Видео от Юрий

–_928EF8EB-B757-744F-A0C8-84FAB99CBB94_
Content-Transfer-Encoding: quoted-printable
Content-Type: text/html; charset=”utf-8″

=D0=A1 =D1=83=D0=B2=D0=B0=D0=
=B6=D0=B5=D0=BD=D0=B8=D0=B5=D0=BC, Best regards,

=D0=AE=D1=80=D0=B8=D0=B9 =D0=A8=
=D1=82=D0=B5=D1=80=D0=BA. Yuriy Shterk.

Tel.&n=
bsp;
+7=
977 6874247

https://polifilm.ru/
https://www.facebook.com/polifilm.ru
The products of POLIFILM in Russi=
a!

=

–_928EF8EB-B757-744F-A0C8-84FAB99CBB94_
Content-Type: video/mp4; name=”VID-20220407-WA0004.mp4″
Content-Transfer-Encoding: base64
Content-Disposition: attachment; filename=”VID-20220407-WA0004.mp4″

AAAAGGZ0eXBtcDQyAAAAAG1wNDJpc29tAAAAGGJlYW0BAAAAAQAAAAAAAAACAAAAAADoj21vb3YA
AABsbXZoZAAAAAAAAAAAAAAAAAAArEQAT7AAAAEAAAEAAAAAAAAAAAAAAAABAAAAAAAAAAAAAAAA
AAAAAQAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMAAI46dHJh
awAAAFx0a2hkAAAABwAAAAAAAAAAAAAAAQAAAAAAT6SDAAAAAAAAAAAAAAAAAQAAAAABAAAAAAAA
AAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAQAAAAAJAAAACQAAAAACN1m1kaWEAAAAgbWRoZAAAAAAA
AAAAAAAAAAAAPAAAG71OVcQAAAAAACJoZGxyAAAAAAAAAAB2aWRlAAAAAAAAAAAAAAAAAAAAAI2M
bWluZgAAABR2bWhkAAAAAAAAAAAAAAAAAAAAJGRpbmYAAAAcZHJlZgAAAAAAAAABAAAADHVybCAA
AAABAACNTHN0YmwAAAC8c3RzZAAAAAAAAAABAAAArGF2YzEAAAAAAAAAAQAAAAAAAAAAAAAAAAAA
AAACQAJAAEgAAABIAAAAAAAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAY//8A
AAAyYXZjQwFkAB7/4QAZZ2QAHqzZgJASbARAAAADAEAAAA8DxYtmgAEABmjpeLLIsAAAAApmaWVs
AQAAAAAKY2hybQAAAAAAEHBhc3AAAAABAAAAAQAAACBzdHRzAAAAAAAAAAIAAA3cAAACAAAAAAEA
AAVOAABO0GN0dHMAAAAAAAAJ2AAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAGAAAAAAEAAAIAAAAADAAABAAAAAABAAAGAAAAAAEAAAIAAAAADwAABAAAAAABAAAG
AAAAAAEAAAIAAAAAFQAABAAAAAABAAAGAAAAAAEAAAIAAAAABQAABAAAAAABAAAGAAAAAAEAAAIA
AAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAACQAABAAA
AAABAAAGAAAAAAEAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAA
AAQAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAGAAAAAAEAAAIAAAAA
AgAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAACAAABAAAAAAB
AAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAQA
AAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAA
AAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAI
AAAAAAIAAAIAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAA
AAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAA
AAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAGAAAEAAAA
AAEAAAYAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAACAAAAAACAAACAAAAAAIAAAQAAAAA
AQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAB
AAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAGAAAAAAEA
AAIAAAAACAAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAA
BgAAAAABAAACAAAAAAMAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAAC
AAAAAAgAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAgA
AAAAAgAAAgAAAAADAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAwAABAAA
AAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAIAAAAAAIAAAIAAAAAAwAABAAAAAABAAAGAAAA
AAEAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAABAAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAQAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAAC
AAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEA
AAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAA
CAAAAAACAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAAC
AAAAAAEAAAgAAAAAAgAAAgAAAAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAA
AAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAA
AAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAA
AQAACAAAAAACAAACAAAAAAMAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEA
AAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAA
BAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAI
AAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIA
AAAAAQAACAAAAAACAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAA
AAMAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAA
AQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAB
AAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIA
AAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAgAAAAAAgAA
AgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAAC
AAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIA
AAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAA
AAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAA
AAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAA
AQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAgAABAAAAAAB
AAAGAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAQAAAQAAAAAAQAABgAAAAABAAACAAAAAAIA
AAQAAAAAAQAABgAAAAABAAACAAAAAAQAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABgAAAAABAAAC
AAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAA
AAAAAQAAAgAAAAACAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAA
AAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAACgAAAAABAAAEAAAA
AAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAA
AQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAYAAAAAAQAAAgAAAAAB
AAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEA
AAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAAC
AAAAAAEAAAYAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYA
AAAAAQAAAgAAAAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAgAAAAAAgAAAgAA
AAABAAAGAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAADAAAEAAAA
AAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAA
AQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAMAAAQAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAAAAEA
AAIAAAAAAwAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAA
BgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAGAAAE
AAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAUAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAA
AAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
BAAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEA
AAgAAAAAAgAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAwAA
BAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAA
AAAAAAEAAAIAAAAABAAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAEAAAQA
AAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAA
AAADAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAA
AAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAGAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAAB
AAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEA
AAQAAAAAAQAABgAAAAABAAACAAAAAAIAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAABAAABAAAAAABAAAI
AAAAAAIAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQA
AAAAAQAABgAAAAABAAACAAAAAAgAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACAAA
AAACAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAA
AAEAAAIAAAAAAgAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAoAAAAA
AQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAAB
AAACAAAAAAEAAAYAAAAAAQAAAgAAAAATAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAALAAAEAAAAAAEA
AAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAAAwAA
BAAAAAABAAAIAAAAAAIAAAIAAAAAAwAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAI
AAAAAAIAAAIAAAAABQAABAAAAAABAAAGAAAAAAEAAAIAAAAAFAAABAAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAUAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAwAABAAAAAABAAAIAAAA
AAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAgAAAQAAAAAAQAABgAAAAAB
AAACAAAAAAIAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEA
AAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAgAAAAAAgAA
AgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAK
AAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAYA
AAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAIAAAA
AAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAA
AQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAMAAAQAAAAAAQAACAAAAAACAAACAAAAABgA
AAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAAEAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAwAABAAAAAABAAAG
AAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYA
AAAAAQAAAgAAAAAFAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAGAAAEAAAAAAEAAAoAAAAAAQAABAAA
AAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAA
AAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAAB
AAAGAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAoAAAQAAAAAAQAABgAAAAABAAACAAAAAAQA
AAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAgAAAAAAgAA
AgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAACgAABAAAAAABAAAG
AAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAMAAAQA
AAAAAQAABgAAAAABAAACAAAAAAMAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAGAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAA
AAEAAAIAAAAABAAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAA
AQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAAB
AAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAEA
AAQAAAAAAQAACAAAAAACAAACAAAAAA4AAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAAFAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAA
AAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAACgAABAAAAAABAAAKAAAA
AAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEA
AAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAA
AAAAAAEAAAIAAAAAAgAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAA
AAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAA
AAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAA
AAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAAB
AAACAAAAAAIAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEA
AAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAA
BAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAI
AAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIA
AAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAA
AAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAA
AAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAAB
AAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEA
AAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAABAAA
BAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIA
AAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAA
AAABAAACAAAAAAIAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAgAAAAAAgAAAgAAAAACAAAEAAAA
AAEAAAgAAAAAAgAAAgAAAAAEAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAAB
AAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEA
AAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAA
CgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAE
AAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAA
AAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAA
AAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAA
AAIAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIA
AAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAgAA
BAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAMAAAQAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQA
AAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAoAAAAAAQAABAAA
AAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAA
AAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAACAAAAAACAAACAAAAAAEA
AAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAA
AAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAK
AAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAMAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAA
AAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAA
AAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAA
AQAABAAAAAABAAAGAAAAAAEAAAIAAAAABgAABAAAAAABAAAGAAAAAAEAAAIAAAAABAAABAAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEA
AAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAGAAAEAAAAAAEAAAYAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAJAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAK
AAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIA
AAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAA
AAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAA
AAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEA
AAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAK
AAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAA
AAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAA
AAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAA
AQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAAB
AAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEA
AAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAA
CgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAA
AAAAAAEAAAIAAAAABQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQA
AAAAAQAACAAAAAACAAACAAAAAAMAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAA
AAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAACAAAAAACAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAAB
AAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEA
AAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAA
AAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoA
AAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAA
AAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEA
AAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAA
BAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAgA
AAAAAgAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACAAA
AAACAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAA
AAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEA
AAIAAAAAAwAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAMAAAQAAAAAAQAA
CAAAAAACAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAA
AAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAA
AAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAAB
AAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEA
AAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAA
BAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIA
AAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAA
AAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAA
AAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAA
AQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEA
AAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAA
BAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAwAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAA
AAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAFAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAA
AAEAAAIAAAAACQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAA
AQAACAAAAAACAAACAAAAAB4AAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAF
AAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAACAAAEAAAAAAEA
AAYAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAEAAAEAAAAAAEAAAYAAAAAAQAA
AgAAAAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAEAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAADAAAE
AAAAAAEAAAYAAAAAAQAAAgAAAAADAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAGAAAEAAAAAAEAAAYA
AAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABgAA
AAABAAACAAAAAAIAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAA
AAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAA
AQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAAB
AAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEA
AAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAADgAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAA
AAAAAAABAAACAAAAAAMAAAQAAAAAAQAABgAAAAABAAACAAAAAAUAAAQAAAAAAQAACAAAAAACAAAC
AAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIA
AAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAAAwAABAAA
AAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAA
AAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAYAAAAA
AQAAAgAAAAAFAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAAB
AAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAMA
AAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAAC
AAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAMAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAA
AAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAMAAAQAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAA
AAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAMAAAQAAAAA
AQAACAAAAAACAAACAAAAAAEAAAgAAAAAAgAAAgAAAAADAAAEAAAAAAEAAAoAAAAAAQAABAAAAAAB
AAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAIAAAAAAIA
AAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAYAAAAAAQAA
AgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAMAAAQAAAAAAQAACAAAAAACAAAC
AAAAAAQAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAYA
AAAAAQAAAgAAAAAGAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAA
AAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAKAAAA
AAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAABoAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAAB
AAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAIAAAAAAIA
AAIAAAAABAAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAEAAAE
AAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAABAAABAAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAA
AAAFAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAKAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAADAAAEAAAA
AAEAAAYAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAoAAAAA
AQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEA
AAgAAAAAAgAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAACAAAAAACAAACAAAAAAEAAAgAAAAAAgAA
AgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAAC
AAAAAAIAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAJAAAEAAAAAAEAAAoA
AAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAA
AAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAAGAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAADAAAEAAAA
AAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAIAAAAAAIAAAIAAAAA
AgAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAAB
AAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAKAAAAAAEA
AAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAIAAAQAAAAAAQAA
CAAAAAACAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAIAAAQAAAAAAQAACAAAAAACAAAC
AAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAYAAAAAAQAAAgAA
AAAGAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAA
AAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAoAAAAA
AQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAACAAAAAAC
AAACAAAAAAoAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEA
AAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAwAABAAAAAABAAAGAAAAAAEAAAIAAAAACwAA
BAAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAAC
AAAAAAMAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQA
AAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAA
AAABAAAAAAAAAAEAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAA
AAEAAAIAAAAAAgAABAAAAAABAAAGAAAAAAEAAAIAAAAABAAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAAO
AAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAABQAABAAAAAABAAAGAAAAAAEA
AAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAHAAAEAAAAAAEAAAoAAAAAAQAA
BAAAAAABAAAAAAAAAAEAAAIAAAAAAwAABAAAAAABAAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQA
AAAAAQAAAAAAAAABAAACAAAAAAQAAAQAAAAAAQAABgAAAAABAAACAAAAAAUAAAQAAAAAAQAABgAA
AAABAAACAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAGAAAA
AAEAAAIAAAAABgAABAAAAAABAAAGAAAAAAEAAAIAAAAABAAABAAAAAABAAAGAAAAAAEAAAIAAAAA
AQAABgAAAAABAAACAAAAAAcAAAQAAAAAAQAABgAAAAABAAACAAAAAAMAAAQAAAAAAQAABgAAAAAB
AAACAAAAAAQAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEA
AAgAAAAAAgAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAACAAAAAACAAAC
AAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIA
AAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAYAAAAAAQAAAgAA
AAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAGAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAA
AAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAAB
AAAIAAAAAAIAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEA
AAYAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAA
AAAAAAABAAACAAAAAAEAAAQAAAAAAQAACAAAAAACAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAAC
AAAAAAYAAAQAAAAAAQAACAAAAAACAAACAAAAAAUAAAQAAAAAAQAACAAAAAACAAACAAAAAAQAAAQA
AAAAAQAACAAAAAACAAACAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAA
AAABAAAIAAAAAAIAAAIAAAAABgAABAAAAAABAAAGAAAAAAEAAAIAAAAAFQAABAAAAAABAAAGAAAA
AAEAAAIAAAAAAwAABAAAAAABAAAGAAAAAAEAAAIAAAAADQAABAAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAAC
AAAEAAAAAAEAAAYAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEA
AAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAwAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAA
AAAAAAABAAACAAAAAAIAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAIAAAAAAIAAAIAAAAAAQAABgAAAAABAAACAAAAAAEAAAQA
AAAAAQAABgAAAAABAAACAAAAAAMAAAQAAAAAAQAABgAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAA
AAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAgAAAAAAgAAAgAAAAABAAAKAAAAAAEAAAQAAAAA
AQAAAAAAAAABAAACAAAAAAQAAAQAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAAC
AAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAgAABAAAAAABAAAKAAAAAAEA
AAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAABgAAAAABAAACAAAAAAIAAAQAAAAAAQAA
CgAAAAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAoAAAAAAQAABAAAAAABAAAA
AAAAAAEAAAIAAAAAAwAABAAAAAABAAAGAAAAAAEAAAIAAAAAAgAABAAAAAABAAAIAAAAAAIAAAIA
AAAABgAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAgAABAAAAAABAAAIAAAA
AAIAAAIAAAAAAwAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAoAAAAA
AQAABAAAAAABAAAAAAAAAAEAAAIAAAAAAwAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAAB
AAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEA
AAYAAAAAAQAAAgAAAAABAAAGAAAAAAEAAAIAAAAAAQAACgAAAAABAAAEAAAAAAEAAAAAAAAAAQAA
AgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAIAAAQAAAAAAQAACgAAAAABAAAE
AAAAAAEAAAAAAAAAAQAAAgAAAAABAAAKAAAAAAEAAAQAAAAAAQAAAAAAAAABAAACAAAAAAEAAAQA
AAAAAQAABgAAAAABAAACAAAAAAQAAAQAAAAAAQAABgAAAAABAAACAAAAAAcAAAQAAAAAAQAACgAA
AAABAAAEAAAAAAEAAAAAAAAAAQAAAgAAAAACAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAIAAAA
AAIAAAIAAAAAAQAABAAAAAABAAAIAAAAAAIAAAIAAAAABQAABAAAAAABAAAGAAAAAAEAAAIAAAAA
AgAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAABAAAAAABAAAGAAAAAAEAAAIAAAAAAgAABAAAAAAB
AAAGAAAAAAEAAAIAAAAABwAABAAAAAABAAAGAAAAAAEAAAIAAAAAAQAACAAAAAACAAACAAAAAAEA
AAYAAAAAAQAAAgAAAAAaAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAABAAAEAAAAAAEAAAYAAAAAAQAA
AgAAAAAHAAAEAAAAAAEAAAgAAAAAAgAAAgAAAAAUAAAEAAAAAAEAAAYAAAAAAQAAAgAAAAACAAAE
AAAAAChzdHNjAAAAAAAAAAIAAAABAAAACgAAAAEAAAFjAAAACQAAAAEAADeIc3RzegAAAAAAAAAA
AAAN3QAAOUEAAAFXAAAAYAAAAFgAAAAjAAAUPQAAAOkAAA9SAAAW2wAAEHcAAAIsAAANKQAAC9kA
AAyKAAAPIgAADcgAAASHAAAQqQAAC8IAAArFAAABVgAAFE4AAAOVAAAQDAAADl0AAA57AAAT4gAA
FdgAAANhAAAODgAACd0AABCIAAAUpAAAE7UAAALPAAAWcgAAEuAAAAC6AAAZ3gAAEssAAATHAAAS
FwAAC70AAA1dAAASlQAADI4AAAV3AAAJ5wAACkgAAAxyAAANtwAADRYAAAJ6AAAM+wAACzwAAAnJ
AAAPhAAAC9UAAAI8AAAa4AAABJUAAAtOAAAREQAAFIMAAAKEAAANtwAADhMAAACqAAAW8AAADNEA
AALZAAAAjAAACzkAABKvAAAQ4AAAAHYAAA/6AAARWQAADm8AAA+cAAAVOQAACn0AAAjYAAANywAA
DZwAAA2QAAAAjAAAE/kAAAYBAAAPSgAAAiAAAA5KAAAAwAAADGYAAAKoAAAI6gAADLwAABE4AAAA
iwAAFgAAAAZ+AAAEdAAAD3IAAAC/AAAeeAAAH+QAABMzAAAArwAAHGgAAA+lAAAAdwAAC0MAAAzt
AAAGCwAAC9YAABD7AAAPjgAADkgAAAI4AAAlCAAACeUAAAnQAAAREQAAAL8AAAy6AAAEKAAADiMA
AADJAAAIwQAACvUAAAkIAAACmwAAIDgAABIHAAAPqQAAIKsAAA63AAAhlAAAF6MAAADgAAARKwAA
GtgAABZ1AAAAiwAAAYQAAB0pAAAvTwAAF8UAAA//AAAaTQAAANoAAAVDAAAPTgAAOEIAABZIAAAQ
lQAAANkAACwQAAAYEwAAD6QAABGNAAAG2AAALIsAAA32AAAY3gAAAEoAABiwAAAEDwAAEdwAABox
AAAAXQAADn8AABdSAAADZwAAEeQAABQ0AAANjQAAGooAAAY0AAArUwAAAPgAAAnzAAAmeQAABl4A
AAbbAAACwAAAEOAAACHDAAAGggAAAgsAAAoaAAACqgAADfoAABNnAAAc6QAAB3EAABdqAAAAqQAA
CmAAAAkXAAABEAAAEM8AABUgAAAC3QAADn4AAAHeAAAOCwAACzMAAAxFAAAFhgAACUAAAAgXAAAU
egAAFKQAACKxAAAO3QAAAGgAAAXMAAASWAAAGw0AAAWIAAACNAAAD0EAAA86AAAgpAAABWIAAASB
AAADXgAAGCkAAAKoAAABhgAACvgAAAQVAAADRwAACOMAAAtMAAAMEgAAEboAAAHBAAAfaAAABOQA
AAMNAAABLAAAFbkAAASSAAAOygAAArsAAAHgAAAI+QAACVEAAGygAAARiQAAA0MAAAGRAAACngAA
C7AAAAKbAAAKUAAADhsAAAKCAAAJwwAACl4AAARtAAAO7wAAArYAAAG5AAALTwAAC0gAAAFqAAAS
OgAAA3UAAAqTAAAMlgAADlYAAAA/AAALKAAADCwAABEVAAAT/AAAGhAAAAyxAAAAUQAABhcAABDq
AAARDwAAGDIAAAPqAAAGfwAAAIYAABNcAAACLwAADAAAAAVdAAAQhAAAA8AAAAHpAAACBwAAHkcA
AAPuAAAAvwAAAu4AAB6fAAAFAgAAAqwAAA4iAAAAgQAACEkAABG7AAACZAAAAkwAAAHwAAAIcAAA
AGQAAAdMAAAMtQAAAisAAA4QAAABegAAAesAAA1JAAAKlAAADiMAAABfAAAb0wAABl4AAASTAAAD
PAAAC18AAAMdAAAAaAAAELEAAAJKAAAL6AAAD+cAAAT4AAAAkwAAFDwAAALyAAABvwAAEokAAASE
AAAAhAAAAHcAABKxAAAFgQAAAMgAAA4FAAAAjgAAEZYAABPqAAADbwAAA0YAAAO9AAANkAAAA8gA
ABc0AAAEEAAABQMAAAC9AAAdLQAACHYAAAOnAAACywAAFFMAAABqAAAB0gAAGBoAAABiAAAMtwAA
G1UAAABUAAACIwAAE3cAABfoAAAEoAAAAKoAAAH4AAAZ3QAAA+wAAAB7AAAC3QAADHUAAADBAAAA
YwAAFjwAAAMcAAACQAAAAY0AAAxHAAABmAAAAG4AABX4AAAC0AAAAqYAAAxxAAABngAAAKcAAAGi
AAAOZwAAAp8AAAGcAAAAaAAAEkkAAAQhAAABmQAAAwYAABVYAAABswAAEHsAABZ8AAAD1QAAAmcA
AAIHAAAEMQAAEWYAAAMqAAACFwAAAYEAAB5rAAADcAAAALIAAAHHAAAR0gAAAicAAAHdAAAFAQAA
DogAAAKmAAABhgAAAaIAAAmbAAAFSwAAEaEAAAS6AAAB/gAAAq8AAA2hAAABtQAAE0gAAAN+AAAC
GAAAEh0AAAIDAAAEZgAAEjgAAAJyAAACPQAADpUAAAGsAAAC1AAAEYkAAALnAAABaAAAAVQAABKx
AAAAWQAAEukAAAQsAAACSwAAAzEAABKqAAADjgAAAmwAAAJgAAAOSwAAAe0AAAHVAAAP8AAAAzIA
AAHFAAABwgAAGIMAAAF7AAAaJgAAAdEAABvhAAACKwAAHAIAAAOKAAAA7AAAAl4AAAzwAAABegAA
DusAAAQMAAAQhAAAAfUAABXfAAADygAAAngAAAR4AAAO2AAAC1UAAAuyAAARaQAAAloAAAUoAAAL
CQAABAEAAAF3AABv5QAAB+UAAAI3AAAKxwAAFNUAAAPYAAACgAAAAc8AAATWAAAP5gAAAsYAAAIR
AAANMwAAAXAAABfaAAAATAAAC9EAABbXAAADbAAAAdAAAALSAAAUhAAAA40AAAHLAAAB3wAADRkA
AAKvAAANdAAAAewAAAE+AAAO2AAAAbQAAAIFAAASRAAABCwAAAI4AAACOAAAC6IAAASCAAAcagAA
BBYAAAKOAAAB1wAAFhQAAAP/AAABEgAAAdcAAAzfAAAReAAAAksAAALzAAAWWQAAA0kAAAHJAAAS
ggAAAfYAAAOtAAAU5AAAApkAAAGgAAABUQAAEY0AAAP7AAAAiQAAAGMAABHKAAAC2gAAAg8AAAx3
AAACFQAAAJgAAABxAAAIigAAD90AAAI3AAATUAAAA44AAABOAAAB+gAACqoAAABZAAACwgAABC4A
AA6lAAALuQAAAFoAAA0WAAALdgAAAFcAAAvDAAALKAAAEZ0AAAJUAAACugAACFsAAA5eAAAQiAAA
AtwAAAKeAAAZ/wAAAGgAABK2AAAB1wAAHTAAAABfAAAAVwAADsUAABADAAAQTwAAFUUAAAYwAAAE
ngAAAPYAAB5lAAACIAAAHB4AAAIyAAAcdgAAAwgAAACCAAACSQAAD5sAABDkAAAILwAAGroAAARy
AAACAgAAAqIAAA8dAAAErAAAEHEAAA4xAAABPAAAD+EAAAGFAAACqAAAC6IAAA3oAAAUMgAAA4oA
AAFqAAADQQAAFp8AAANdAAACGwAAEiUAAAMGAAACAAAAFSEAAATnAAACeQAAA08AAAmgAAAB+wAA
CkEAAA4aAAAM2QAADBwAABxmAAAFigAAAIoAAAXOAAAKFAAAFhkAAAM0AAAEWgAAAQIAABCQAAAM
PwAAEVEAAAHgAAAMCgAAGWMAAAb4AAAEEgAAA4sAAAJQAAAakAAABq8AAAPsAAADpgAAFfoAAAZB
AAAAxAAAAEEAAApOAAAPJQAAF48AAAlIAAAAfwAAA8MAAArXAAANQgAAD48AAAM/AAAVFQAAA3MA
AAKkAAAB4AAAC4UAAAT8AAAXMAAAA+wAAAH2AAACWQAAEd0AAA7/AAABBQAAExwAABKOAAACvwAA
AnUAAAV5AAAMlgAAFDQAAAUAAAACxAAAAukAAAKkAAAKJAAAEzEAABmjAAAEZgAAA20AAAE1AAAP
oAAAAn8AAAGzAAABIwAACFUAAAQkAAAJGwAADTsAAAvoAAAAawAAECkAAAH2AAABmwAAEOYAABMC
AAACzwAAAfEAAAJuAAAREwAAAmsAABKnAAADxwAAAIQAAALTAAAOtgAAYzcAABknAAACrgAAAmwA
ABC/AAACeQAAAJQAAAG5AAAQBQAAAfEAAAJgAAAXswAABHQAAACZAAAWLwAAAGAAABYjAAAAgAAA
GekAAAQvAAADDwAAAl4AAAUrAAASeAAAAqQAAAKjAAAKKwAAAKcAAAK3AAAaewAAAsoAAA/AAAAV
aAAAA1EAAALRAAALKgAAGcAAAAX7AAAC8AAAA1UAAAaXAAAYDgAABXEAAAJ9AAACvgAADuMAAAKg
AAAOwQAADk0AABeDAAADPAAAAf0AAAKTAAAS6wAABjQAAABqAAAC5gAAC/UAAArhAAAAlQAADhsA
AAv3AAAQdAAAC3kAAAt9AAACFwAADqEAAApZAAARqwAAA38AAAJKAAAFkwAAE4wAAAL6AAADHgAA
E9QAAAK+AAABZwAAFE0AAAZRAAADvwAAAxUAABAYAAADwgAAGG8AAAYLAAAEywAAEr4AAAR+AAAb
SAAACh4AAADYAAAF1AAAFIEAAASEAAAB6AAAGTcAAAbCAAAVxgAABI0AAAIeAAALiwAADNwAABN4
AAAQGQAADM4AAAMMAAAT5AAAFAUAABKxAAAUKgAAESoAAALIAAANDwAADZ0AAA2+AAALhQAAB1AA
AAWKAAANugAAAuUAAA9yAAALwwAAD5sAAANRAAAOogAADeAAABeQAAAOSwAADsYAAAJEAAARYQAA
HjcAAAjIAAAFjQAABTwAAAHeAAAOUgAAFdYAAAXFAAAPBwAAEWcAAAI/AAAYXAAABvAAAAbPAAAU
+QAAEAUAAAKOAAAhJAAABKcAABNiAAAn8AAABCQAAABbAAAP4gAADT4AAA+uAAAOIgAAEY4AAAHi
AAAAYAAAEMcAABA4AAAMlwAACRYAAAbqAAAMpwAADZsAAAqCAAAQOwAADl4AAAIxAAALYQAADOgA
ABARAAAHTwAACAcAAAfyAAAOLQAACMEAAAvyAAARsAAAAz8AAAB3AAACDAAADdkAAArUAAAHmgAA
CbMAAAI/AAAWuAAABLQAAAJ4AAACjQAADlEAAAKSAAAWYwAABeUAAAHeAAAC9AAADLgAAAV1AAAM
NAAAF8IAAAKQAAADPQAADAYAAAC8AAAUQAAABQIAAAFmAAACtAAAEfsAAACGAAABJwAAIY0AAAcs
AAAeAAAAHxUAAARnAAAkVwAAETkAABqAAAATlwAAFIkAAATYAAAAogAAFCEAAA3gAAAkAQAABDwA
AAKdAAACSAAAHyQAAANdAAAAiAAAAvUAABE1AAAaxAAAAZMAAAJPAAAWGwAAANYAAAJAAAADVQAA
FnwAAAMCAAABrgAAAeQAAIeNAAAChgAAEs8AAAMjAAAB7QAAAbwAAAv8AAAD0gAAEWEAAAJyAAAC
GAAAErEAAAG3AAAEUgAAEIkAAAMOAAABxwAAAg0AAB+cAAADHgAAAWMAAAHGAAAU8AAAAr8AAAI/
AAAFuAAADHgAAAKnAAABjgAAFpkAAA3PAAADPAAAAGMAAAwIAAARzwAAA7kAAAIzAAAB/gAAD9oA
AAMQAAACCQAAAccAAAutAAACIgAAAPgAAAFtAAAMLwAACKkAAAG4AAAPgQAAA1cAAAK+AAALsAAA
FsAAAAX1AAAHfAAAB4MAAAjZAAAT5wAADJkAAAPuAAALtgAACykAAA6vAAAPaQAACxAAAAVRAAAG
/QAABwgAAAg6AAAIGgAACXMAAAOIAAAIUgAACJMAAAjqAAAMJwAAAkMAAAMnAAASJAAACFkAAAQI
AAACfAAAFFsAAAMNAAAJAwAAEqAAACfyAAASfAAACmUAAB6eAAAAyAAAAF4AABeXAAAY7AAAEVwA
ABRzAAAA4AAAE/oAAAJPAAAPNQAAAM8AAAUmAAALsQAAAIIAABHvAAAPGAAADisAAA1cAAAMzAAA
EYwAAAB1AAAMWAAAEvEAAAt6AAABkAAAB2EAABFgAAAjMgAAEMsAAAB4AAAAsQAAHgMAAAyjAAAG
MAAABtAAAAKwAAAAgAAABOoAAB0pAAAEGgAAErAAACJOAAAl4wAAGpkAAAB6AAADZQAAIsYAAClc
AAAGlAAAAMIAAEUFAAAUCwAALRgAAAdbAAA16AAAA+0AAANPAAAIqQAACqEAABbMAAAGqwAADLIA
ABXkAAASowAAGkcAAAfNAAAHLgAAGzcAAAKyAAALhwAADWQAAA63AAAFRgAADtsAAAHiAAAr9wAA
AzIAABL8AAACUgAAJmMAAAtkAAAAvAAAKRAAAAC/AAADIgAALuoAAAHJAAANnQAACacAAAsuAAAE
YQAAFG4AAAxYAAASYwAADx4AABouAAACaAAAEw4AABI9AAAB+wAAG3IAAAQZAAAD6QAAGwQAAAYK
AAAC/AAADZoAAAuhAAACnwAAFvAAAAIiAAAPTAAADxEAACm1AAAQiQAAAswAAAD4AAABTgAAFlcA
AAHtAAARTQAAAMcAABJ0AAABYwAADj4AAACIAAANNQAACwEAAAyHAAAUGQAAFdkAAAW5AAAA0QAA
AfMAAAxsAAARvgAAAtIAAAINAAABDwAAEpwAAAKZAAACaQAAAY0AAA5fAAACNwAAAN8AAAIwAAAR
igAABN0AAADEAAAJZgAADUgAAAJBAAABUAAAEIsAAAHXAAAMZwAADK8AAAs3AAAMyQAADPQAAAIi
AAAQOQAADq4AAA9yAAANswAACEoAAAYLAAAb9gAAA9kAAAJFAAABqgAAEj8AAAONAAAJ5AAACucA
AA0SAAAdzAAAB1cAAASMAAAWZgAAA9kAAAJiAAAB8gAAEQkAAAKxAAABDwAAAU4AABW6AAACIQAA
BJgAAADRAAAKrQAADkwAAAIMAAAB/gAAAT4AAAMJAAASIgAAA50AAAJyAAACOwAAD8AAAAKiAAAI
sQAACawAAA6JAAAK9wAAD1cAAARUAAALBQAADgAAABjMAAAEIAAAArkAAACAAAAQKwAAAkUAAAGh
AAABVQAAEC4AAAH6AAAAuwAAAcUAABwgAAACjwAAEa8AACOkAAACjwAAAN0AAAKLAAAVSAAAAkYA
AAQsAAATrAAAArcAAAHPAAABmgAAEMUAAAJ3AAAAuAAAAfAAABMOAAACxQAAAIkAAAHyAAAWzQAA
A8sAAAH1AAACqAAADNAAAASEAAARqAAAAskAAAH4AAAPNAAAASIAAABgAAAAiwAAHVcAAAOfAAAC
MQAAAdYAAAg2AAAAxwAADkkAAAJEAAABpAAAAYYAAA50AAACkQAAAPcAAAGxAAAF/gAADgsAAAHX
AAAEBAAADuUAAAJcAAABtQAAAUUAAAgcAAAB5gAADZMAAAG6AAAFrgAADzoAAAHyAAADGAAAG/UA
ABTpAAADSAAAAggAAAHLAAAQ1gAAAl4AAADIAAABagAAEQEAAAJjAAB0+QAAD94AAALQAAACTgAA
AZ8AABIZAAADLgAAAL4AAAIQAAAO/wAAAikAAAIWAAAPlwAAAsoAAADyAAAB1gAADgkAAAGGAAAC
sAAAEXQAAAJ2AAABgwAAAWcAAA/iAAAC6wAAAOcAAAJAAAAPjwAAAjwAAAMTAAAPiQAAAsQAAAJ+
AAAB7AAACsgAABBDAAADIQAAALwAAAIoAAAOswAAAd8AABGSAAACgQAAAH4AAAGGAAAK3wAAAUAA
AASiAAAdAQAABTsAAALKAAACPgAAEHIAAAKDAAAWvwAAA5MAAAG+AAACBAAACxkAAANIAAAV/QAA
AgEAAAPzAAAW/gAADL4AAAbeAAAaygAAAzoAAAHpAAABdAAACeIAABMMAAADrQAAAUsAAAJqAAAQ
sAAAAlMAAAQ9AAAP2wAAAaAAAA9SAAACsAAAAK4AAABiAAAQ6AAAA3UAAABrAAAB+AAABZoAAAXS
AAASAgAAAtIAAAIeAAAM6gAAAFMAAAA7AAALvAAADFMAABHiAAADPQAAAnsAAAJAAAALpwAACuUA
AA1jAAAOiAAAAhMAABp9AAABOgAAAH0AAANaAAAfzQAAAb0AAABWAAADKAAAEWEAAALZAAABvgAA
AaoAABDAAAAC+wAAAf0AAAChAAAHQgAADtUAAAHGAAAEkwAAESAAAAJaAAACZwAAAH4AABMjAAAH
dgAAARMAAAOaAAATFQAAFQ4AAAHSAAAC7gAAGsoAAANvAAAB/QAAAd8AABJNAAACWwAAAJoAAAHY
AAALywAAAesAAAPkAAAQ5QAAAlAAAAI4AAAMWAAAAb8AAAZLAAAArQAADjkAAAJnAAABaQAAAdwA
AAs1AAAEUgAADOgAAAHqAAABlgAADY8AAAHrAAAaGAAAAvcAAAC8AAABIAAAFNwAAAK8AAAB2wAA
ASkAAA95AAAClQAAAe4AAADSAAATbQAABEEAAAILAAAB4gAACiMAAAW7AAAQlAAAAlEAAAJLAAAA
rAAADlAAAAHMAAABzAAACuoAABvxAAADigAAAoIAAAGOAAAEMQAAEIQAABFPAAAVtwAAAnEAAAB8
AAAAuQAAFD8AAAL9AAABuwAAAcUAAAggAAAGUgAAExMAAAOFAAACPgAAAhYAAA3oAAADqwAAB+gA
ABKyAAADEQAAAnsAAAGTAAAOgwAAAlAAAAD6AAABkAAAIRMAAAQoAAABtQAAAN4AABWnAAADEgAA
AwoAAAHjAAARMAAAAkEAAA1OAAAKOgAAAF8AAA92AAAB7wAAEBAAAAI3AAAAiwAAAgMAAAtgAAAC
ggAABPcAAAKMAAABtwAAelEAAA6ZAAAC6AAAARUAAABpAAATaQAAA1MAAAKdAAAAyQAAGaoAAANF
AAACLwAAAdkAAAXSAAAOuwAAAfUAAACmAAABsAAACZMAAAKUAAAKMwAAEYYAAAMMAAACNwAAAcUA
AAQAAAAAggAAFJgAAANrAAACKwAAAeYAAAQqAAARWgAAApwAAAIZAAAKCQAAAcgAAAB7AAAAlQAA
G2QAAAaqAAACFAAAAlQAAAMmAAARkgAABHsAAAOkAAAZ7QAAEKwAAADwAAAWIwAAFuEAABQdAAAN
BwAADmcAAAU8AAAMxwAAAGUAABF1AAAMcQAAEKEAAAKYAAATcwAAAvUAAAJfAAAArAAAELwAAAIM
AAABvAAAAJQAABMlAAAESwAAAvEAAAB+AAAOJgAAD2gAAAsdAAAHiAAADVkAAALAAAAQaAAAAoEA
AAy1AAAOhAAAAgkAAAOGAAAL4gAAC/AAAAtkAAANzwAADK4AAAQEAAAMYQAADQAAABDHAAACYwAA
AaAAACCxAAABxwAAAJ0AAAMeAAAWGgAAAh0AAAP9AAAAjQAAE/8AAAMLAAAB+QAAAkEAABKXAAAD
SAAAAPMAAAHYAAAShgAAAxQAAAH7AAACDgAADs8AAAMiAAAAeQAAAacAAA5UAAAEFQAAE0sAAAOW
AAACPQAAAfEAAAwkAAAAcAAADrsAABWuAAADswAAAnUAAAHUAAAPGAAAAgEAAAD+AAABswAAEN8A
AALsAAABRAAAAYcAABEEAAAC0gAAAlEAAADfAAAIngAABSIAAAnzAAALDQAAARoAAAJ0AAALBgAA
AZwAAAulAAAAoQAAAVcAAAPCAAAX9AAAA6YAAAD0AAABzQAAJvYAAAJnAAABfwAAIIsAAAOlAAAA
eQAAAvEAABGBAAAArwAADt4AABibAAACmAAAAk4AAAEiAAAFEAAAFR4AAAMaAAACLgAAAagAABF/
AAACvwAAAP8AAAFmAAARNgAAAiMAAAHVAAAC3wAAE4EAAAMYAAACMAAAASgAAAnBAAAK+gAADyIA
AAJeAAABUgAAAakAAA4IAAACeAAAAMEAAAH7AAANygAAAZIAAAOwAAAOGQAAAskAAAHHAAAByAAA
CmgAAAT1AAAQ7gAAA8sAAAKTAAACDgAAC6kAAAPoAAAY4AAABK4AAAHIAAACOgAAEGgAAAStAAAI
WQAACkQAAAwRAAAShQAAApgAAAKNAAABBQAAC9wAABDzAAACtgAAAfkAAANNAAALqAAADDEAABGx
AAACDAAAAsoAAADSAAAQHwAAAvEAAAG7AAAAqgAACy0AAAVFAAACyAAAAcEAAHAJAAAJDQAAAGIA
ABFZAAADVQAAAb0AAAIhAAAOvwAAAiMAAACiAAAkkQAAAz0AAAHpAAACGwAAEsYAAADGAAAT8gAA
AJIAAAvrAAAAdwAACQIAAAwMAAAAzwAADNwAAABXAAAULAAAAzUAAAGPAAAcRwAAA8oAAAEAAAAB
+QAAGXYAAAJzAAACCwAAAR0AABJtAAAC8wAAAewAAAB9AAAQFgAAAr8AAACDAAABUAAAEHQAAAKm
AAAAiAAAAaIAAA6VAAACNwAAAf0AAAC1AAAKOAAAENcAAAKZAAABsAAAAY8AAAQFAAATnQAAAtUA
AAHDAAAYDgAAAecAAACpAAAA6AAAD88AAAFFAAACNAAAAHsAAApMAAACWQAAEacAAAJ4AAAFUgAA
DTsAAAHZAAABqwAAAKUAAA/tAAACjgAAAgcAAAF9AAAN7wAAAoEAAADMAAABlgAAC2cAAAHFAAAX
EQAAAxcAAADmAAAB7QAAE/AAAAJVAAAC2AAAEfsAAALsAAACKwAAAZQAAA+3AAACJwAAAYQAAAFP
AAAPwgAAAgMAAAGTAAADlQAAHnsAAANBAAABxQAAAkwAABLuAAADoAAAAVcAAB/QAAADTgAAAbkA
AAJsAAAWPgAAAPkAABq5AAACxAAAAdwAAAGuAAAGHAAABrsAABLVAAADFwAAAasAAAG8AAAPtAAA
AlEAAAFlAAABqQAADQcAAAIsAAAA+QAAATUAAA06AAACLgAAAX8AAASiAAAHQgAACQEAAAGfAAAK
pwAACJcAAASbAAAlvwAAAfsAAANeAAASggAAAocAAAiIAAAKIQAACfMAABAEAAABsgAAAUIAAAbU
AAAP5QAAAeMAAAHHAAARNAAAAlMAAABrAAABCwAAEfMAAAKfAAABvQAAAdoAAA6tAAAClAAAANcA
AAGZAAANCQAAAm4AAAHbAAAA0AAAEb0AAALqAAACLQAAAXMAAA0OAAACQAAAAPQAAAGZAAANcAAA
AdkAAAO8AAAQcAAAAyoAAAH9AAACNwAACfUAAADeAAAScQAAAscAAAF1AAAB+gAADwQAAAMyAAAW
nwAAAksAAAKdAAAPCAAAJXsAAARSAAABIgAAAjAAACB7AAAA6wAAAtYAAA/6AAADQgAAAOkAAABi
AAAQKwAAA4gAAACkAAAB6QAACHcAAAz5AAABvAAAAdoAAA2FAAABTwAAAG8AAAJnAAAKeQAADkAA
AAP0AAANMwAAAFgAABPIAAAESQAAAc4AAAiaAAAAqgAAAIgAAA7qAAAOhgAAAyYAAAB6AAAAdgAA
GRUAAAe6AAAAxgAAAlIAAAM8AABrHQAAC5oAAABQAAATaAAAAtUAAAIaAAAFCQAAE7QAAAR3AAAB
wQAAA1QAAAfrAAANQwAAAwQAAADcAAAB0QAAC4YAABx2AAAG4wAAATUAAAPQAAATmgAAA2QAAAMt
AAASgAAAA0IAAADoAAACTAAAEa8AAALrAAACHQAAAOQAABTzAAAEgwAAAh8AAAKgAAANzgAAAYEA
AAIeAAAJkQAAElYAAAN6AAACJAAAARcAAAtpAAABzgAADb0AABPWAAACxgAAEukAAAPZAAACQQAA
AdQAAA/FAAACHgAADOIAAAiiAAAMYwAADCQAAAxbAAACFAAAB8EAAAr/AAAKPAAADXgAAA2wAAAA
YAAAFAgAAAgYAAAMAgAADP4AABN9AAAAdQAACkkAAA1CAAAOrAAADyIAAA5MAAAdCQAACi4AAAQ/
AAADkAAAEv4AAAMlAAALWgAADioAAAtCAAAKwQAADwEAAAIdAAAPHwAAFzQAAAVKAAACmwAAAp8A
AAP3AAAN4wAAAowAAAGeAAAJHQAACt0AAAJoAAAPrwAAENEAAA+jAAAOygAAF0cAAAHVAAANIgAA
DloAAA6bAAAObAAAIeIAAALKAAAOlgAADW4AAA/HAAAPsQAAD9YAAAM2AAANHgAADDQAAA5qAAAL
1QAAFzMAAANUAAAJ+wAADE4AABDQAAAePgAABfEAAAUYAAABrgAACNkAAAzPAAARogAAE1cAAAK0
AAAoNgAABUQAABiPAAAV1wAAAHoAAB/mAAAXCAAAEc4AAAKIAAANsAAAD5sAAAJIAAAAYwAAEQgA
AAzTAAALzAAAEJ4AABDbAAAAkgAADrIAAA5HAAAVSAAABKAAAANpAAAJBgAAC7AAAAyYAAARlQAA
AIUAAAVuAAAJ4AAACo4AAA8uAAAB7AAABf4AAAmQAAALogAADOAAAAHWAAAJXAAADe0AAAK/AAAL
DgAADJUAABAFAAAMlwAAAFQAAA7FAAABnwAAEnUAAAK7AAAFRgAAAKgAAAklAAAAbwAACcwAAAlG
AAANWgAAAysAAAH2AAAA8QAAGyAAAAB7AAAVFwAABN0AAAJaAAAAoAAAFBUAAANWAAACrAAABu4A
ACWVAAAFWAAAAIsAAAedAAAuzwAAA/MAAAIeAAAAjgAAL7EAAAN5AAACpgAACLQAAA+jAAACpAAA
FxwAAAWcAAAEcAAAA3YAAA4vAAAB5wAACagAAAyqAAALVQAADNsAABFpAAABZwAAHCsAAA7qAAAS
IAAAEasAABMyAAACWAAAGCwAAAd2AAADjwAAAxwAAA38AAACFQAAEPQAAAZgAAADKQAAUfYAAAok
AAABvwAADZUAAA1AAAARgAAAA5kAAAIGAAAB7gAAFqEAAApKAAAGuwAAAvwAABsEAAAAPQAADxAA
ABCbAAABxgAADSQAABt6AAAIoQAAAKAAABAmAAANQAAAE00AAAOOAAAAggAAFlsAABBaAAACTwAA
EroAAACBAAANXgAAGNoAAAZuAAADFwAAA5gAAAMRAAAPWwAAFMIAAAEsAAAKMQAADGMAAAHeAAAO
6wAAEGcAABaWAAADzQAAAtgAAAT/AAAMRwAAF6oAAAUQAAAEdAAAA4UAAAI9AAARWgAAFbgAAAT8
AAACyAAAAksAAANOAAAL/gAADFQAABUWAAAFTgAAA4EAAAKFAAAdWwAACLwAAAPGAAADGAAAEVYA
AADWAAANNgAAGXQAAAVnAAACuQAAAuYAAAPvAAASCQAAA28AAAIYAAAPbgAACrgAAAQ4AAAeKwAA
BZYAAANcAAADCgAAD3QAAABuAAAZPQAABHQAAANFAAAEFwAAEEwAAAPJAAAUQwAAA9oAAAK+AAAC
AAAADQ4AAABsAAANNQAAFD8AAAKyAAAJuwAAAK4AAA0zAAADKgAADswAAAB1AAAM1AAADo4AAAG8
AAARPgAAA4gAAAKHAAAM2wAAAoEAAADHAAAEqQAACvwAAAyGAAAPZAAAA2EAAALxAAAA8wAAJBwA
ABMqAAAAcgAAES0AABXvAAADywAAGvgAAAbnAAAAmAAADvEAAABkAAADiAAAFE4AAAPcAAADNQAA
EBUAAAKRAAAUAgAABRkAAAB8AAACtAAADmYAAA3KAAAB+AAAFvMAAAR5AAACcQAADzMAAA5sAAAE
PwAACe8AABp6AAAEnQAAAlAAAAJEAAACCwAADG8AAA/TAAACMQAADtoAAAzTAAAEtwAACJUAAAoh
AAALAAAADIAAAAJUAAAAlgAADWEAAA79AAACzwAADIsAABYHAAAHUgAAAIcAAAX3AAAKzQAADo8A
ABr0AAAHTgAAAJgAAAaWAAAYwAAABLoAAAEIAAAa8wAACKIAAAQNAAAEmQAACPUAAAKkAAAL9wAA
El4AAA2CAAANgAAADBIAAALvAAALLwAAENMAABBjAAAMgQAADOsAAAJYAAAMDwAAEDEAAAoXAAAJ
tAAAD/MAAAGqAAARnAAAF6gAABA4AAAP2wAAC5AAAAMfAAARXgAABAgAABEsAAAUDQAACAIAAAO4
AAAAyAAAFywAAAMLAAAJ/wAADcsAAAHgAAAaTgAACHMAAAXuAAAPGwAADsYAAAJFAAAPJAAAGpcA
AAVYAAAC9wAAJlYAAAc6AAAArwAAA+kAAExpAAASowAAA3oAAACwAAAL4QAAFVgAAAM+AAAR9QAA
ER4AAAPHAAAKpwAAF1MAAAd2AAAB/AAAAr4AAAMJAAANVwAADk8AABJ9AAARWQAABQ4AAACOAAAD
HQAACt0AABDxAAASqwAAAxkAAAPmAAAAmwAAEbgAABLaAAAFHAAACuwAAANKAAAVrgAABZ8AAA7y
AAALwAAADdgAAAJFAAAKxgAAEE8AAAxKAAAPkgAAD7cAAAH5AAAPOgAAAKgAABY+AAAS5wAAFN8A
AAKAAAAAbQAAKUcAAAu/AAAIegAADFYAAACnAAAdwwAABIYAAAB2AAAAsQAAKQsAABEKAAAGoAAA
CGUAABsPAAAKLgAAAIcAAAS1AAAB5AAAI7QAAAsQAAAJIgAAFWgAAAXGAAADHAAAIR4AAABzAAAM
mgAAIIoAAAj/AAAAqwAAJBQAAAjaAAAJFgAALOgAAAyNAAADugAAIbcAAA2rAAAGQwAABf0AABRr
AAAFBAAAId0AAA6zAAAHWAAABgMAABUMAAAFPAAAET8AABBTAAANVAAAEOIAABBBAAAGUwAAEBAA
ABrIAAAJpQAAA28AAAOrAAACuwAAEVgAABVuAAAHrgAAA34AAAOkAAASugAAAMMAAARFAAAR7wAA
DC8AABZ5AAAB/wAAEagAABY1AAAQMAAAAq0AAA6dAAABvAAAD34AABwUAAAI9AAAAjQAAAXZAAAB
eAAAFcAAACf4AAAHFQAACUQAAAIlAAASgAAAKQYAAA0/AAAFDwAACJsAABjZAAAAqAAAI+cAABGM
AAAJ1wAABRgAABtNAAAB4wAAKrgAABN7AAAH2gAACQcAAAUbAAAa/gAACh0AAAbQAAAQAgAAFGsA
ABftAAABGAAACcQAABYfAAAckgAAB6IAAADOAAARHwAADHcAAB7WAAAIgwAACOcAACJ8AAAM8AAA
APwAAAjzAAAWpgAAHccAABGUAAAA9AAACPkAABk2AAAIEQAADuwAAAOjAAAQHgAABCYAABQCAAAL
NgAACQwAAAMJAAATjwAAEYEAAB3IAAAStgAACLgAAADTAAAuIAAAEdQAAAeZAAALhQAAEccAACoL
AAAAnwAAFz8AACLZAAA5kgAAIG4AABXHAAAA7QAAHKoAABMqAAAZtgAAAvIAAAEnAAAq1AAAEHEA
AA5JAAAPIAAAFCYAAAVOAAASBgAAD3wAABL4AAAPFQAAHlsAAAM4AAAcBAAAJd8AAAlvAAAF8AAA
BVsAAAgSAAAmuAAACccAAAPRAAAElwAAF/oAAANsAAAQYAAAEbwAAABYAAALYQAADugAAAvhAABl
MAAACf0AAA5dAAARnAAADz4AAA3mAAACEwAAE1EAABHuAAAATgAAC5UAAAvAAAAC7AAAIg8AAAYp
AAAJtgAAA5YAABG+AAADgAAACw8AAA9ZAAACPgAAFIEAAAN3AAAAhQAADOQAAA7NAAADUAAAAI8A
AAB6AAAD3QAAIT8AAAa5AAADhwAAAHkAAAH6AAAAWQAAEbMAAABhAAAXgQAAAmQAABT+AAABcQAA
FXYAAAB0AAAOcwAABogAAAluAAACQAAAK+0AAA+UAAAJJgAACAMAACEwAAADuQAAD/4AAAHPAAAY
4QAAA4oAAAHlAAAFWQAADBAAAA2ZAAAMswAADh4AAA2CAAADUgAADFMAAAy9AAAOzwAACigAAA0T
AAAD4AAAC+gAABtyAAAE0gAABVcAAAJ9AAAFVgAAB6gAAAxpAAAOMQAACkUAAAx9AAAA6QAAEvMA
AAOQAAABxgAAAiIAAA+9AAABUQAADH8AAAr8AAAWFwAADPEAAAFiAAAoLAAAFf4AAAmLAAANFAAA
FgAAAAJOAAAXpwAAJYQAAApFAAAOIQAAI+MAAArsAAABIQAACbcAAC07AAAI3wAADhQAAARMAAAh
cQAADFMAAAVrAAAImAAAFJ4AAAQ6AAAVkQAAEykAAA/9AAAAlwAAFpIAAAXzAAAMTwAADsQAABIE
AAAZJQAABBYAAA4bAAAA0gAAF84AAAaiAAAT5AAAD3cAAAKLAAAPNgAAAGsAABUbAAAZBgAAEJ0A
AAGrAAANeQAAEjQAAA5KAAAAWwAAF0UAAAJZAAAPXwAAEBwAABZfAAAFHQAAEXUAAABTAAAPYQAA
DPIAAA55AAARrgAAE44AAAJlAAASyQAAD+EAAABlAAAY8AAAE6QAAAVhAAAixwAABA0AABK3AAAR
VgAAFTgAAAKrAAAc/gAABYwAAAKtAAAFQQAAC90AAAJcAAAbggAABlMAAAHGAAAUTwAAAcQAABC5
AAAB3QAAAIYAAAG+AAAMBQAAFKoAAAcyAAAAigAAAG4AAB/+AAAEbQAABqYAAALEAAAOiwAAAGkA
ABtDAAAIOAAAAJMAAAI8AAANtQAAF8oAAAUgAAAD7wAAAkYAAAMkAAAAfQAACXwAAAynAAAB1wAA
DkwAAAwoAAABdwAADOYAAAkrAAAKnQAAEVUAAAJ9AAACJQAAGQIAAAa5AAADdgAAA5kAAA3UAAAY
mwAABU8AAAEUAAADXgAAGIUAAANDAAAA2QAAErgAAAHFAAAN8gAAEe8AAAKuAAAAuAAAH9IAAAY6
AAAHbAAAAtQAAAxRAAAMXQAAAVIAAAU3AAACIQAAW8gAAAvXAAAB7AAAGYUAAAQ9AAACIwAAAqkA
AANyAAATWgAABBIAAAPPAAALGwAAF7wAAABOAAAScQAAD5EAAAyOAAAR4gAAD4sAAARqAAANwwAA
AroAAAHgAAAPeAAAEBEAAAH6AAARvgAAEIMAADGzAAAGuQAACYAAAAJYAAANxQAADXMAABNHAAAa
HgAABl8AAAC1AAAgWgAACb4AAAR7AAAETAAAEAQAAAa6AAAlsAAABBcAAARtAAARZgAAHMIAAASw
AAAUtwAADxQAABKSAAASrwAAAuoAAAcWAAAMtQAAD3gAAAwJAAAQhAAAEFAAAANaAAARTAAADi4A
ABCjAAAO6wAAEZkAAAJzAAAJ6QAACzQAAA3DAAANaQAAGVAAAAHqAAARoAAAD74AABBQAAAAVAAA
DbIAABD2AAAOaAAAD/UAAAKpAAAL3AAAGAcAAAJPAAAOuQAADv0AAA3RAAAP0wAACxAAAAMqAAAN
VAAADqIAABC0AAAQuQAAKzwAAApSAAABOgAAA3UAACH2AAAHLgAAAFsAAALTAAAMDwAAAHAAABG8
AAAPhAAAFIwAAABkAAALTgAADekAABeSAAAEDwAAAxsAAADEAAAMWQAAD7YAAAGuAAAQswAAFB4A
AAVNAAAQ8AAAAucAAACuAAAAXgAAETIAAAMGAAAIuQAAAGUAAAjmAAAUmgAABCEAAAJ1AAACbAAA
D3kAAAKnAAAB3wAAD0gAAABZAAANOwAACq8AAABjAAAKKQAAEToAAAVcAAAN9gAAAFoAAA9qAAAS
rgAABCAAAAG8AAAAbQAAFzQAAB1xAAACvwAAAmUAACURAAAEZAAAAIgAAALcAAAqywAAA6gAAAJC
AAAQKQAAAmQAAADBAAABcwAACg0AABBPAAADiAAADbgAABR/AAAEowAAAl0AAAMUAAACJgAADLoA
ABeiAAAFQAAAAc0AAAPkAAACzwAACngAABDYAAAD2AAAA1kAAAHEAAAB9QAADWwAAAJKAAAMrgAA
CpMAABMnAAAGUgAAAG4AAALFAAANSgAAFC8AAAToAAADCwAAAF8AAAiQAAALfwAACF4AAAhnAAAA
xAAAChcAAAwEAAASwAAAA4IAAAMCAAABawAADHUAAA+/AAAN6wAADl8AAAS9AAAa9wAABJUAAALD
AAACjAAAEEMAABECAAADXwAAAJAAAAI2AAAPDgAAAhsAAAGXAAAI/wAAEIgAAAKzAAACXwAADKsA
AAGgAAAL8gAAIDgAAAdoAAAD6AAAA1wAABvtAAAKQgAAAKsAAAZKAAAY3QAAEaEAAALyAAAKlAAA
A4gAAFekAAAP3gAAA4IAAAMyAAAaPQAACr0AAANBAAAFmgAAGXcAAADZAAAkAQAAEroAACfaAAAV
fQAAEXMAAAIXAAAqGQAAFmYAAA7WAAAMKAAAGXIAAAPqAAAjyQAAEOIAAArJAAAHLAAAHW0AAAmH
AAABoAAACZYAABZRAAAZugAACbYAAAZeAAARpAAAD68AAA+FAAAVwgAABn4AAAcnAAARSgAAD2UA
ABNcAAAR9wAADroAAAZOAAAkmAAABsAAAAPTAAADJgAADuwAAAVXAAAPuQAAAbwAABEbAAACgQAA
ANkAAAeCAAAVIgAAA2sAAAIpAAALsAAAFy0AAAl1AAAHBgAACMwAAAj/AAAAkgAACcAAAAXxAAAJ
YgAAAIwAAAieAAAEOAAAALAAAAZsAAADVgAABRwAAAD+AAACbQAAApoAAANKAAADEQAABhMAAAUM
AAAFnQAAB3QAAACAAAAVtwAAAXIAAAEjAAAGEAAAAcsAABA8AAADZwAABKkAAATuAAAFNQAABh0A
AAfUAAADbgAABmUAAAa9AAAFdwAABdIAAATRAAAFfwAABR8AAAeKAAAE3gAAB8QAAAggAAAEOQAA
BQ0AAAWjAAAJ7AAABxQAAAM0AAAD5AAABGoAAACnAAACDgAAA54AAAClAAACiAAAA8gAAANuAAAH
WAAACj0AAARfAAADJwAABxMAAAGaAAABNgAACKoAAAadAAADWgAABb4AAAe7AAAIJAAABnMAAAoN
AAAEYgAACT4AAAVVAAAHAAAABroAAAj5AAAEQgAAD8AAAAqLAAADfQAAA3UAAA7qAAAHWAAAAgAA
AAXZAAAGsAAABZxzdGNvAAAAAAAAAWMAAOjHAAGGZgACCsgAAqDMAANRPQAD22cABGXvAATxDQAF
d3QABgjWAAZ6IAAHJ8AAB7wHAAgo+QAI9GsACdudAAq6VAALg3AADD+tAAzPbwANYLkADdxWAA6Q
OQAPEqIAD45tAA/tAAAQrssAERfrABGseQASLcQAEpARABL6lQATTQcAE7QqABQoLwAUj9gAFP3U
ABV4VAAV37YAFi/7ABaBIQAW8O0AF0tSABeRRwAX88QAGE1+ABioJAAY/qoAGYlQABnvbQAaV1cA
GyJIABuJ0wAb3aQAHEvdAByldAAdCu4AHVotAB2tsAAeCMYAHoVVAB8RHQAfj7AAIAfJACCAowAg
5o0AIV8QACHPHQAiQpoAIrEWACMbwgAjnXgAI/TLACRcQgAkzxAAJSW7ACXjaAAmYYUAJr8xACcz
2QAnuK4AKAhfACiMOwAo9QcAKXliACn0ggAqkSYAKxx7ACuy1AAsN1QALN3dAC2C7gAt+ygALn8U
AC7niwAvTjsAL8IPADBZLAAxEdgAMaVDADH2ywAy0kcAMzvAADOZrAAz+SUANEY7ADTCKwA1M3cA
NZp1ADY2BwA210sAN1ceADf2ggA4aIUAOUy6ADpARAA67f8AO4NvADxAJQA85UkAPWB0AD4AmAA+
cW8APtzPAD8ztgA/mhwAQDBeAECpOQBBDAkAQVy0AEHGiwBCK2AAQquCAEMI5gBDV7QAQ6joAEP+
YwBEUPIARJu+AEUNYABFyBQARhdYAEZqSQBGujEARyDHAEd7IABH+S8ASFoiAEifygBJCQsASXVu
AEnJkABKJKUASoe9AErinABLNkYAS5ejAEvengBMM1oATI1+AEz28wBNYP8ATbcxAE4V9ABOZaEA
TyJ5AE96IgBP0MAAUBBHAFCRWwBRJrkAUYe9AFH1YwBSZEMAUucLAFM3IABTkC0AU+ApAFRGOQBU
jjYAVOXeAFVTowBVxDgAVgstAFZiUwBWsEkAVxanAFd8iQBX4rQAWCUSAFjeRABZUuYAWb/rAFoR
/gBaXkMAWq+wAFr42ABbVCEAW6ULAFvwsABcUucAXMBoAF0bVABdZCUAXc+8AF4uzgBehawAXsPA
AF8QeQBfYrEAX+BJAGBCSwBghJYAYObqAGFA+gBiBmIAYmjOAGLHBQBjD5cAY3ZsAGPkyQBkXYIA
ZQCNAGV7PwBl2IMAZmiFAGcYpABnpQoAaEmAAGj4/gBpecMAae9HAGpepwBqz4EAaxoPAGuH5QBs
N6wAbJ6YAG1DBwBtuQYAbmK+AG7r1ABvgJcAb/EHAHBtQQBw50gAcVm+AHHCNgByNz4AcqtwAHME
AQBzbIcAc8PyAHRs1AB0y/wAdUELAHWxkAB2IIUAdqOKAHcSoQB3nigAeCIBAHi/KQB5M/EAecls
AHqK4AB7As8Ae2duAHv4BwB8fCkAfSOPAH2sXQB+PjcAfv03AH+kdgCAVC0AgMQdAIFPhwCB7/EA
goZhAINLAgCD6+kAhKI4AIVAQgCF2ywAhpslAIenPQCIY9sAiS2EAImsfwCKn6oAixn1AIuDBACL
3GgAjFYtAI0JXwCNg8AAjfrCAI5jwwCPDAcAj8uhAJCC0ACRHwkAkbJnAJJMZACS2UYAk4wnAJQW
rQCUe7QAlPdfAJVjVQCVxT0AlkclAJa1jQCXHQcAl9aGAJhkLACZBYwAmZ0+AJo1ZQCayZ0Am1+R
AJvz7gCcjGYAnTK3AJ26uACeJawAnpSbAJ7zhgCfYEkAn/AvAKBVTwCg0GMAoRggAKGR+wCh6wsA
onJ8AKLIPgCjPg4Ao8CJAKSNLACleNUApiVYAKbRWACndP8Ap+N/AKhNLwCoji4AqNtUAKkkOACp
cUAAqcFVAKn8WwCqQi8Aqp0OAAAATHN0c3MAAAAAAAAADwAAAAEAAAD7AAAB9QAAAu8AAAPpAAAE
dgAABXAAAAZqAAAHZAAACF4AAAlYAAAKUgAAC0wAAAxGAAANQAAAWeF0cmFrAAAAXHRraGQAAAAH
AAAAAAAAAAAAAAACAAAAAABPsAAAAAAAAAAAAAAAAAABAAAAAAEAAAAAAAAAAAAAAAAAAAABAAAA
AAAAAAAAAAAAAABAAAAAAAAAAAAAAAAAAFl9bWRpYQAAACBtZGhkAAAAAAAAAAAAAAAAAACsRABP
sABVxAAAAAAAImhkbHIAAAAAAAAAAHNvdW4AAAAAAAAAAAAAAAAAAAAAWTNtaW5mAAAAEHNtaGQA
AAAAAAAAAAAAACRkaW5mAAAAHGRyZWYAAAAAAAAAAQAAAAx1cmwgAAAAAQAAWPdzdGJsAAAAZ3N0
c2QAAAAAAAAAAQAAAFdtcDRhAAAAAAAAAAEAAAAAAAAAAAACABAAAAAArEQAAAAAADNlc2RzAAAA
AAOAgIAiAAIABICAgBRAFQAAAAAB9AAAAfQABYCAgAISEAaAgIABAgAAABhzdHRzAAAAAAAAAAEA
ABPsAAAEAAAAAuBzdHNjAAAAAAAAADwAAAABAAAADgAAAAEAAAAHAAAADQAAAAEAAAAIAAAADgAA
AAEAAAATAAAADQAAAAEAAAAUAAAADgAAAAEAAAAgAAAADQAAAAEAAAAhAAAADgAAAAEAAAAsAAAA
DQAAAAEAAAAtAAAADgAAAAEAAAA5AAAADQAAAAEAAAA6AAAADgAAAAEAAABFAAAADQAAAAEAAABG
AAAADgAAAAEAAABSAAAADQAAAAEAAABTAAAADgAAAAEAAABeAAAADQAAAAEAAABfAAAADgAAAAEA
AABrAAAADQAAAAEAAABsAAAADgAAAAEAAAB3AAAADQAAAAEAAAB4AAAADgAAAAEAAACEAAAADQAA
AAEAAACFAAAADgAAAAEAAACQAAAADQAAAAEAAACRAAAADgAAAAEAAACdAAAADQAAAAEAAACeAAAA
DgAAAAEAAACpAAAADQAAAAEAAACqAAAADgAAAAEAAAC2AAAADQAAAAEAAAC3AAAADgAAAAEAAADC
AAAADQAAAAEAAADDAAAADgAAAAEAAADPAAAADQAAAAEAAADQAAAADgAAAAEAAADbAAAADQAAAAEA
AADcAAAADgAAAAEAAADoAAAADQAAAAEAAADpAAAADgAAAAEAAAD0AAAADQAAAAEAAAD1AAAADgAA
AAEAAAEBAAAADQAAAAEAAAECAAAADgAAAAEAAAENAAAADQAAAAEAAAEOAAAADgAAAAEAAAEZAAAA
DQAAAAEAAAEaAAAADgAAAAEAAAEmAAAADQAAAAEAAAEnAAAADgAAAAEAAAEyAAAADQAAAAEAAAEz
AAAADgAAAAEAAAE/AAAADQAAAAEAAAFAAAAADgAAAAEAAAFLAAAADQAAAAEAAAFMAAAADgAAAAEA
AAFYAAAADQAAAAEAAAFZAAAADgAAAAEAAAFkAAAADQAAAAEAAAFlAAAADgAAAAEAAAFvAAAABQAA
AAEAAE/Ec3RzegAAAAAAAAAAAAAT7AAAAXMAAAFzAAABcwAAAXQAAAFzAAABdAAAAf0AAAI0AAAB
igAAAaYAAAGyAAABnwAAAYEAAAF7AAABaAAAAXkAAAFzAAABgwAAAYEAAAGMAAABggAAAX8AAAFm
AAABYwAAAWAAAAFgAAABUAAAAUsAAAFeAAABZwAAAYgAAAHCAAABuAAAAYEAAAFrAAABUgAAAWAA
AAF6AAABRgAAAX0AAAGSAAABigAAAXoAAAFZAAABWAAAAWMAAAF8AAABegAAAXYAAAFsAAABUAAA
AZoAAAGlAAABbwAAAXAAAAFbAAABbQAAAYYAAAGmAAABcgAAAXQAAAGtAAABugAAAaQAAAGKAAAB
WwAAAVwAAAFLAAABkAAAAVEAAAFXAAABRQAAATIAAAFXAAABUwAAAU0AAAFZAAABXgAAAWYAAAFb
AAABSgAAAWkAAAGHAAABVQAAAVUAAAFMAAABSgAAAVkAAAFMAAABTwAAAVUAAAFgAAABXAAAAbEA
AAG+AAABpwAAAegAAAFgAAABXgAAAXIAAAGjAAABoQAAAZIAAAF5AAABkgAAAUIAAAF5AAABdwAA
AVEAAAFDAAABjwAAAaAAAAHqAAABxgAAAU8AAAFZAAABWQAAAXMAAAFJAAABUgAAAcMAAAHaAAAB
uQAAAbgAAAGgAAABawAAAY4AAAFQAAABXAAAAVAAAAFfAAABrAAAAVEAAAFYAAABoQAAAUoAAAFf
AAABYAAAAVYAAAGVAAABZwAAAV0AAAFuAAABXwAAAcMAAAGWAAABUwAAAW8AAAGcAAABagAAAVMA
AAE+AAABWgAAAUoAAAGfAAABXQAAAS4AAAFkAAABQwAAAXQAAAFxAAABVQAAAXUAAAFsAAABcAAA
AZoAAAFuAAABYwAAAVoAAAFdAAABSwAAAWcAAAFqAAABVwAAAX4AAAFvAAABfAAAAaIAAAGaAAAB
YAAAAVcAAAFrAAACKAAAAWIAAAFrAAABcQAAAZoAAAG8AAABZQAAASYAAAFLAAABWAAAAU0AAAFK
AAABggAAAcgAAAGtAAAB2gAAAVcAAAFCAAABVAAAAZAAAAF3AAABUAAAAV8AAAFIAAABUAAAAUEA
AAFXAAABfwAAAXEAAAGJAAABVwAAAZ0AAAGfAAABmQAAAa8AAAFyAAABYAAAAbIAAAGzAAABgwAA
AX8AAAGwAAABoAAAAWQAAAFjAAABaQAAAX4AAAFtAAABgwAAAWMAAAEOAAABfgAAAZ8AAAF6AAAB
TAAAAYMAAAFxAAABkgAAAUMAAAElAAABTgAAAUIAAAFtAAABbgAAAVUAAAFjAAABOwAAAWYAAAFA
AAABUgAAAZgAAAGSAAABigAAAbgAAAFhAAABPwAAAUAAAAGeAAABZwAAAaMAAAF+AAABcQAAAXkA
AAE7AAABSgAAAVgAAAFlAAAB4gAAAX4AAAFUAAABaAAAAT0AAAFEAAABUQAAAUgAAAFQAAABPgAA
AWYAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAGUAAACDQAAAekAAAHIAAABzAAAAeUAAAGkAAAB
fQAAAaUAAAGnAAABZAAAAWUAAAF3AAABTwAAAWMAAAFRAAABXwAAAXYAAAFbAAABZwAAAUcAAAF2
AAABYAAAAWYAAAGBAAABhwAAAWUAAAFYAAABbAAAAVoAAAE9AAABVAAAAYYAAAFXAAABbgAAAY8A
AAHHAAAB2wAAAVkAAAFCAAABOgAAAVgAAAGJAAABoAAAAboAAAFeAAABVQAAAWsAAAFfAAABcAAA
AW8AAAHbAAABpQAAAZ0AAAGiAAABowAAAX8AAAFnAAABXgAAAZQAAAGaAAABagAAAWMAAAFhAAAB
QgAAARYAAAFtAAABSAAAAXkAAAFhAAABagAAAYYAAAGPAAABTQAAATsAAAFGAAABSgAAAWMAAAGW
AAABgQAAAWsAAAFFAAABMgAAAWcAAAFjAAABXwAAAVcAAAFPAAABNgAAAU4AAAFIAAABTAAAAWMA
AAF0AAABcwAAAXYAAAF4AAABbQAAAXgAAAHoAAACFAAAAW8AAAGBAAABSQAAAXkAAAGYAAAB4wAA
AfQAAAGsAAABbQAAAXQAAAFvAAABdwAAAUsAAAFyAAABXAAAAbcAAAGRAAABnAAAAZUAAAGCAAAB
iAAAAVQAAAE7AAABUQAAAY4AAAFFAAABTwAAAVoAAAFJAAABTgAAAWsAAAFjAAABqwAAAR0AAAE+
AAABWAAAAVsAAAGKAAABpQAAAZwAAAGEAAABOAAAAZYAAAFvAAABSgAAAWgAAAE0AAABXAAAAZ0A
AAExAAABIAAAAWUAAAFUAAABXQAAAa8AAAG6AAABuwAAAaQAAAHLAAABvgAAAY8AAAGbAAABpAAA
Aa4AAAFzAAABZAAAAV0AAAFLAAABawAAAVYAAAGCAAABYgAAAT8AAAGFAAABTAAAAW4AAAFpAAAB
ugAAAY4AAAGkAAABVQAAAWcAAAFKAAABdQAAAXsAAAFxAAABYwAAAU8AAAGlAAACJAAAAWsAAAFy
AAABcgAAAWMAAAFWAAABgQAAAZ8AAAFQAAABlgAAAZQAAAFnAAABdgAAAVoAAAFZAAABdAAAAVsA
AAFFAAABZwAAAVAAAAFQAAABvgAAAckAAAFgAAABbwAAAWAAAAE+AAABcgAAAVcAAAFaAAABbwAA
AZMAAAHcAAABuQAAAXwAAAFzAAABawAAAWsAAAFkAAABhwAAAVkAAAFPAAABsQAAAWUAAAFnAAAB
kAAAAZEAAAFSAAABUwAAAVwAAAFQAAABcgAAAXYAAAGJAAABagAAAW8AAAF6AAABbgAAAVgAAAGe
AAABSgAAAXgAAAFPAAABmQAAAXsAAAHOAAABmAAAAXYAAAF4AAABVgAAAUkAAAFlAAABSgAAAUcA
AAF0AAABTQAAAbYAAAGLAAABZQAAAY4AAAF0AAABYQAAAUgAAAF8AAABYQAAAbwAAAGkAAABlQAA
AaYAAAGKAAABRAAAAWEAAAFVAAABnAAAAXwAAAFtAAABRAAAAYQAAAHAAAABeQAAAWMAAAGLAAAB
jgAAAXQAAAFVAAABfAAAAUUAAAEgAAABWgAAAbYAAAFyAAABbAAAAWQAAAFiAAABbQAAAWQAAAGJ
AAABXAAAAXIAAAGbAAABZwAAAUsAAAGAAAABWwAAAVEAAAFNAAABSwAAAUUAAAFuAAABZwAAAYgA
AAF+AAABXQAAAbQAAAGgAAABXgAAAYIAAAGCAAABkAAAAXIAAAFwAAABXAAAAXgAAAGBAAABiwAA
AZYAAAF/AAABpgAAAYsAAAGEAAABnQAAAaUAAAFqAAABPAAAAUAAAAFMAAABUAAAAXcAAAFeAAAB
bQAAAXMAAAG4AAABXgAAAVAAAAFZAAABSgAAAWEAAAF1AAABdgAAAWkAAAFtAAABUAAAAX0AAAGp
AAABlgAAAaQAAAGkAAABdQAAAV4AAAG+AAABZQAAAVIAAAGtAAABlAAAAYUAAAGTAAABhgAAAX0A
AAFaAAABWQAAAVAAAAE5AAABbAAAAVcAAAFcAAABXgAAAXkAAAGTAAABcAAAAZgAAAFUAAABVwAA
AVgAAAFYAAABWwAAAX0AAAFqAAABXAAAAXUAAAF6AAABhwAAAYAAAAF8AAABZwAAAWIAAAGYAAAB
WgAAAXcAAAFhAAABXAAAAWAAAAFwAAABVgAAAXwAAAGCAAABbQAAAWAAAAF6AAABaQAAAX8AAAFy
AAABqAAAAZYAAAFuAAABbgAAAWMAAAF3AAABfQAAAYUAAAFmAAABiwAAAV4AAAFdAAABZQAAAWMA
AAFOAAABaAAAAZMAAAFWAAABjQAAAakAAAGeAAABiAAAAZ8AAAFqAAABSgAAAXkAAAGOAAABgAAA
AXUAAAFrAAABcgAAAUIAAAFAAAABUgAAAccAAAGJAAABiAAAAVsAAAF8AAABbgAAAWwAAAGYAAAB
cAAAAXEAAAFkAAABWwAAAU8AAAFKAAABNwAAAYYAAAGJAAABSwAAAYIAAAF1AAAB1wAAAVsAAAFm
AAABLwAAATsAAAFtAAABnAAAAaMAAAGhAAABvgAAAZwAAAGNAAABxQAAAZsAAAGvAAABkAAAAVoA
AAFTAAABWgAAAWoAAAF4AAABaQAAAVEAAAFRAAABlQAAAY0AAAGYAAABSwAAAUkAAAFpAAABRgAA
AVEAAAF0AAABVAAAASoAAAE5AAABjAAAAV0AAAGmAAABpAAAAcoAAAFqAAABgwAAAWkAAAFGAAAB
SAAAATcAAAE5AAAB6QAAAeEAAAGgAAABhQAAAWgAAAFpAAABUwAAAVYAAAFLAAABUgAAAZYAAAFj
AAABYgAAAZkAAAG0AAABgQAAAXgAAAFvAAABXQAAAYUAAAFqAAABcQAAATIAAAFHAAABRgAAAW8A
AAG0AAABtAAAAZEAAAE7AAABWAAAAV8AAAFoAAABtwAAAaUAAAGpAAABXQAAAVkAAAFEAAABPwAA
AUcAAAE+AAABSgAAAV4AAAFZAAABYQAAAVwAAAGbAAABiwAAAbQAAAHCAAABXQAAAWEAAAFdAAAB
TgAAAV8AAAFVAAABlQAAAbsAAAG7AAAB2wAAAbUAAAGpAAABfgAAAXEAAAFiAAABYwAAAY8AAAFg
AAABaQAAAWwAAAFtAAABUQAAAWoAAAFeAAABgAAAAXAAAAFcAAABiwAAAVsAAAFMAAABbwAAAXoA
AAFfAAABfAAAAUIAAAFnAAABcQAAAXAAAAFaAAABbwAAAYUAAAFvAAABfgAAAW8AAAFsAAABagAA
AWwAAAFRAAABVgAAAZoAAAGgAAABvQAAAYsAAAGOAAABXQAAAUsAAAFIAAABJgAAAT0AAAFpAAAB
VAAAAVIAAAFKAAABXwAAATwAAAExAAABQQAAASgAAAFoAAABcwAAAXQAAAGcAAABXwAAAbYAAAGk
AAAB1QAAAZ4AAAHIAAABXQAAAW0AAAGHAAABvgAAAdoAAAGpAAABOgAAAXkAAAFGAAABPQAAAToA
AAE8AAABQAAAATUAAAE1AAABNQAAAWAAAAHPAAABoQAAAf8AAAHNAAABnwAAAX4AAAFlAAABRQAA
AVUAAAFuAAABXAAAAUIAAAE7AAABWAAAAWUAAAFzAAABUAAAAXEAAAG8AAABzQAAAb4AAAGRAAAB
jgAAAXcAAAF1AAABeAAAAXUAAAFzAAABkgAAAY8AAAGCAAABfwAAAawAAAF3AAABbAAAAV8AAAF6
AAABWQAAAXoAAAFtAAABqAAAAUQAAAFpAAABaAAAAXUAAAGoAAABkQAAAWwAAAF+AAABXAAAAXoA
AAFWAAABWwAAAVsAAAFUAAABVwAAAWIAAAFsAAABygAAAZsAAAGnAAABngAAAWwAAAElAAABbgAA
AZkAAAF4AAABbQAAAZQAAAF6AAABcQAAAVIAAAGrAAABnQAAASsAAAGsAAABjgAAASoAAAFIAAAB
hgAAAVsAAAF7AAABgwAAAVwAAAFzAAABYAAAAV4AAAE4AAABNAAAAVEAAAFWAAABlwAAAW0AAAFm
AAABjgAAAY4AAAGwAAABiwAAAYkAAAFaAAABcAAAAXcAAAGIAAABfgAAAXoAAAGGAAABiQAAAYYA
AAFzAAABTgAAAXEAAAFzAAABcwAAAUMAAAFBAAABRwAAAUMAAAFrAAABOwAAAVoAAAFxAAABTAAA
AU0AAAFFAAABQAAAAUkAAAFFAAABYQAAAWcAAAF0AAAB+AAAAeYAAAGsAAABMwAAAUEAAAGmAAAB
0gAAAdsAAAGwAAABdgAAAY4AAAE+AAABVgAAATUAAAGUAAABkwAAAfgAAAGeAAABogAAAVIAAAF+
AAABXgAAAWcAAAF9AAABgAAAAWYAAAF6AAABlQAAAZ4AAAFxAAABcgAAAWAAAAFXAAABXAAAAXoA
AAGHAAABqwAAAVwAAAFnAAABegAAAWwAAAF3AAABSQAAAV0AAAE/AAABXQAAAUQAAAFTAAABXwAA
AXYAAAG/AAABhgAAAWwAAAE8AAABfwAAAVQAAAGTAAABMwAAATMAAAFwAAABXwAAAXwAAAFAAAAB
jwAAAfkAAAGnAAABkgAAAX8AAAGGAAABagAAAWUAAAFzAAABMgAAAXYAAAF4AAABmgAAAasAAAFF
AAABJgAAAZUAAAFhAAABeQAAAW8AAAFeAAABVwAAAWgAAAFiAAABYgAAAZEAAAFOAAABcAAAAYIA
AAGQAAABpAAAAaAAAAF+AAABmAAAAd8AAAFwAAABdwAAAbYAAAFbAAABZwAAAVoAAAFkAAABYgAA
AVgAAAGMAAABdQAAAVYAAAF3AAABdQAAAW0AAAGIAAABeQAAAbwAAAGHAAABkAAAAWMAAAF4AAAB
XwAAAZEAAAFoAAABPQAAAWwAAAGZAAABXAAAAWwAAAF9AAABkwAAAZ8AAAFlAAABXwAAAYMAAAFT
AAABXgAAAWMAAAFwAAABgAAAAW4AAAGoAAABmwAAAWQAAAFwAAABYAAAATsAAAE5AAABQgAAAWEA
AAFOAAABZgAAAVAAAAFfAAABVwAAAWkAAAF9AAABZgAAAWYAAAF9AAABhgAAAWIAAAF8AAAB7gAA
AdUAAAFxAAABdAAAAUoAAAGMAAABhQAAAXcAAAFZAAABbwAAAYUAAAFrAAABfgAAAXIAAAFvAAAB
eQAAAW8AAAFtAAABagAAAUkAAAF3AAABQAAAAWMAAAFfAAABYgAAAWYAAAFNAAABUAAAAV8AAAFf
AAABYQAAAXUAAAGCAAABqgAAAbUAAAFrAAABbwAAAagAAAFRAAABTQAAAY8AAAGHAAABwgAAAWEA
AAGXAAABgAAAAc4AAAFgAAABfAAAAZEAAAF5AAABbQAAAXIAAAFBAAABeAAAAWYAAAFVAAABWAAA
AXMAAAFsAAABSAAAAUwAAAF9AAABeAAAAWcAAAF0AAABswAAAU4AAAFZAAABXwAAAdkAAAGoAAAB
gwAAAawAAAFyAAABlQAAAWMAAAFnAAABUwAAAW0AAAF7AAABZQAAATMAAAF/AAABawAAAY0AAAFm
AAABhQAAAVoAAAFkAAABXAAAAV4AAAFUAAABmAAAAcsAAAGIAAABxwAAAXMAAAFeAAABWAAAAXEA
AAFfAAABbgAAAS4AAAF1AAABkAAAAaQAAAFkAAABMwAAAYgAAAFkAAABggAAAacAAAF5AAABdwAA
AW0AAAG6AAABewAAAYYAAAGMAAABdwAAAawAAAFmAAABiQAAAW4AAAFgAAABcAAAAVcAAAFnAAAB
XgAAAVkAAAF4AAABagAAAWsAAAFZAAABsgAAAXkAAAFsAAABZAAAAWIAAAF6AAABbQAAASQAAAFH
AAABuwAAAZ4AAAGWAAABRgAAAWMAAAFtAAABawAAAW4AAAGHAAABYwAAAY4AAAE5AAABewAAAX8A
AAFfAAABawAAAXIAAAFnAAABhwAAAXkAAAFNAAABPQAAAYsAAAGJAAABfAAAAXEAAAFbAAABlAAA
AcQAAAFgAAABXwAAAV4AAAGQAAABiQAAAX4AAAFrAAABYwAAAWIAAAF3AAABVAAAAVUAAAFqAAAB
aQAAAWQAAAGNAAABiwAAAX4AAAGqAAABxAAAAXYAAAF+AAABngAAAaMAAAGCAAABigAAAVUAAAFi
AAABUgAAAU0AAAFXAAABXwAAAWcAAAGCAAABOAAAAWoAAAFBAAABZQAAAWgAAAFLAAABbgAAAVoA
AAGIAAABjAAAAbkAAAF9AAABwAAAAYoAAAFwAAABrQAAAV4AAAGSAAABgQAAAXAAAAFIAAABRAAA
AVAAAAFVAAABZQAAAVoAAAFqAAABYgAAAVMAAAF6AAABYwAAAXkAAAFAAAABVAAAAVoAAAFVAAAB
dAAAAZgAAAGEAAABmQAAAa8AAAGkAAABgwAAAW0AAAFRAAABTgAAAU0AAAFmAAABUgAAAWUAAAGQ
AAABjwAAAaAAAAGdAAABbQAAAXsAAAFaAAABRQAAAVwAAAFHAAABawAAAakAAAHYAAABdQAAAW8A
AAFpAAABYQAAAZEAAAFeAAABuwAAAcgAAAGhAAABKQAAAWMAAAE+AAABOQAAAUEAAAGwAAABVgAA
AWMAAAFfAAABcQAAAYAAAAFoAAABVwAAAdEAAAGyAAABuwAAAXcAAAG2AAABOQAAAVcAAAF7AAAB
bwAAAWEAAAFMAAABfgAAAVEAAAF9AAABfAAAAWQAAAF1AAABaQAAAboAAAGgAAABdwAAAXYAAAFh
AAABYQAAAW0AAAFuAAABiQAAAW8AAAGHAAABVAAAAW0AAAFcAAABZAAAAWcAAAFsAAABWAAAAYwA
AAF5AAABUAAAAXkAAAFuAAABYwAAAYsAAAFNAAABlwAAAVwAAAFoAAABdgAAAZkAAAFjAAABLwAA
AYkAAAFpAAABcwAAAcIAAAGmAAABvwAAAZwAAAGRAAABegAAASkAAAFQAAABLwAAAWUAAAFuAAAB
ggAAAWAAAAF3AAABpAAAAWUAAAGsAAABbgAAATsAAAF2AAABYQAAAVAAAAFoAAABTgAAATwAAAFi
AAABggAAAVoAAAGWAAABXQAAAYMAAAFXAAABVAAAAWQAAAE/AAABYAAAAbAAAAGiAAABsgAAAc4A
AAHZAAABswAAAWsAAAFzAAABiAAAAUYAAAFKAAABLQAAAXUAAAFVAAABUAAAATYAAAE2AAABWQAA
AToAAAE9AAABPAAAAW8AAAFVAAABOQAAAU8AAAGfAAABugAAAZ8AAAG/AAAB0AAAAYgAAAHHAAAB
jQAAAaAAAAGYAAABRgAAAV0AAAFOAAABjgAAAYIAAAGVAAABWQAAAWsAAAF1AAABZgAAASsAAAFV
AAABcwAAAVAAAAEzAAABbwAAAWQAAAGAAAABVQAAAVEAAAFJAAABigAAAaUAAAGcAAABoAAAAbYA
AAF7AAABhQAAAW0AAAFlAAABzwAAAaIAAAFpAAABZgAAAWkAAAFOAAABaAAAAXcAAAFGAAABXAAA
AXQAAAFvAAABmgAAAYkAAAG4AAABtQAAAaIAAAGMAAABcwAAAUwAAAGJAAABaAAAAVEAAAF6AAAB
YQAAAVsAAAFTAAABXwAAAV8AAAFyAAABjQAAAWkAAAF9AAABwQAAAWcAAAGKAAABlAAAAYEAAAFs
AAABjgAAAWIAAAF7AAABUAAAAYgAAAFpAAABWAAAAYoAAAFrAAABaAAAAWUAAAF3AAABeAAAAWwA
AAFqAAABXQAAAXsAAAGMAAABaQAAAV0AAAFbAAABdgAAAV0AAAFtAAABWgAAAVkAAAFPAAABgQAA
AVEAAAFvAAABagAAAWEAAAH0AAABiAAAAX0AAAFyAAABXgAAAVoAAAGkAAABaAAAAXgAAAE+AAAB
PAAAAU4AAAFHAAAByQAAAWQAAAFvAAABhwAAAZ8AAAGDAAABpgAAAbIAAAF8AAABmQAAAWgAAAFR
AAABdwAAAVMAAAGhAAABmQAAAaIAAAHHAAABbwAAAWMAAAFzAAABWgAAAYIAAAFpAAABcQAAAWoA
AAF7AAABcwAAAWMAAAFnAAABXgAAAXwAAAFdAAABWgAAAWMAAAFKAAABJgAAAScAAAF4AAABhQAA
AVEAAAGeAAABYgAAAU8AAAFaAAABngAAAVgAAAGBAAABcAAAAZoAAAHMAAABvwAAAX0AAAFVAAAB
awAAAWUAAAGJAAABcQAAAYoAAAFlAAABSgAAAXQAAAFIAAABXwAAAVEAAAGZAAABlQAAAW8AAAFm
AAABfAAAAVgAAAFWAAABaQAAAZ4AAAGXAAABsAAAAcEAAAG4AAABbwAAAVsAAAFRAAABgAAAAWcA
AAFbAAABVgAAAWoAAAFZAAABcAAAAXcAAAGdAAABjAAAAZAAAAG8AAABpwAAAYkAAAFhAAABfQAA
AYYAAAGbAAABmgAAAWkAAAFMAAABWgAAAaIAAAGRAAABcQAAATgAAAFJAAABTwAAAVMAAAEuAAAB
oQAAAaQAAAGLAAABXwAAAVUAAAFYAAABWgAAAVUAAAFPAAABfwAAAXkAAAE5AAABYwAAAV4AAAGK
AAABfQAAAakAAAFwAAABXAAAAXoAAAFgAAABeAAAAW0AAAF4AAABfgAAAXQAAAFvAAABtwAAAZYA
AAFoAAABewAAAW0AAAF5AAABnwAAAZYAAAFzAAABhwAAAVIAAAFJAAABNQAAAVsAAAFWAAABRgAA
AVkAAAE0AAABRgAAAVIAAAGeAAABPgAAAVwAAAFVAAABWAAAAaAAAAG9AAABjgAAAWIAAAFxAAAB
lAAAAYcAAAGYAAABfQAAAWsAAAFDAAABXAAAAWQAAAFrAAABVAAAAYQAAAFuAAABfQAAAY0AAAG1
AAABzQAAAXYAAAGDAAABdAAAAWQAAAHLAAABVgAAAXQAAAFhAAABYwAAAaYAAAFeAAABegAAAXMA
AAFpAAABUAAAAZ0AAAGjAAABowAAAaAAAAFAAAABOwAAAWEAAAFJAAABigAAAZYAAAGMAAABvwAA
AYgAAAFzAAABhAAAAVAAAAGhAAABnwAAAYQAAAFcAAABkwAAAVQAAAFTAAABTgAAAW8AAAEDAAAB
PQAAASoAAAEuAAABYAAAAXkAAAGMAAABYQAAAVoAAAIHAAABMwAAAUcAAAFjAAABZgAAAbcAAAF7
AAABdAAAAWEAAAFxAAABzAAAAXUAAAF+AAABfAAAAYYAAAFMAAABTwAAAVYAAAFfAAABZwAAAZEA
AAFqAAABkwAAAYwAAAFzAAABcwAAAW8AAAFzAAABXwAAAXYAAAFDAAABZQAAAWUAAAFoAAABeQAA
AYQAAAF+AAABLAAAAWcAAAFOAAABkwAAAWUAAAGzAAABzQAAAWIAAAGSAAABeQAAAVAAAAGEAAAB
eAAAAX8AAAHAAAABkwAAAXEAAAFwAAABqAAAAX8AAAF6AAABWQAAAW0AAAFoAAABawAAAa8AAAF8
AAABWgAAAVcAAAE4AAABYAAAAUoAAAFAAAABiwAAAckAAAGzAAABegAAAXcAAAF7AAABaAAAAWwA
AAFfAAABaQAAAW8AAAFpAAABowAAAVcAAAFFAAABbwAAAV0AAAFlAAABdAAAAUwAAAFlAAABZQAA
AdMAAAGhAAABfwAAAaIAAAFqAAABZwAAAWoAAAFoAAABSQAAAVwAAAGGAAABkgAAAXgAAAFKAAAB
egAAAXkAAAFRAAABWAAAAVcAAAE5AAABkwAAAa4AAAGXAAABcgAAAVsAAAFWAAABmQAAAXUAAAFB
AAABRwAAAawAAAGTAAABbgAAAWsAAAFiAAABagAAAZoAAAFiAAABcwAAAVkAAAFRAAABTwAAAWkA
AAFmAAABVQAAAX0AAAHAAAABcwAAAYMAAAFtAAABtAAAAXkAAAGGAAABUwAAAZEAAAHLAAABrAAA
AXUAAAFnAAABeQAAAbUAAAGBAAABiwAAAWUAAAFEAAABVAAAAUAAAAF7AAABUgAAAWoAAAGCAAAB
kgAAAaoAAAFkAAABggAAAWsAAAFjAAABbAAAAa8AAAG2AAABiAAAAVsAAAGDAAABfgAAAWoAAAE6
AAABcQAAAWEAAAFMAAABNAAAAW0AAAEyAAABZAAAAUQAAAFpAAABmgAAAYUAAAFmAAABjgAAAUsA
AAFYAAABRwAAAVQAAAFYAAABOQAAAWQAAAHbAAAB0AAAAc8AAAHEAAABvgAAATIAAAFWAAABXgAA
AUwAAAFVAAABcAAAAVIAAAFxAAABhAAAAXUAAAF6AAABVgAAAUgAAAFYAAABdwAAAZMAAAF5AAAB
dAAAAZAAAAF1AAABkAAAAWkAAAFeAAABcwAAAW8AAAGGAAABbgAAAdMAAAGHAAABigAAAXYAAAGt
AAABiAAAAWcAAAGFAAABdgAAAWUAAAFeAAABUwAAAUsAAAF0AAABYAAAAWwAAAG6AAABlwAAAYYA
AAFtAAABcAAAAXMAAAF4AAABZQAAAWYAAAGBAAABqwAAAYUAAAGCAAABbQAAAV0AAAFXAAABgwAA
AVMAAAGkAAABbwAAAWoAAAFdAAABNwAAAVcAAAGKAAABowAAAaIAAAFVAAABUgAAAWgAAAFuAAAB
cgAAAVAAAAFNAAABaAAAAW8AAAFwAAABYwAAAWkAAAFuAAABbgAAAZAAAAGEAAABbwAAAT0AAAFu
AAABcgAAAV4AAAFBAAABfAAAAW0AAAGVAAABjwAAAY0AAAF6AAABUwAAAVUAAAFVAAABYAAAAZQA
AAF6AAABdQAAAbwAAAF7AAABowAAAXgAAAFpAAABrwAAAYYAAAF7AAABfQAAAVAAAAGcAAABiQAA
AZkAAAFRAAABPgAAAXoAAAFdAAABYAAAAYIAAAGIAAABhAAAAWsAAAGsAAABaQAAAUAAAAFGAAAB
lwAAAWkAAAFMAAABhgAAAccAAAFZAAABsgAAAWoAAAFZAAABaQAAAU0AAAFRAAABtAAAAbkAAAFg
AAABbgAAAXQAAAFoAAABYAAAAWQAAAFdAAABgQAAAT4AAAFIAAABMwAAAT4AAAE4AAABSgAAAU4A
AAFfAAABXgAAAakAAAGrAAABxQAAAUUAAAFAAAABmQAAAZQAAAFzAAABTAAAAWMAAAFjAAABTgAA
AUUAAAFWAAABgAAAAbYAAAHCAAAB1AAAAZcAAAG1AAABoQAAAZoAAAGsAAABnAAAAYEAAAGcAAAB
lAAAAU0AAAF8AAABWwAAAVoAAAE7AAABYgAAAUsAAAFJAAABZAAAAVoAAAE3AAABaQAAAVUAAAFS
AAABUAAAAVMAAAHmAAABlwAAAYkAAAGXAAABeAAAAXUAAAFkAAABTwAAAUYAAAFOAAABTgAAAWwA
AAFwAAABwgAAAaEAAAF9AAABgAAAAaAAAAG8AAABfgAAAXEAAAFOAAABrwAAAbMAAAGGAAABcgAA
AW4AAAFfAAABcQAAAVEAAAFNAAABbAAAATwAAAFoAAABXQAAAWkAAAFvAAABbQAAAUAAAAEhAAAB
SgAAAXIAAAF5AAABsgAAAdYAAAHLAAAB1gAAAaAAAAGUAAABlwAAAWsAAAFQAAABSQAAAagAAAGC
AAABUQAAAWIAAAFRAAABZAAAATMAAAE+AAABSAAAAT8AAAFQAAABVwAAAYMAAAGAAAABVAAAAbwA
AAGTAAABmgAAAWYAAAFIAAABlgAAAV0AAAGTAAABzwAAAZkAAAGWAAABIwAAATcAAAE5AAABLQAA
AR8AAAE0AAABVwAAASoAAAE9AAABXgAAAUQAAAFFAAABaAAAAXQAAAFzAAABdAAAAXMAAAGKAAAB
qQAAAcQAAAG5AAAB3gAAAZgAAAGCAAABigAAAWMAAAFXAAABkQAAAagAAAGCAAABvAAAAZEAAAFu
AAABUQAAAXcAAAFfAAABWAAAAU0AAAFvAAABagAAAYsAAAF6AAABlgAAAa8AAAF1AAABYgAAAWQA
AAGHAAABhgAAAUkAAAFdAAABVAAAAXwAAAGCAAABVwAAAa4AAAGKAAABkQAAAVkAAAE+AAABlgAA
AVkAAAFhAAABjAAAAWcAAAFBAAABYAAAAbEAAAF/AAABuAAAAcoAAAHFAAABfgAAAWYAAAGUAAAB
MgAAAVAAAAFNAAABUgAAAU4AAAFQAAAB2gAAAVYAAAFIAAABWAAAAY8AAAF6AAABcgAAAUMAAAFE
AAABXwAAAVgAAAFRAAABbgAAAVsAAAG/AAABxQAAAeQAAAF9AAABPQAAAUYAAAGBAAABaQAAATMA
AAFbAAABZQAAAVYAAAFkAAABPwAAAXEAAAFwAAABogAAAZsAAAF8AAABgAAAAZMAAAGBAAABYAAA
AVgAAAGKAAABcgAAAbkAAAHFAAABUgAAATEAAAE6AAABSgAAAVUAAAF1AAABNQAAAVgAAAGuAAAB
gQAAAZQAAAFgAAABMgAAAVUAAAGYAAABWwAAAVAAAAF2AAAB2gAAAZQAAAF8AAABVgAAAVkAAAG+
AAABtAAAAa8AAAGHAAABkQAAAXsAAAF4AAABWAAAAXwAAAFFAAABTwAAAWkAAAFSAAABWQAAAUkA
AAFYAAABqgAAAYIAAAFfAAABngAAAYsAAAFkAAABWwAAAXcAAAFtAAABeQAAAWwAAAFWAAABXQAA
AWcAAAGEAAABeQAAAV8AAAFuAAABYQAAAWoAAAFrAAAB9QAAAX4AAAGZAAABlgAAAXkAAAFxAAAB
sQAAAc4AAAGvAAABgwAAAWUAAAFSAAABTAAAAT8AAAFMAAABewAAAVQAAAF+AAABuwAAAXQAAAFU
AAABcwAAAWEAAAF+AAABYgAAASIAAAE6AAABSwAAAaUAAAGAAAABYQAAAZ4AAAG0AAABcAAAAXgA
AAEtAAABoAAAAaIAAAG0AAABfAAAAZYAAAF3AAABkwAAAZQAAAGuAAABgQAAAV0AAAGGAAABkwAA
AX0AAAFkAAABfwAAAWwAAAE0AAABjwAAAUEAAAFEAAABaQAAAVQAAAG8AAABPAAAAV0AAAFVAAAB
YgAAAVIAAAFtAAABdgAAAWkAAAGxAAABdgAAAWwAAAFqAAABdAAAAVgAAAFOAAABZwAAAVcAAAFL
AAABSgAAAYUAAAGvAAABpAAAAaoAAAE5AAABbAAAAUIAAAGRAAABXwAAAUwAAAFUAAABRwAAAVoA
AAGZAAABaAAAAXoAAAGqAAABmgAAAbUAAAHEAAABigAAAW4AAAFlAAABUwAAAUgAAAGGAAABgwAA
AXIAAAFyAAABawAAAW4AAAFsAAABbQAAAWcAAAF0AAABUQAAAWUAAAGSAAABgQAAAWMAAAFWAAAB
XAAAATIAAAE5AAABhQAAAZYAAAHlAAABfQAAAXoAAAF3AAABsgAAAV0AAAGFAAABUQAAAVcAAAFF
AAABdwAAAYEAAAFTAAABUQAAAWMAAAF8AAABWAAAAWkAAAFlAAABVAAAAT8AAAFFAAABbgAAAVkA
AAFVAAABoQAAAYUAAAGXAAABVAAAAXsAAAFqAAABZwAAAWYAAAFrAAABygAAAbEAAAGqAAABjAAA
AXsAAAGkAAABVQAAAVAAAAFiAAABKgAAATkAAAGJAAABlgAAAcMAAAFGAAABMwAAAWAAAAFVAAAB
SAAAAVQAAAFUAAABSwAAAXAAAAFHAAABUgAAAX8AAAFkAAABlwAAAbIAAAHOAAAB/QAAAdsAAAGz
AAABnAAAAWUAAAGmAAABfgAAAYoAAAGeAAABEAAAAUIAAAFSAAABPAAAAYUAAAF4AAABXgAAATIA
AAE8AAABTgAAAUYAAAFMAAABiAAAAXQAAAG+AAABXQAAAYUAAAGkAAABZgAAAXIAAAE9AAABSQAA
AVMAAAFoAAABagAAAZMAAAGUAAABiQAAAbgAAAIaAAABpwAAAX4AAAHPAAABfQAAAWgAAAFWAAAB
fQAAAUkAAAFTAAABPQAAAWkAAAFnAAABRgAAAU8AAAF5AAABpwAAAUQAAAFxAAABWwAAAUkAAAFe
AAABRQAAAa8AAAF5AAABQwAAAUkAAAFIAAABRAAAAUEAAAFRAAAB+wAAAaYAAAGxAAABcgAAAXsA
AAFOAAABjQAAAXMAAAF3AAABgAAAAaoAAAFOAAABoAAAAeYAAAHAAAABiAAAAToAAAFoAAABbwAA
ASYAAAFNAAABoQAAAa4AAAG6AAABUgAAAUwAAAHNAAABagAAAZgAAAGKAAABZgAAAYMAAAFeAAAB
bAAAAW4AAAFRAAABdQAAAUcAAAFLAAABSQAAAYcAAAG6AAABtgAAAcgAAAGFAAABegAAAboAAAGn
AAABlQAAAWYAAAFSAAABSAAAAXMAAAFzAAABhQAAAVQAAAE/AAABkAAAAWIAAAFkAAABXAAAAV8A
AAGJAAABVQAAAV0AAAFGAAABcQAAAX4AAAE8AAABOQAAAYoAAAFZAAABZwAAAaQAAAE3AAABVAAA
AZYAAAGtAAABpgAAAX0AAAGIAAABhgAAAW8AAAF1AAABaQAAAXsAAAFcAAABegAAAZMAAAFcAAAB
JwAAAT4AAAE+AAABbQAAASMAAAFEAAABYAAAAU4AAAE/AAABIAAAAW4AAAFMAAABcwAAAXQAAAHy
AAABxgAAAYoAAAFfAAABWgAAAUoAAAGLAAABoQAAAfgAAAGEAAABfgAAAWQAAAFYAAABfAAAAUAA
AAFAAAABEwAAASwAAAExAAABgAAAAXcAAAFjAAABhQAAAf4AAAHPAAABUAAAAVcAAAFdAAABXgAA
AUAAAAFOAAACAAAAAgoAAAHEAAABsQAAAaIAAAFzAAABZwAAAWYAAAGmAAABYgAAAXYAAAFeAAAB
owAAAXkAAAFZAAABwwAAAWIAAAFzAAABcAAAAVcAAAFtAAABngAAAWMAAAFsAAABbwAAAWsAAAF6
AAABcwAAAVsAAAFyAAABWQAAAZEAAAGDAAABXwAAAV4AAAFkAAABYAAAAXQAAAFuAAABYQAAAXEA
AAGlAAABlAAAAXEAAAF8AAABrAAAAXQAAAFrAAABXgAAAZIAAAF2AAABcAAAAVwAAAFvAAABbgAA
AXIAAAF+AAABbwAAAWcAAAGJAAABawAAAWgAAAFsAAABagAAAaoAAAGIAAABbwAAAaIAAAGnAAAB
XwAAAXIAAAFsAAABWwAAAaAAAAFoAAABdQAAAU8AAAFRAAABLAAAAbwAAAGyAAABZwAAAYMAAAFr
AAABZwAAATEAAAExAAABVQAAATwAAAFqAAABXAAAAWoAAAFuAAABegAAAWQAAAGlAAABagAAAcQA
AAFvAAABdgAAAUsAAAFkAAABYgAAAVAAAAFiAAABfgAAAUsAAAFSAAABVwAAAUkAAAFAAAABWAAA
AVEAAAFkAAABtQAAAVoAAAF6AAABZgAAAV8AAAGOAAABgQAAAf4AAAGNAAABdgAAAW0AAAFRAAAB
gwAAAdAAAAGvAAABoQAAAYkAAAGcAAABrQAAAWsAAAGdAAABcgAAAXUAAAFpAAABdQAAAbIAAAFj
AAABeQAAAWwAAAGRAAABZgAAAVAAAAFWAAABdAAAAY4AAAFrAAABXQAAAVMAAAFaAAABeQAAAZAA
AAFxAAABZAAAAVYAAAFnAAABVQAAAWQAAAE5AAABcQAAAYwAAAGvAAABhgAAAaIAAAE9AAABXwAA
AXAAAAF1AAABTgAAAXwAAAF/AAABeAAAAb4AAAGjAAABcAAAAWcAAAFUAAABegAAAWoAAAF4AAAB
pAAAAXMAAAFPAAABdAAAAXEAAAF0AAABSgAAAYwAAAFhAAABbwAAAX8AAAGFAAABcQAAAW4AAAFU
AAABhgAAAV0AAAFhAAABcwAAAUYAAAFYAAABhQAAAacAAAF4AAABhQAAAWkAAAFjAAABfAAAAXIA
AAFbAAABkQAAAXcAAAFmAAABfAAAAXYAAAGSAAABfgAAAYEAAAGNAAABcwAAAWEAAAF4AAABWwAA
AU0AAAGGAAABaAAAAWIAAAFbAAABWgAAAWIAAAF9AAABtwAAAbcAAAFtAAABZwAAAW8AAAFrAAAB
aAAAAUsAAAFdAAABPwAAAUcAAAFJAAABWwAAAUgAAAE4AAABSwAAAYUAAAGWAAABOAAAAVwAAAFP
AAABegAAAZcAAAFMAAABUAAAAVwAAAGcAAAB6QAAAagAAAGGAAABbAAAAVUAAAGsAAABnwAAAYgA
AAFUAAABfwAAAV8AAAGuAAABkQAAAYQAAAF2AAABOgAAAZYAAAHCAAABTAAAAS4AAAEwAAABPQAA
AUgAAAGtAAABLQAAAVMAAAFiAAABdgAAAYgAAAGHAAAB4gAAAbYAAAG1AAABegAAAX0AAAFjAAAB
WQAAAWsAAAGZAAAB4AAAAcUAAAG3AAABmwAAAVgAAAGEAAABVAAAAV8AAAFiAAABgwAAAUsAAAFf
AAABbwAAAVoAAAFdAAABSwAAAT8AAAEnAAABTQAAAUIAAAFOAAABbAAAAZ0AAAGDAAABugAAAZUA
AAFaAAABqQAAAbIAAAGpAAABqwAAAYwAAAF1AAABdwAAAWUAAAFuAAABZwAAAYMAAAFpAAABcQAA
AVkAAAGcAAABSQAAAWAAAAFhAAABaQAAAXcAAAFuAAABZwAAAYYAAAFlAAABegAAAYAAAAFfAAAB
owAAAXkAAAF0AAABrgAAAWoAAAG4AAABdAAAAXUAAAFrAAABkAAAAWgAAAFSAAABdwAAAVsAAAF4
AAABagAAAYcAAAFvAAABpwAAAZwAAAFxAAABSgAAAVMAAAFZAAABcwAAAUQAAAF1AAABZAAAAYQA
AAGYAAABZwAAAYcAAAFnAAABdQAAAUgAAAF7AAABXAAAAUwAAAFpAAABUwAAAWcAAAFSAAABmAAA
AXUAAAGeAAABRgAAAWcAAAF5AAABXwAAAWUAAAFuAAABeAAAAaUAAAHOAAABdQAAAWkAAAFuAAAB
bgAAAXQAAAF3AAABawAAAXUAAAFhAAABXwAAAVgAAAFtAAABkwAAAZIAAAGMAAABaAAAAU4AAAFv
AAABdgAAAVUAAAFtAAABeAAAAZIAAAFZAAABawAAAZgAAAGXAAABgwAAAWUAAAF3AAABWQAAAbUA
AAGBAAABkgAAAbIAAAGOAAABdQAAAUwAAAFiAAABYQAAAWQAAAFcAAABZgAAAW4AAAGIAAABkQAA
AaQAAAFfAAABXQAAAVMAAAFgAAABQgAAAVQAAAFKAAABYAAAAY4AAAFeAAABaAAAAasAAAGHAAAB
UgAAAX0AAAFuAAABdAAAAV0AAAFuAAABmAAAAX4AAAFvAAABYwAAAaoAAAFMAAABdQAAAUYAAAFE
AAABPAAAAWUAAAF3AAABeAAAAWIAAAFyAAABaAAAAboAAAGxAAAB2AAAAUQAAAF3AAABfQAAAakA
AAFxAAABgAAAAVUAAAGVAAABmgAAAVQAAAF3AAABewAAAXEAAAFzAAABUwAAAZYAAAGGAAABYAAA
AVAAAAFrAAABcAAAAW4AAAGKAAABbgAAAUAAAAFQAAABhQAAAVIAAAFyAAABawAAAX8AAAFrAAAB
dwAAAYsAAAHPAAABXgAAAWgAAAFyAAABQQAAAT0AAAF5AAABYwAAASEAAAF5AAABYAAAAW8AAAGO
AAABxAAAAY4AAAFkAAABrAAAAXMAAAFoAAABYwAAAXMAAAF1AAABYwAAAUwAAAFjAAABXAAAAaQA
AAHeAAABjgAAAYYAAAGYAAABggAAAWIAAAFQAAABfQAAAXQAAAF8AAABYwAAAb0AAAGCAAABiAAA
AUoAAAFFAAABcQAAAWEAAAFzAAABdQAAAU0AAAFiAAABfAAAAV8AAAFmAAABdgAAAVsAAAG0AAAB
mwAAAVEAAAEoAAABUQAAAWkAAAF7AAAB4AAAAYkAAAGHAAABnwAAAWEAAAGoAAABaAAAAXIAAAFH
AAABcgAAAYIAAAFmAAABfgAAAV8AAAFEAAABBgAAAU0AAAFOAAABZQAAAWMAAAFfAAABSwAAATQA
AAFDAAABjAAAAZgAAAF6AAABpAAAAb8AAAHBAAABfgAAAYQAAAFiAAABWQAAAVsAAAF6AAABZQAA
AX0AAAFWAAABkgAAAVIAAAFpAAABXAAAAV8AAAF0AAABnAAAAVIAAAFaAAABiQAAAawAAAFpAAAB
uAAAAWwAAAF5AAABXwAAAcAAAAE6AAABcQAAAZsAAAG5AAABlQAAAZgAAAFcAAABXgAAAWkAAAGP
AAABZwAAAXoAAAFfAAABugAAAYcAAAGvAAABsQAAAXAAAAF5AAABbgAAAWoAAAFsAAABMgAAAXAA
AAFnAAABRQAAAWEAAAFIAAABTwAAAXYAAAE9AAABigAAAbgAAAGZAAABqQAAAccAAAGmAAABVwAA
AUQAAAE8AAABaQAAAZ4AAAGTAAABeQAAAUYAAAFiAAABWwAAAUcAAAFSAAABgAAAAVsAAAGBAAAB
ZQAAAdMAAAGOAAABYwAAAUwAAAFfAAABUgAAAVAAAAG8AAABOQAAAWMAAAFeAAABbAAAAVEAAAFt
AAABYgAAATwAAAFqAAABuwAAAZAAAAFrAAABlgAAAYQAAAG4AAABUQAAAVwAAAFjAAABbgAAAXwA
AAHXAAABwAAAAZgAAAFmAAABawAAAXkAAAFWAAABOAAAAVQAAAFLAAABiAAAAcEAAAFtAAABZgAA
AVgAAAG1AAABXwAAAVUAAAFWAAABlQAAAU4AAAFhAAABlAAAAVcAAAGVAAABfAAAAY4AAAFfAAAB
TwAAAaUAAAGtAAABZQAAAXsAAAFyAAABXwAAAV0AAAFfAAABewAAAWsAAAFqAAABYwAAAWIAAAFS
AAABYAAAAT4AAAF9AAABVgAAAcwAAAF4AAABYgAAAaEAAAGJAAABvgAAAaoAAAFwAAABgwAAAXYA
AAGLAAABTAAAAXMAAAFpAAABSQAAAWQAAAF1AAABmgAAAVAAAAFVAAABYgAAAYQAAAHCAAABkgAA
AYcAAAFRAAABYAAAAU4AAAFdAAABRAAAAbIAAAGQAAABgQAAAXsAAAFpAAABTQAAAVEAAAGWAAAB
ugAAAXsAAAFuAAABJgAAAaUAAAGBAAABmgAAAVcAAAFcAAABSgAAAW4AAAFmAAABZQAAATwAAAGV
AAABrQAAAY8AAAFkAAABcQAAAWQAAAFvAAABWQAAAU4AAAE/AAABTwAAAVgAAAGGAAABlAAAAVYA
AAFqAAABfgAAAaQAAAGvAAABpAAAAV4AAAGEAAABXAAAAUQAAAFZAAABEQAAAVYAAAFRAAABTQAA
AVMAAAFbAAABawAAAVcAAAFjAAABdgAAAX8AAAHYAAABxwAAAVgAAAFGAAABVwAAAb4AAAGjAAAB
XAAAAXkAAAFsAAABUwAAAcUAAAG6AAABpAAAAYUAAAF3AAABYAAAAR4AAAFMAAABTQAAAYAAAAGH
AAABUgAAAXcAAAFdAAABegAAAXcAAAGgAAABeQAAAWgAAAFwAAABdQAAAWQAAAFjAAABqQAAAd8A
AAGPAAABeQAAAYMAAAFWAAABfQAAAVUAAAFkAAABYAAAAWoAAAGDAAABgQAAAXIAAAGHAAABjQAA
AYwAAAF6AAABbgAAAWcAAAFqAAABcwAAAbUAAAFlAAABrwAAAXkAAAFbAAABSAAAAWYAAAFRAAAB
dAAAAV8AAAF1AAABaQAAAXIAAAFcAAABbwAAAX0AAAFIAAABawAAAX0AAAHOAAABlQAAAZMAAAGR
AAABnwAAAV0AAAGIAAABeQAAAVsAAAFCAAABXQAAAWUAAAFhAAABZQAAAWwAAAFhAAABlAAAAWcA
AAFdAAABXgAAAVMAAAG3AAABYAAAAXwAAAFMAAABUQAAAVUAAAFTAAABSQAAAZEAAAFMAAABlAAA
AboAAAGeAAABsQAAAXYAAAFfAAABcgAAAc0AAAGCAAABXAAAAUUAAAFBAAABUgAAAT0AAAFhAAAB
kgAAAYoAAAGsAAABqAAAAY4AAAFdAAABZgAAAXwAAAGEAAABagAAAVwAAAE+AAABKAAAAXMAAAFe
AAABVwAAAc4AAAGPAAABmAAAAcIAAAGXAAABmgAAAXcAAAFlAAABQAAAAaYAAAGsAAABiAAAAXMA
AAFaAAABcQAAAVsAAAFgAAABOwAAAVoAAAFtAAAByQAAAWYAAAFTAAABggAAAWkAAAFbAAABRwAA
AVsAAAFCAAABaAAAAWoAAAFrAAABTwAAAYkAAAFvAAABgAAAAV4AAAGFAAABpgAAAbAAAAFvAAAB
bQAAAUUAAAFrAAABqgAAAX0AAAFlAAABeQAAAXsAAAGPAAABXQAAAXYAAAFMAAABawAAAUoAAAGG
AAABYQAAAY0AAAFgAAABawAAAVQAAAFgAAABbAAAAVUAAAFSAAABYAAAAVkAAAFqAAABogAAAWsA
AAFHAAABaAAAAWsAAAF3AAABqwAAAdMAAAHDAAABdwAAAWMAAAFFAAABcgAAAY0AAAF4AAABggAA
AToAAAE8AAABQwAAAUAAAAFBAAABngAAAawAAAGMAAABdQAAAXUAAAFnAAABjQAAAVIAAAFTAAAB
sQAAAakAAAGAAAABhwAAAXcAAAFvAAABYQAAAWMAAAE6AAABXQAAAWsAAAH0AAABkwAAAXEAAAFj
AAABvgAAAVwAAAFHAAABogAAAWIAAAF0AAABiAAAAWQAAAGdAAABawAAAWEAAAGcAAABSQAAAaoA
AAG7AAABiQAAAZcAAAGDAAABaAAAAWsAAAFLAAABYwAAAUAAAAGTAAABjAAAAYoAAAGXAAABXAAA
AVQAAAFCAAABVwAAAVQAAAFSAAABjQAAAcAAAAGKAAABbQAAAVwAAAFQAAABVAAAAVsAAAFuAAAB
cgAAAWwAAAGxAAABOgAAARAAAAE5AAABNgAAAUwAAAEuAAABcgAAAUsAAAFjAAABVgAAAVoAAAFh
AAABZAAAAWcAAAFrAAABdAAAAXMAAAF0AAAB5wAAAXkAAAGjAAABdgAAAb4AAAGYAAABZQAAAXsA
AAFVAAABRQAAAU0AAAFrAAABNgAAAVQAAAFUAAABWQAAAXQAAAGZAAABiAAAAVwAAAGIAAABbwAA
AXwAAAFCAAABnAAAAbsAAAF1AAABnQAAAUkAAAFpAAABQwAAAT4AAAFqAAABdAAAAXMAAAF0AAAB
cwAAAXQAAAFzAAABvwAAAeQAAAHZAAABzgAAAa4AAAGJAAABdwAAAbsAAAHGAAABeAAAAWEAAAGL
AAABagAAAWIAAAGIAAABcwAAAY8AAAFfAAABZgAAAWkAAAGdAAABoAAAAZIAAAGPAAABZgAAAV0A
AAFZAAABYwAAAWIAAAGNAAABVwAAAU4AAAGDAAABdAAAAW0AAAFwAAABcQAAAZsAAAGxAAABWAAA
AWcAAAFYAAABdwAAAZ0AAAFrAAABRQAAAXIAAAGXAAABYgAAATYAAAFKAAABewAAAZgAAAFsAAAB
ggAAAXwAAAFmAAABaAAAAVUAAAFIAAABYwAAAXIAAAFHAAABhQAAAWYAAAFsAAABmgAAAVkAAAE9
AAABhAAAAXwAAAGHAAABlAAAAbUAAAGDAAABowAAAVsAAAGcAAABVgAAAXoAAAFiAAABjAAAATMA
AAFNAAABZgAAAZMAAAG9AAAB1gAAAYoAAAFoAAABagAAAWAAAAFdAAABWgAAAZwAAAFNAAABVAAA
AVQAAAFPAAABOgAAATsAAAFrAAABPQAAAT8AAAFWAAABaQAAAUAAAAFmAAABSwAAAU8AAAFOAAAB
SQAAAbEAAAH5AAABswAAASUAAAFSAAABYwAAAUoAAAFlAAABaQAAAVUAAAFFAAABgQAAAckAAAHJ
AAAB1wAAAWYAAAFBAAABTgAAAUQAAAE2AAABcAAAAbEAAAFIAAABgAAAAckAAAHnAAABzgAAAa4A
AAGSAAABwgAAAcsAAAGqAAABaAAAAU0AAAFpAAABdwAAAaUAAAFYAAABKQAAATwAAAEeAAABPAAA
AXMAAAFgAAABXQAAAYAAAAG4AAABaAAAAXYAAAFpAAABigAAAXUAAAFuAAABcAAAAVIAAAFoAAAB
ZQAAAYAAAAFEAAABUwAAAXwAAAGUAAABaQAAAXUAAAFBAAABmwAAAcIAAAHbAAABXgAAAYgAAAGB
AAABQQAAATcAAAFMAAABWgAAAWoAAAFPAAABbwAAAWAAAAF3AAABSAAAAUgAAAFnAAABegAAAZQA
AAHUAAABggAAAYQAAAH+AAABqgAAAVkAAAGCAAABWgAAAWUAAAFbAAABPAAAAUIAAAE6AAABXgAA
AVkAAAGDAAABWQAAAVgAAAGDAAABfgAAAYYAAAGaAAABnQAAAWcAAAFsAAABVwAAAUYAAAFbAAAB
XAAAATMAAAGCAAAB+gAAAdAAAAHKAAAB1AAAAZwAAAGlAAABcwAAAWoAAAF2AAABhwAAAWkAAAGd
AAABcQAAAW8AAAFAAAABSAAAAT0AAAFSAAABbwAAAVsAAAF2AAAB1QAAAaQAAAFmAAABdAAAAVkA
AAFkAAABTgAAAUkAAAFwAAABRgAAAToAAAFyAAABRAAAAUcAAAFFAAABbQAAAZYAAAGwAAABwgAA
AXcAAAGfAAABagAAAWkAAAFxAAABXgAAAUYAAAF5AAABXAAAAW8AAAF8AAABjQAAAb0AAAHZAAAB
3wAAAbIAAAGkAAABVAAAAUcAAAFTAAABXgAAAVoAAAFMAAABxgAAAZwAAAGFAAABVgAAAVkAAAFh
AAABjAAAAVUAAAGaAAABXgAAAWsAAAFfAAABWQAAAXEAAAFnAAABcAAAAV0AAAFfAAABWgAAAUcA
AAF8AAABlwAAAckAAAFeAAABVgAAAVkAAAFHAAABcAAAAUwAAAFNAAABSgAAAXMAAAF9AAABTAAA
AboAAAFOAAABogAAAV4AAAFIAAABRQAAAXAAAAFSAAAB1wAAAbwAAAEnAAABNwAAATUAAAE6AAAB
TgAAAY0AAAHuAAABtQAAAagAAAGhAAABfgAAAS8AAAFCAAABQAAAAYUAAAG1AAABvgAAAV8AAAGX
AAABbAAAAT0AAAFFAAABNAAAASwAAAEtAAAB4AAAAckAAAGtAAABnQAAAXYAAAFyAAABTgAAAYIA
AAEnAAABZAAAASUAAAFeAAABcgAAAcYAAAH8AAAB0gAAAaIAAAGIAAABeAAAAX4AAAGVAAABZAAA
AW8AAAF/AAABfgAAAWgAAAFdAAABlQAAAWcAAAFvAAABfQAAAWcAAAFUAAABeAAAAWYAAAF9AAAB
iQAAAUMAAAFfAAABSgAAASwAAAE+AAABLgAAAZQAAAGUAAABgQAAAW0AAAFHAAABVQAAAakAAAGB
AAABogAAAYUAAAGSAAABDAAAAVkAAAFbAAABRgAAAVAAAAH+AAABywAAAZ8AAAGhAAABoAAAAXEA
AAFZAAABogAAASoAAAGEAAABlQAAAaMAAAFqAAABqgAAAYkAAAGFAAABrAAAAWcAAAF/AAABZgAA
AUUAAAF/AAABSgAAAWgAAAFvAAABLAAAAUQAAAE+AAABVgAAAVIAAAFdAAABgQAAAegAAAF1AAAB
VwAAAUsAAAFnAAABOwAAAVMAAAGFAAABXwAAAYEAAAHbAAAByQAAAWgAAAFmAAABdAAAAYYAAAFb
AAABZAAAAQkAAAE9AAABQAAAAW0AAAFvAAABPgAAAUYAAAFGAAABNAAAAU0AAAHZAAABlgAAAeUA
AAHXAAAB7AAAAXQAAAFSAAABbAAAAXYAAAFnAAABgwAAAWoAAAF/AAABcwAAAVEAAAFjAAABUwAA
AVUAAAFHAAABqAAAAaIAAAErAAABVAAAAU4AAAFrAAABiQAAAbQAAAGVAAABZQAAAZQAAAGwAAAB
XQAAATkAAAFDAAABWQAAAZgAAAGLAAABcgAAAWgAAAFtAAABgAAAAWsAAAHdAAABvQAAAY0AAAF9
AAABuQAAAU0AAAE6AAABNQAAAVwAAAE5AAABaAAAAcgAAAGoAAABYgAAAS0AAAFFAAABKQAAAaQA
AAG+AAABdAAAAYEAAAE7AAABHgAAAUsAAAFkAAABPAAAAT4AAAFbAAABUgAAAU0AAAHWAAABmAAA
AXoAAAFwAAABUgAAAS0AAAFjAAABSgAAAUUAAAFzAAABdAAAAbwAAAHuAAABxAAAAd8AAAG0AAAB
hQAAAW8AAAF4AAABgwAAAYIAAAF1AAABcQAAAa4AAAFlAAABVgAAAFIAAACZAAABcwAAAXQAAAFz
AAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABdAAAAXMAAAF0AAABcwAAAXQA
AAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAA
AXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAAB
dAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0
AAABcwAAAXQAAAFzAAABdAAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMA
AAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAA
AXQAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAAB
cwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAF0
AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQA
AAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABdAAAAXMAAAF0AAABcwAA
AXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAAB
dAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABdAAAAXMAAAF0AAABcwAAAXQAAAFz
AAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMA
AAF0AAABcwAAAXQAAAFzAAABdAAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAA
AXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0AAAB
cwAAAXQAAAFzAAABdAAAAXQAAAFzAAABdAAAAXMAAAF0AAABcwAAAXQAAAFzAAABdAAAAXMAAAF0
AAABcwAAAXQAAAFzAAABdAAABcxzdGNvAAAAAAAAAW8AAXAEAAH2vwACjA4AAz0OAAPGcAAEUyMA
BN4fAAVjDgAF8skABmZ3AAcTjgAHqFkACBUQAAjf/QAJx3sACqTHAAtvLgAMLLsADLw6AA1NeAAN
xfoADnvyAA7/JgAPeaAAD9eEABCb0wARBPIAEZeTABIYCAASfHgAEuajABM6QwATnwEAFBP1ABR6
uwAU6dMAFWPTABXLsAAWGzAAFm01ABbcMAAXN2QAF3z4ABfhUQAYOF4AGJRFABjqHAAZdOUAGdup
ABpDMAAbDdcAG3XMABvIxgAcN6MAHJH2ABz1FAAdR/IAHZmkAB30VwAecVMAHvyMAB97tgAf8kAA
IGz7ACDSmAAhSzAAIbxFACIsegAinkkAIwhRACOHtAAj4GQAJEfxACS6sQAlEjcAJc6uACZN0gAm
q+AAJx5vACejPgAn9FQAKHoWACjgUwApZX4AKd9lACp9DAArB8UAK56kACwkDAAsyMwALW7TAC3n
igAuacEALtUzAC85RAAvriEAMEShADD9PgAxkPEAMeK7ADK+GgAzJz4AM4XVADPjxQA0MzoANK0N
ADUhsAA1hhAANiEwADbDRgA3QgIAN+IwADhUlAA5OK4AOittADraHwA7cBsAPCraADzT3AA9SpwA
Pe2KAD5b8wA+x/YAPyAGAD+FaABAHFIAQJTyAED4KQBBRv8AQbKUAEIYGgBCl+4AQvU1AENC4ABD
k1oAQ+qZAEQ9NQBEhy0ARPoeAEWzbABGAroARlXrAEalIwBHDpwAR2csAEfk4ABIRg4ASIsuAEjz
9wBJYUQASbXvAEoP0wBKc7MASs6iAEshnABLgwwAS8sOAEwgGQBMeJQATONqAE1MfgBNomsATgEN
AE5RkwBPDsoAT2XbAE+7/ABP++sAUH4tAFEStwBRdFoAUeC8AFJPCgBS02cAUyLLAFN7XgBTzFkA
VDE3AFR6qQBU0sYAVT67AFWwnABV9r4AVk5UAFabRABXAzkAV2g3AFfOcABYEQsAWMm5AFk+swBZ
q6QAWf0LAFpK/ABam7UAWuORAFtAPwBbkUIAW9y4AFw+CgBcrF4AXQbWAF1QvgBdu+4AXhmyAF5y
wABerxYAXv0rAF9NgwBfzF8AYC7vAGBviABg0fEAYSzfAGHwyABiVTUAYrKjAGL8kwBjY8MAY9Ex
AGRH3ABk6yIAZWc1AGXENwBmVBAAZwPkAGeRCwBoNYoAaOYzAGlkVABp2coAakweAGq7jQBrBYEA
a3OdAGwjkgBsigEAbS7KAG2mQwBuTeoAbtc2AG9sBwBv2+IAcFv0AHDRhQBxRcAAca00AHIjMABy
l48AcvARAHNYCgBzr34AdFf5AHS4XAB1LJMAdZ39AHYMmAB2j1QAdv5qAHeKAgB4DTAAeKsMAHkg
OQB5tGAAengVAHrt/QB7UvQAe+MpAHxpDQB9DxwAfZgaAH4qtwB+6DgAf5AzAIA/8gCAr/cAgTp1
AIHbowCCcl8AgzcHAIPZXQCEji0AhSxIAIXGTgCGhvAAh5JtAIhPAACJGeoAiZfWAIqL/ACLBPsA
i26oAIvHugCMQ08AjPX4AI1u+wCN5wAAjk8aAI74awCPtuoAkG43AJEJ9ACRnr0AkjjSAJLGSACT
eLIAlAJ5AJRnkQCU4O0AlU7mAJWw7ACWMwoAlqHlAJcIdgCXwg0AmFGJAJjwagCZiCgAmiLdAJq1
VwCbSsgAm+DfAJx3owCdHp4AnaTJAJ4RkACegZ4Ant7JAJ9KpQCf3H4AoEMWAKC78wChBF0AoX08
AKHWAACiXewAorTzAKMqSwCjqnoApHmTAKVk9gCmEY0AprwlAKditACnzvYAqDiIAKh6cACox/cA
qQ5QAKle3gCprQMAqegKAKot3gCqiL0AquMWAKr3aACrCkYAqx6XAKsy6ACrRzkAq1uLAKtv3ACr
hC0Aq5h+AKus0ACrwSEAq9VyAKrz9W1kYXQAAALlBgX//+HcRem95tlIt5Ys2CDZI+7veDI2NCAt
IGNvcmUgMTQ4IC0gSC4yNjQvTVBFRy00IEFWQyBjb2RlYyAtIENvcHlsZWZ0IDIwMDMtMjAxNyAt
IGh0dHA6Ly93d3cudmlkZW9sYW4ub3JnL3gyNjQuaHRtbCAtIG9wdGlvbnM6IGNhYmFjPTEgcmVm
PTUgZGVibG9jaz0xOjA6MCBhbmFseXNlPTB4MzoweDExMyBtZT1oZXggc3VibWU9OCBwc3k9MSBw
c3lfcmQ9MS4wMDowLjAwIG1peGVkX3JlZj0xIG1lX3JhbmdlPTE2IGNocm9tYV9tZT0xIHRyZWxs
aXM9MiA4eDhkY3Q9MSBjcW09MCBkZWFkem9uZT0yMSwxMSBmYXN0X3Bza2lwPTEgY2hyb21hX3Fw
X29mZnNldD0tMiB0aHJlYWRzPTE4IGxvb2thaGVhZF90aHJlYWRzPTMgc2xpY2VkX3RocmVhZHM9
MCBucj0wIGRlY2ltYXRlPTEgaW50ZXJsYWNlZD0wIGJsdXJheV9jb21wYXQ9MCBjb25zdHJhaW5l
ZF9pbnRyYT0wIGJmcmFtZXM9MyBiX3B5cmFtaWQ9MiBiX2FkYXB0PTEgYl9iaWFzPTAgZGlyZWN0
PTMgd2VpZ2h0Yj0xIG9wZW5fZ29wPTAgd2VpZ2h0cD0yIGtleWludD0yNTAga2V5aW50X21pbj0y
NSBzY2VuZWN1dD00MCBpbnRyYV9yZWZyZXNoPTAgcmNfbG9va2FoZWFkPTUwIHJjPWNyZiBtYnRy
ZWU9MSBjcmY9MjQuMCBxY29tcD0wLjYwIHFwbWluPTAgcXBtYXg9NjkgcXBzdGVwPTQgdmJ2X21h
eHJhdGU9NDAwMCB2YnZfYnVmc2l6ZT04MDAwIGNyZl9tYXg9MC4wIG5hbF9ocmQ9bm9uZSBmaWxs
ZXI9MCBpcF9yYXRpbz0xLjQwIGFxPTE6MS4wMACAAAA2VGWIhAH/dqhqE7UhlMS6STlSYP2emYkE
VD1wLThD4HImQKM/6DoDb6YZHCaEmm4BFnfD+PbjqewG40uOTfv0ygrLqv2IevhQPK/s5rqDFhI1
+EMtIzwpyn8gtQJrQwhRLtaMroDOit1+wuI3HM2iNdefeFeZAbj4Pzbqw/d6pvgUmichLlgOG+GZ
S8h9g54LxOemD9ltFXYquuGmmcpC2PEsiPJG/VANCOVq2UXdBX/NfjyYGGcV6Sa20vZwpjyakzUF
BQNUx9C0Z3zddLQE06JjuJroyW+hlpaf1W4WLNZpZn/DLeWepPY0Cu4ey88qJtlWBZsSN7asISfO
JiJ0vZ/VAbr5xDy3ZHM116X2Mb5vCV6rJw0qkOY8idqq9D61vbUFMNaDaRcfMmKkp2Zb+zmp+WaC
F7zc99oH4iY14TFP4fsoI/R276bCScajX5eNRuxi+Zqo9AlW5CoyqI3t4ouYNDl3iP5dRSB3dphB
iekNuFMFt7fObF2jvF0dt5jnuecbHAIxHxEqwlKPlK1W4n+LapDiSW4MMFN/x6nJVP6SgT0dKC9h
OUFNEaWRdqsDbcGYhRyJrG+FTO7lrpcpv2wGJYsMAFFYIDNULtSt1KHIsglce5Tt1hZ3IchyvmYM
xxGq6g6EX9bh8bKaAoOEjX0qIl0xwQ3WdPEfoCCGBZKYcXIATeKomBG9WHa05WQBLe3HrNkN8zUw
3VemuuvaXZ7NSaFT6BeUo0lRtEgSo9UE5CP6ayPOI2J9N3xV5KWLHq/7BnEbVMMSrv9mQfzO2Loo
Wr4fc/cAFkEGFBm3f0dFzW51EdZ6IEHfohShdOnaDS+bWATvpOPj6ySkgNwXAKrVGIfFMHiYK4c7
/M8KNsE26yKPrEfVWmYxxZ+hiM3wc59V3h6pMnYw8zrJDz9pxkY1+QgmTDQdc1I4pLldIRZSK9Kj
2c3OTFi1giCMRYqRkE/x6qA4dZWo1+z9Y688yuBCAfK/ZTtn13ehyUFj3nZQAE0GE9Kcr5YEzpuI
wh1mhU0cKXcslSkglHNWkguVYa58Zsdux46MwN9CrdRnX7lo3PTsYmq+iNgL5H2b92MmhuLkXF0H
50+f15llyb0m2eDgoXDQ4tbYJTR1ifLbuwTLjBwssihtA315wjBQc0dyFzup6B8WMt2PQ1NOYJkV
gW/Eu6Szuf4t04/7LSbSV1b0FGELXD0j3fMgFOLLgahNNFy6UqPO74xik4m1/6eiJpPRep0g0a+x
MrXeKAm4RtqETk/i2i1PAAPshq2yF7z5VnU8CK+8I4PnUIBMbUwklRBnJhgbUI8H65vRoiC9W8zK
u3aYQB9j7hXL8ctm+lcVVIubtH5Q5zC5/LcgtOlZAlRbMqFiwXZgM24AJIRl2Q23CSIVJKOsavhQ
/wngxWpsODUc21nml+JsXrpLdF885YR2YEcQ5HyE1GTo+8XZcnXRikUILyfYFZ15QxUfdhiA79QI
kcOkFP6Q0VMullFVLe4VydqtyLGtdcxH4C4cONcqcNjKxpUqaGdEuTbbrMnzMZEA64I0QyUhb3Wp
g4bq7R9AihpFl58w1jgt/tjIPF0LcNHg3i2CJTkR9p1FtWzt2+WK8hrdWVNaIVR6yIXTOS6ItIuU
8KIffUBGGxvBsZ58yz/ABOWejOwv4pNXHb8W0E+afFvgNzjdBmvuG3U0Beow9RMFPaUmUpDE6mws
4ylyIQF9vccOvLNHuQorUCZy+OAseGDH1l6u3g2f/2a0A4Nsp+KLk+7ca7jQjNV5VCpi7B57WZat
Y81DzzROGbjMCGWvVQX3LBM0CkI5m++RlkkuR3LlebHGZexagHdQ5kQh6GU2M+yQ4WPVFf3PB3ga
qKNUp3IqFJVk1sz3xxdWZvioLVHWIxwgSfFrG02n4zIdGmslS4HQz4JjHEZvJc0SzeAL7GrsSR9Y
3FYlea+QRn4/DRaAQG8oBH4qEtCasqjQcHKtL76Ii00cemZB8GeVWClrbG2BRxW2KElXrC0O5wU+
p5S7E32eOYw86C/DLiS+FtxvgcAsMdRnXh4jzSMqHycS/o91bYWJbMEtT8J/YsyzsMDBimDLeyfR
YAPXiJIw8sXaXPleb+PrSf0y+MmjDUBstM18EEvV1qjhLwVR8o0REkFITouDz6o3KIFAU58WhheU
jB3WYYgv+TZu2y9RxaTUQe8ZN0YnM9AlSHoFWmlIOveN94sgewoPsSitz4Fo1qwOKZIdM+8zUMP7
PVW1JU3/W58rK5lemk6B/avX3K6rywtRZuCT824opzzCfYTu28qSPQgiS0lMISubSjGok0lAzKUQ
tdLGh7zT6arPa4aYi30TzDhJDP3+vC4k75yCHNqeogq/IAAcaNiYm/JrSmfJt1YXcHnsNa4XbRAY
77JNnhh8i+hzLxqJVms1e4rqUH6DLNTpRXrZ/IZOjkyCdHs4i47b/kW2SzJJxadu+nUnkkXyRdJI
mOlQ2vbyEAc4L0dERRu30wXMaVA+QpjezM7L3vf7rR6pexpZd5HPNrXLhcvzy1medYKUNVw4RROf
XSzv9b5Uuh3ARgn/Ha1nYveSU/7mtaFGmJgKYg+uNJ+h+kWj/tEtymj6nkjMEO+AXSjX1OQHfOjE
iGvjWe+c64ucCX1mBew+1LlS0xoYT18Xlfw7Bw4erzpSbph6QzeWWy+dv0Qhi3JAAnagvB0p3AXq
MmRO3j/EswMzIf/ceMbc3KrHnGsvg7eDLK7euZPuoO6zLPbvPR7NHgIQDLx0SRD1W/mzpWbuHngi
l9VlPdpbCJw3vE723dxLNze2uydJrNw4EXC7CTVvl7PuBsU4kXWqe1fqnPPhC+GKx4m1BSzHIizP
qSxGtVu/Cjz4BOfkBlyqpLf9V/GnEMFQLxcDKZrTvc1M+s9xPMemZ/1IqSwxx5H/tX45NvriBGPX
TN1Ny6VlDtFp5tbgdq6p0XVhfzwhAkV5ireglOZmJnsM6l1rylYSnwJtoohv/o8+2rX3mb0unMy4
Xz6I7+uN9a3KRaNY/GMg9lkdqSkr5feNrGB4yzGhs76vRfbndyf9nD9OBmNdTfIN2Hh2X62vFWQS
Wy8/aw/sBlGHMNyzTRPAC7GN/o0+2lMh9jibRFiXzQDc/k9vIwtgdntyQsVJVoU4BElLJgmeMthD
CfKZywMpEJZ+nqbWXiwSXppZOaZKPJ/bopVxxHLd2dFzhnUrFM1cu+tgEmCC6emfa6M2Q+wyx4eX
xQSelK+uIGYEMZMNdpBddApX77G1kYuGQYL71BWbAMUUOXzUM3LKdh00ol8UiHz6fbkDa9bq9MsH
d3MkwSFGAWEElrf5gkAtfhRGwpgTU+hTrB1el1qWnXilYPv1ka+gVaV2DYDxY6rqSfKmyQKK0QO7
2fr3tw9LIhyzOAtzL5nWu3+aVcEgFBmiG1szNMFXTFcaRDQ9bb7LMvNvbUWwPn3JG+nSb13r41US
EagKdhC5kpyluwnhczlDALKS9sEF8Q31Rng/rcaY+QNc7Y5E9jdekrYUyHDayA86d0IRw6UNOEXi
fNFLSbhJj8HUxsOGOgwoXuPM/NiWZn8xA/bZgkr6Li21q5ic2wYfpAbpuJwuRP8IZuH8i6/EY9ej
QDOU9XmnyQBl26PZUKLBMCO0X8hQSUxn5ouKq/3ScyD7kLKc5mEkWwPAfgpleJ8ubabWkVToUXYB
h8g+PYs3imOfMvVtbQ5TbKGu0fnTk+4FAaLCZ+zqgv0qGdixBV1ivYm/GsKLamrZRlgVrGtMdlf/
YK+OsRaXSMnHR+uS37ENi/QgbCnDRk669Qqv2Qtc8+UUyug6SmmvjTxeI7wWzHqdRc7cCJNPltBS
gEEXdcIMlW7l4q8+Om+PIl3RAYf4Cmkgpdawf/tP40YR7b+Da9RQcQxIxsDbAd1AMIFKLCjkvEvP
jCPSxvV0WIPSzn2APIWjLVIj8buXBjtLwEhCCW9WCAVLhrBKkXb7eYgTUqoNzimQgJkmLN7WsTUp
9xVznYiq9OsU7fUF8vsSpVi28vMeQv8xeWGfLRgnfeKwUxvg3Vlmd4nseTp2hhwme2UEroJ2GZ0h
w2yLMO/vdjCVdaqpO3XKPCJL4s0Xo84p4UuiTQxHAum+ME/ZH4FF+nGCiwHNw2ZawstIXLtdpCSH
ayi6GSrGC0lMVh5uUvrGEa1G61rALKnGXqq1+7gi5tGy8hCwZLjOef4kzvCV++pE/0cu3JwuTLrQ
jJ3Ret6dKlfYdz5k5tSG2NAjHBRU3/C24J1NTEHWZdd+jkjlQt0sxGmx4Z0sq5MR4mRdU9zzXg+b
v5zDDT1jX7/GZTFOENv/TNyKMAxFpce/mvG9WOy8RDlCMNfmyuMA+pbH8oVW8t73mp5O1jOShzL5
d4Uzxs+HzQnENB/nPRJQc/d1ZUW7z0/F1JES6Zgz+O4m7Hp29/et78E2L8J0yUmrWCWHX+jwFXwO
XZsEX9InW58SE34rMkD+hB45Q1YDxXpA2cBv/Af7woDApw1m/8kKC1aJI9WbqzaxwApcgOBQKD63
5mjHp6BiG8rRx+SUEg1b2CH3Vy6b/nrQ4hxFPYxvDBObP5XIao9t49VDgPhG9dVwoGJv2gfzcrBA
u/Fmhss00l6h1B/O0aoQaJTNGgPK1jUN767BSPNc571vqIuOIvBIu/ddGjWM/BkV5zWMaDYjE1Ef
wI7d5/WgNBF3Xcm76/S3/B9mYEg3+2Cr0Ku4gKt3GJYavroW94tsOnk1R3ch5XzMmDqqdiCEWA5E
2F7sFRr1s6MhmJvM5ZowgjVeWHmOYxoxt65zlbjAkjzI3dfXlk/yYgBIboaD0l2RcYOIxspCeFni
hxK7rp6xU8jxfi8MvLW0qMcfOI20TPWm4mobTaKGeGnl3Tvwwz5dBzDMVJCA8yY2GNX0rIx9MYLE
tWCfUpij7sKMlkfz1oMW2ViuEGpKDaugu0lJNqlxvNp1zV849agnm/MeHz+wJerUqHwy8fzx1Zr6
oJgZbq8gYfpqH8OWZ7SMGjy3gsXV3ckERwB3D1oNLZUITI9WHnW0M94Tk1C4DFS21AM6hmQGitZ/
Cc1Gry7bw9gM5kmOC0/lU5ozvD/srSUmT41dGnk48VXzKLHNa2h3VMSrR3ldOSUKX0TKGyeOA3zd
wLeAGL379tNxTQu1JwA6eWEz3875XFPaM7K+d4ozLehGn5eUF3v2LA/8pxSJlflETnciXVghervh
B4Fhoecwiy8f6BMT8A4p34NBo5wVUkqWcxUmAUf6+j+3DDuPkw4rbXFZT9zYtCae9uiNOQ8NAAQ7
dFn4X1mI8v3k/DulJXkA4TH3uGXVYVxfKhdiiUsEmoMnUK7TvrbCRz4abywvnPo5ovmxZs1sJToN
3K0NGRCh7uicMwm1aYcoSUGvuXeyCzUvNJ52vJbVa1Ck9Q+mTlvvxPKWGPgEVtcmlTCesKID8h3M
UTFp3hRqGx/gELFwt0SVe+5F1vxC1af/WW4NgNrcdnjDqf1UVrDbcNGfuzewucFG8cpVtI3Pn4sR
/EOy4sM66TWmbXIPtR77/3D7djf0DMxTuHKUGaS6JdgIW5W1fRzQgc9+F6eFAaPtQeJYSTUB9Khj
IE1Irz2MhHBeThTMywPPCpFJ0wU29hqG5ghv3JP6azQnVrap+QCT3FGPPXvJeMM6ginSe7txnNld
MT25rnsJwoRHEp8HrTRCdJSbjqVoHSdUGdXBlAA6TlvfB5hQzb3JdgU0HKJgC3FyrjRLbQhEebTQ
rYAUPmCt6MOeuHn1+q4y0WXAbrtCuFkporAVuDDVzUPnKOci/9D4Tl1jApJap09Csdm6aovprP5K
wDEREbWhCUCzfpYZ2sIJHib3dELc60Ds5F7uLvmUY8JgGx8lzohO2587kRAr5Zc9vNI5iSwHQu8D
ZO65XjrN1bvpUITMyd/whHkPeb4FyB9zHZj/qbqT3eHTaRjiSI3i5wwcqjoIN1UIFo2qP98OrjGy
m5aqA/5TwFvg2mANHrPFFstHMXpDnRGF9aWlfLpNr0LB+ew3H9dzeSb/BiMsDuhYsKopdUKmgDiE
VL5tOai//+k3jKxOMnbev76SbkFEq3AkmvQDWdamj5jR3IerXEU/0iwfv5k9AJSEsuIIEABXlrNy
I2BAbU4btU0mskyY5t0f11b7JrHriaPTmV5HzZz3e9vNLJuGHFdBdYzeTcdEWIumKHwTrSuJjTxl
Ns8z/+L+LfhCVa6pEj31bRA4UnVUqiYecWzIHlZICJcHlqP2tyy2Z0aAbFJ1GW+9nbWFDIqugOLv
A4xoN+DvnbTk0j4LBmrrvLT1Y0asAp6s8ULFL9K8Xegrxy5gy9Iqkw8NItONgngrP4N0dY5XUEMc
0st3MFXXVoRbRPGBPKSWcVxTAAprIQUFF6QOwbvHZrLqyoqUgPnOHsqjcBfx2arF9fzHmkMEC5Oe
OyMrowllqtdoNxyKWi/FNrb9YngXZ42H9iKShp6YT5l5W3fpcJf5OcUXGIRvVuM9ynnNeQxLjF9s
+QqsLmFNZi+Q1OsQ2lXB5Y55jI6RKSolVG/iuRYZOTKmTEypdo+HLXBoSSgSuePgEpD3L6rUv6Lu
+/aQ/OjxQexWJeoCo696OEiWOuGi7zEq8V7c7pZ2QT5R8R+fkO6eWdUCQe5IpZiPe38ktmCj208R
FbtIYMU2DFedtbxRLJWzOAxcRAaD90dXTlTdPOxRB8OUUeiKjDXSklMcVJMRbHfzYXOjX0Wir4+P
aUlozrACS0VQqHtsYHKZQhW1RPqgITW9FBG5rIw7UUc/et14DpfJ/ZR4QAWxzjT8QXThgcUUxA+9
9iyndp7z41LJCe5zl6VrO5FiP31/N03LnD0VJsmyfu4k6iqfXxn4nRoVEQojwxDQ6dCgbmpiBYuS
5NPA+5mCD/3W4Yv1Jd+iAAUU5VjeGwhHEheXW8daEkt+KWyDfE/8WWqJgtXtg5EnxfzOboU7Lq/Z
samrtUNjgsFpobrJbQ85AtoPOf6nPE2fs6uLSb/CdedHMN+muVsozIupQR4RFYvOfwHspUfd5wKX
NPUOM4EPyn51BJpmKEWnX16zi59G+hmA8HYJBhuTrQkfIwtyAOloyQSda8yZu8vnAB5V1pA0ernu
RyhzcWGCnnGV1bsVE40gUEHxP8BnXTPzvSD7jnL65s6hCTHnvwWeCR+hTsY2v1gR7Ydl3PGJcQ/3
bUSyjksT4bQ9JF4jThwR9/qTJxEVzFTF3Mw9DGgiQm0is4QRd46UVqSd/k0WfapIhKpwg7uhkhmz
Hsf+Oh4Cv7ZebDxv4CKaDTCExCK1axCkldFHu1FxkGoqAa6EQNbU5gArcb22el9O/H5kq9ZtgMw6
FcDT26Qnx9MPJTf0WCSzSiyOEoJQtk6bFh/xHH4LOKKfOEAguLtZm8C5f2P1B+PLytnljTX3R05f
1WnidQALRinpGvJd6VOQMvlmKb7LGisg76q1bmpHtXWLd9a9an1mIStmGYtMpRxv1R+iYg0Qm80F
m7ckgpzlXBxlS2RmZygAt7qtqCC9b34nIF0r0Upv4cUrAS/s2RsCyGmFTATE8ekHAD3KarQChgkG
4A7lW9iStCzk7E38cZWTEzEX0/lkOxoWT+wAb05rE6vwvrT5jq4yWoOniuuGwgkoh+FgltI9hXhI
U3sONc0bltB5xn0I1ZIvLsmfIdkTYeueZMmBkSIeZkhMlzWtVjuRU2zaiqndR95rMl3clNcilCOt
DwZmXnD8gwwRdWl+xGPDDFlzUDBf+qcF0yaOu2mZRFek+nC0dy3HDvI5AIWNNGy5eh8g/biMq3S1
U+bXDa1EQL4VUKaSWyJi6gJ271sQ8IhMtcSrU9uMM47JWmHARboQt8SuQvxZ4lNJhs4JY36c449g
Sr0zIgWjPxsiTBLcbD184xWtBwZ6FuDFFJgC7R/5suIQqdAo98KPaVNUqfQwuPMU6btSQ0d0dVPM
p89Ggiqx4luUguwmGMyRK89iAkrGOuP/da1xx2Hq5vDCq51hs8G6CNkpFUEb43xrPVkrksiGbB3Q
78AqnAtMD7do6DEkynPRKKoRdFuOWJhjTGll41LrLurqP61ObU+lZ1r+are8d/mGpTdnVSQMwbLk
hBvEYUr1x2DfCAa5gOgvRxpw2rjoOlVFl3YZKT1/Q/L38rtSairVWUxwSzp1khrB22xWJLqAHukP
cPwFqJ/ufu8DFCAbqFChhApcNnMHhLJwXM8ZeoEKvsO7dX9jPgqEWcEKvnksgRKqfkEfpDeCoDIt
q4XXBm9Qf3KehgcFgy662i9UQ99iBfBbEC/hvBcaMtYqRJmwKaXwJZady9s59BjvD9VY7lpIA8AY
B2jMPlQ0vHrlaWC54jkCXJd7pBXkyLwLJYNTKYGKIuT8m33rd91XJbxlWvf6ceOYGqAQjEmexgps
mdOoAhUzhJnj4sgwSBwq4DKzJy4785Z2sdREUh3MuBJh/CoVwLPiuh1vkvO1szGT/pi5oQr/5bp5
YmLs+12gFa444/jdwA9GF1Jd4siWRbA2lKKB2WLliM+U+EfLu5moawTJvcsjoa0/e+8eCe5ZNZnT
wrVfLG0x3wQVdfog8iHiIk7CjUqgc/rotAAqFuS5e93x49WdFkSTNtFjbuWiqY+45mKsTFEXgR95
Y32t9vzKFvnPUvaRD4GYPYKwiaBjI1nups3NlKlHPxFTHKnZfdCh/wuqGu0qaGkLsmppzbnJh174
1dXve68fjTDgSzYgZjeg33DALfL0H4hxJmKEm4Fz1vS1nmpv9iVzod8R56QW4WT25YV4pLX/n5t/
0wvWEdj1frde8sS3fx12uuTevY536438vxzyqhAXezwSmKNkUNyb2OiE6Zl77+X4UbSsktz3ye6b
u5ASD/jzVLsUeMZL4O8u0kauDc5b8o2hzqziVYARTLO2wQwmHZazfo9DyFpveqLR7jNQuasl/Ijz
OraxOwNlkc8eymC3Gid05HkaRylqtVMXXl3IuwkC9FCLG+Zk1cKRzsZL8ArNdgIrDjUh2HrJdHxG
8Ige1xo7cTXMwZWXyWiHAoEuN4PEp0YB1RVJvYM9x3gIw6edpDwmgBy13CevZ4pO7uX0gewy11PJ
c4yzi8HsNg4gYO8H3Uwii2Yn4ATkjPaPs+CguDxVmL5BZPYcqRmWPa9RtpXa+BdtVpAp2djUqQmY
4WyQCUcE0YnD5/FlFBhDpbz4jjBw7FcTOJjpHStoAevNw6sJ/U26TSQahUq4bdJtFt6ve30vMyeN
Pl7P4f5qeqLVsaeBs6fDSjYUbG3TY5Vf49I7fQmEnvSqwb17VwW+STFeUB8PCcR4rN7GrAxNS/Ef
bFrrkR/HXcrn9REM3fS05wM0ngUU4VC0dgRliqtyt3135gXgioZEdD7xQ3IRpg82TQ1VxMK8EDHO
dG5DTvtKs1ZJt+x53vLSYYvsPmJZHWgCcZbOZrxBD6omFvid9H/B6pquZ2Sxot877UXqSclZzyEq
MDvTvEaZARGM5Fp/0V0nJ01JoCTbR1i4OAd8jsBOieufZNgovAulHrvqVfRBMLAoDO5Y6CIbbJBF
gSEclAtZFhe3o7JbsgHX3GeM0II1ciCKM9zwgnR8J8dex+5F46xJDY+Gj6a5Jwirc1Cv+IZqr5jq
V7Lb7cOVePr/EccZ+XPegM1GVVqjyYLbTsrOJccv4JfgjUj8oS4fjaB7LflIYLLtn3M5x7VRjewI
lWve+5ezDd/XKRIFFiPQkPOBFFfJJKPCqE+iHHJaoiWdJlFfzCcWXbUknLt785GUzlUUJujBDQjL
eW89s7AVQBXSIcALHn03ktafhOwrJMNh0qV3FE6SW1M5zWS8hyLz6eRAchLu9YFrmSk8i2y55yNy
LdfR//Ry7IiFf1nuT9/l/EkkK5tCAReF2gvQa+SL/t13vEY20T45fTiITN8MI/1a6gNiv6REsGKZ
rIM9mIaUQasLyKeQ045RE9Mx/SH30Tk8r5Cj4VwvS7+jt3o81X9YpATvHoclijzM9qkjFSbO6Eik
jIQdN9ra6z8rNS50kdYsO6vams9KpNYl23hOnxDOeKT68H79Nvr4gQm6Cwa/gNMWXfe6Zq0/Rga1
w/9v19pXzJP4W6b+Ex6VeIrA0gsnC2DQUDb/pVY2yJQgNFQLSlB3KfkiCqpg3rXlSKptQSeu20vl
vPXD73lL/EIryV7QlK+kvPCsFk/woqgJk8KXjNvVm9F5/Z0FuhS/6WIL7OARIbneYW12Vy2WJVZq
xnRjK3zQakX/xAYHBHKGdkjzm1YjLkP2XntViRVFw0Z8H8BaGCBtKr/cQya5UBKohoYKIjunZ0Oi
UQZQVPas+oEy6CWhSY02VT1/IBUjoZgaAAg0j4XZm+TUzq3B6E9EUucWYfYAQQ8C4FcGxMVph8dE
Rqbw2i/8DwYVXDRs/yxSjwhytXuLR6UExXulqkJpgH51AgSNHYxVih4TeVzCEVgt0qOAFwsjyJMk
pMkLQ7qs/fqu0dcf3j0ogfWFstFWaeQFvE2Za/3mzUgt+PbRBWEXg+TsYXg40k4ZRgnfNDFxKJid
9H1Daml1VGV7ARzlNkWLhRHCXSNNucGSNUxpP5rjArj/k14ttc9HI50GQXQHtm8lKY00ize6mKfi
3vm3VKMAwMHRdYrsZLOHn3BNja6u3lsdyUCiDJxsZZDOGN5G5x9HTksHpEn7ihpGJXVY+yGGZIJY
puI7/cdeuZpFNA7/8FVmx5oc3ZSF8+fVX4omLnigwme5+H+uKVGw+Vzdin+4aLPxlR43pjg41QUv
0s+HYFUpKTQL92K8n2b54Yk40IlbeTNoGkMyLb8h038hr9GXi48Hw5/d3c4YTvqUb/+zez4NfzZH
sKfVXtyiCQCslplhrb+BAB570uluLPFupmVEv4De4faVt8FA6Xb4Q/PP5L736xC1E52AUC/xW6GN
X9bzIiZwIdwW8sxRfhDoyzoVLBge8M3lS8aqBKUOjWqyUnRWb2QrEA8TxEQD5hc4i+V2MgSyCwLi
rCMHxgq2tVLGogwiIdWVrP+Ab0unijAD42mFKDixQi6fdAdarVpqcahBYQ0HhbTYVYq7X1T0HimN
yRrXN2cco9mb/P1tv8LKrvQJ94U0yn6a4VbJinnXKHrxW5CKzbvzsEWSBof7eRRTbf9xhA4DtBLM
Ysd5fCKk0cYh55NMHf/+WNgq/tkk3Wlo/avMR3qGn92YqBJPg1FkOIdpm6kR6Lfw2OLyNzCO38gr
LNGMl5POY/sAh1qrtatRu63WBX+IbGm6c12/9oOhndY0WFnNSxcos3KlJNfIAzGVOf/kOrF5NNeo
RLFgbBYrJ3Yknjv3Ve3wq179HPVptymHktcVg+m5ozZENJctlMx8IBRrhR1BK75tFhJXrGfCIeL/
22xcNKr9bHNVbWWbMmiwOio8FtItmz5vk5ZvsqR/O7PmyRa8cg06cdcbDJqp49NZSoaELKWbMCVd
AsVUEskTiDY1/7ReRFsx9L4VAZ3Ycey6qDBwNpr8fGHTd6LfZTczbzawn/3rk7CaA6nk/tyMAeI2
xjwZPd/VNEqH4hVCgz2rRF6jFUBOCIUESGngxjuBYzezX4VUXg2OOnB7DiRopv+5FMdHxiL6JJTM
U1A2JsiZjgBcnJpWGNrmc5dIufYJKPzfd9ac8RMwJvxqwxGwRh2I4DlV9HM9FO39/0fzW/HG4T5s
1niDBIVax6Wk1D5K4aUqz1x8zLtYcAecUCQ1ZiO0bwCKhEGb3MayMUMrpHb/jl83XGdRma2LEiMk
8VFtwkyB62gSrHCCEY/1wrtBoE13/kgN0HLOvC6Spmhn4GVSQy+NYPGCbom4lFv3SwsQx4McrJY3
JNBXoTq/2iLNUzhdn7ff2NK/gQJKIDquH67ArKOA40Syw8fL6fwFri8LuzL8ePBg18KHuLNk73xD
mcp5zI48U2TYvB9ZHEDz5OrRUyrtusEuQ47SZvTPl5kyl2bn4nB4wvC5PdHEnnrhAUhrUWpwXcnp
0JpE91GSDR5fYp7WVgSJhNu0fAcKjM4H3G0G9WLuFkUeVWcXL57ZqIgAe3FbtTm0E68i/+UYnwXt
pCnqukTRc8xejGLYXTpDGjQR8AiTFh4UyOzt0i73ObpVNJvSvHvx1Ytq1hWASpFL46IE9YTiCjxJ
xO8NoNBQTvg8Ngd/rzlPHccDDrL+hDKXbY7yJlwVe525X02qAN4biP2P8Ng22KReKd15qCvljUqc
juwqISf7uaY/xB4p3qH1dcWpLoxKfkY4MoRqw5DDrJlxPoALnc122pGDjjN4IVlAjWd0myiygCFp
D1kS1GoWJ1S2Y2XwjVeRsRK5eJJktVY1Jx6wP/FqvCikp8aCJmDzmf1qyxNmy7Xc3ZRf5Fe0i3p+
5KuocYkhnSak8toF61FtXJAC2ocAh5T/7omRc9nX0ZRlz1MQSt7bOFOu8Xk+kOCyxkaf+Nqbq/px
6N7tQZuJKXx0D16QYHEZNhEojJBcgQgvTHEQmqhcbPfktEnwi1vJ9uljSijeGhOXx0v6E73wA+Cz
Addn9TSQdfHB2GfJkokODRzJQl6Vhb+r278rEtrphcoFg4zOYzdE8W4wYF2Kive56wPOGVriw++v
KzmhT9MHCH15TX9jzCztbVXaQA+x7zaHeVOFHVUcs34Qdf1CPc76/Oyngvu7UddcQo2CCkEz893/
vCPaC0N6/O6hGeSLkRN0HWffUV68Vi3sRz9xxsHmk81ouT5BUkuQgT3XXOp4eIuHpw3NZnoEXy4e
PoaXmcZvakaGsnhk4Z3JOBt9SG7qhpdaP6+idvIxtuxCnzRfdNpwEcICjSvBD7VX4yHxgZUCkUAg
eHeLV7FR8q8TWOkJ+Hxm/sYAbmlsQNVtlfKGOYVpqJ4zWcEr8ySlg8fpLjTrK8zSiiMektYQotvj
5iJTwLxtM9LanHc553w9lrpxjbd8DtjJ9MIOLh0BrTU86pF7YkBhQYUluWSU+QR9pXQVregkrVsw
x+gllJ1Bj3e9mHA7O8HSNd6bD4O13GhyxQgIH1CfvjboreqlwddNSS8HhdYg9MV+Fgen2KXRxiCj
IhwhrFgXdkqJ4OgKdYHoX20aerbDqXsgjeCDi6ZJJKVMo7VEKiKFjQX/0N6Y9ieSstrYbcHoQ2No
DPiuiik6HCzdeoUUyd4NYQ50tMvh+x6pfI+AnczS6HL9brIw4r0x8VIccvN/506yjERAIXad26Nc
5WXfh/YqvbULp1MK4IrsdJIsHeVEAvXqzSpsIrmV1nsokzE+dWMR3fuL0Y1DBpkQD/9emKUsUWLd
2YCvkT3Ok2s7buGICBb7dJzUF7Gm+X8XMpN+XGmVImo2JfWHBlMbTLBw+sGWIR24phBGwlgiYEWV
Sv/bqUSSsvovq/PIgYjdXBDoToRlRbguZlcg53NmGL+LRo1Od4T1TrGNXQl5NsSiXjQdQlv+SbDx
hV9taaOm8eq5UucBlO+R/3Gvm7g0MqNo3GUFlaqlioQHMmfxgLncEPH/QyyMEhZMDHlBqEIBDPnb
5h7Pz4v9liefKReSbKbcFB55tZta9Q3kgOlK20FRPsPXQqzS5ZAA4d5iewldnH2qhqAS9nYbzYqo
hUYGKrWxWYxhSb2FTC41uzqOPuj1J3e/c/zd5eDUpkJnxUCurMk2/JhjJWaL2Y5lPqzPl+ktRszl
+xviCf0JKwNUWvYGA3d7R43Chyswt/bsZ2Og9KWYk+QDcpgPWtwnTrq+WtYdAaA8ykAT1hBnVuHU
C/BPthmhvHDM69IVyhmR6+csEew2OSIVTxajjbis/5V36ngJKSQajbkze+UhTllNzFCIhS+dd4Kz
gWnjBPg670HFh9oQPcL5MUqDvq4Rgo/fxYkxy3EyeHLP2Gl0kc8YQoXvzq69oWR+afhh7JhOKhXd
j5jj1/V43UBuJV1MuFuFupdD3yHWCy3svLXbB/L245hihIzy0N1wkHdoVT3YaowaIHScESAsbNP4
B81ZOKzPqfVdbrd3X5439Hq7flnIhJgBXA/YDyGP0M8mSrmZAEhoB8EHMtKBFqf64mCpzLA43DGe
sm1nXxfP6A7XvFApsldW7jw4oA/u+U7F0gXCDax3wOZBYOefC8R36Enm+EzPuitaTaWC/is8iYEf
t5SCOWuHB/JTLL9fMFXLWwziV1ZMXPshTPBZ8MsJsmBqYuYMkpU1hFzT/jTv0UiS0nQFTHdxuS26
VzxcEPS9Tbb6EEiQYFYcJoBKoWBRCRvRmlxxb04z77H1vgPQ1fNLDIagw7RBprI/rXZJKyB8egJI
3vQi8H1CL1nSzBgMwVbgvVJimV9Yf8KZLXlZbYJMOpvTXzNoYpPmjzKorl3vOHtwr7IBevinOyOs
Ph7voQiMBZNxYyMRyv7LLJK2ypPEFiXln5HL/+uf1t5sZlVPmaVW9Yd1FR12WMhAgZ7JG9+MiX+O
8W+6eNjPVcvZwXQX3oynR9lMAgZwXAuc0xVLP2fjif/narIMO6WYupmtzsKB2BQ3v5pTYWXELc4u
jcB7Hy9YMuVeA8T1JNC1B8PsPboXUxeBy8zrbEjfAkbnxztnn+GYhEbpr9hrdYAsxXfcOnUzFF9g
ZNMdG06c6qPANzbbhhK47YhZLBiMysWlOPU5T1CLMGfhADtZfiFqbjmhkF1Zc6Jd6XkEeTFoZl14
ZMRqSdAcudW521RRsy4JHebOqHoaiAHJxEIJrS6oRQtXL3sL+6PjhsxCHMO4vXWjuA3VZfZkmgkA
HlYPybER+rbt4rnXdWyMpAmC8VBdXgCaZQ43Xx6m5Xy8Z8Wwo8Wd6/sGqUlYP4CE8LBQs0nhs27Y
HgSePM+HtX5BkmkDkh1NwXdMSuEfgd2Nyj+rARx3AxwwuIrHDnPgmPIkz3aTLcUDvJAJZRoN5EV7
EU9mRd2Zp6h6i2vfYRzLS6M94Tas68XDybcoh7n47wI0O++8SXL9r66c+iD1F1H56QUhuI3Yglcw
QOIProNj7VDX0fb3vRueIQ4aIARZE1vZ+E0K9g9Mm9KUwqgj5IWSXXtPKtxNXmCUq1G9PimStZsz
rvYr2T9YIpWwIhD5PLl+EHEdDD6RU5rbQ4Cw5DrtbpcA+ubRkySotMTr1zfFiToVXc4cd27P633j
G6/MhnMzmFaCyucLIgqSWjdELj/5eyvMuwDXf90n2GVlhQn1iGsoSgJB+wadcQLZrGiNdAtj6Zk7
O6ZARpwtndchQed4V/2ZLVsfcLHyN+qMlAPurzKE2Cpp39HfwIIAziNNgTWkD1ps6oaSo3kHbXgd
0eJyX1Aep/yEJomUtGRE5L2p6foHUcC1sJ0iCV8e5Y3YD2Io7+LxnCMHLxPqVoED2A5D/2MWVi2S
AUYNxeDpCmsrLb0YYjrbcAUVAwinAzlQInyNpzSwmYei8fS2qRYDtmEq9oKsRE0DaChz5RIOTKl2
KY/ppCIAf5IrnhytjXbE46Sm6uiZUyqWhg/GBL+Nor6JwLnCpvZUZQfaSlYjppuSoQFqey2tNlU0
9tzPvJzfU1U+MTza3PpHajUDbDoLFJPbv0vIvpqidOdQqTFbkudLCE3lrZBmuYeLPBIRml1znQNA
h/SdXssOApV664ywM6VrNSYKjHFqvNgr+twuQZotNjUxuG+HUJbEl6KU69DEbXBkvE51WaIjXjlE
Gv+BXY/PFejTJJcHxJx9Tkf8zinMPE29EjX71/uXluRLCK4MwPRNjsCgHzyiGcDQ/xnkIOl6JUrT
eI0Miu3zfuxzI8YYR3HXfq1DXMvb2enlKqUXmw4sXR9m2RR3CVRDbfwOIUg9lVClD4oWCpt99k+I
71Oii+pBqYTrooDiUajFiaLR5jBG8BNpc02xO9CMnR4zc2MkyeegsSfrMbRNgx8rOGLsKr6Vhem9
Vdjy8QaUMTVT3BSs7ROXTGSu08oMk60zx7L69ZC7OVPbcKLFuROud9iTJv0SnD+EEtOtAhj1E5M0
oUXYu5QpgGI2tFjllUmas66C7/RjD+suRllw06TR9Ha0VdyGpwiHddCGp2K90463FpmhQgQ3H5nI
T5rwFO+UH104VX/jUcnNih6P4iyVDcqSjUtoT1CD1PXVb3pD3047c9bjQBRWbsTWV1WaGivtLLnH
hDjhGzySf+8lk4dR6/chDOwsS0Ig8l99KjdgF62huSv7Rqequh/q4FuhdrEqinGQVDvsC8vcGEBm
zTIfeyWoC+WaYkltfFlP9NJVW4gTsPwPD/LRud6Ws1b/FKHbRHFsZyGO0+8KvtAHrGY1C9+p9Q8y
tlNa5jtEhNSViyDm1g4UNTMRzDdwDppTY7ghJUk27+bqzUeWgmyY5Q5J7c5n+EE6KDUqWnYVI2My
NeyP6EvfeFIw3Xi4OLygUPO/NrmqKJCNaCWf5tpC0kFq2Hte0YogY22I1EJ2LUXxkJNllGpsUueu
dM2NIgUPYH3PB4vhyck9dszmpHdKhoeeVJotBOIuJlz6Qd1t5I++lD8Cbl/RNKxShxN7JM3wTxA1
7jX026rnLk8duLaH/wjmB4Jg6MXWk9A7dmQvXneKfMtVKLu8E2+wvXJNNZza2f9QgM7h2MP6Dkue
U82psKt8FCPX6n/wk+arnpLRNfs9Zf2gehckS3IQyZ3ETnb/0V5OriJHq8mjQm7H2AVPEUXgLS5I
LNFDVcAj3JOpsdUkFLPiv9n1OlWHhu01R4Us5R9bD5dGTGuQMr1wqFtu4f+KCqPPaxODFZuHJB1I
FsJtb1AvqJ+oPQJOE6i/IK9/GzLmNMKnwEMYD5ddfcuYckEoPI8lDGJU4zpGq026hQogPA0oXJ4a
GSMeZ4zXLhk2fpyJjKv9LZyEBXUd6PptA/kpik/rZ+6UBAavmLObpUxQJqVkx6VGgtg95KqulJ5j
EfU0vfaXVPow5k5yifD/OR9x+gLueo3yr4YGueuIvrWV/KqUPB9dkBWlOjdSHktayZFkSjFFR8vD
XaLqZQ9uT6RFGdYqOZjb5mZJHH5mueR+9IbNcXp2MVkL62SAftZTEbf326PjlqcNfGuC6hSl71ll
vp/dg8CW+BBl8jHXxFfvb3sDLxV+u7NW2GnKqAY/rNYInTD5+5xtGvFlANZRooDH8+xSIiTO2v3z
cJzgVV/3NQxPvoaik0OplqEp9pLhHIH23zkXwoRKG822DcTk+TC6oSj51+PpSylXmMC7XiMg9B+v
BkHM1JYCe7zune2jFBIL4G40UqWQ7mpc5PRnjOyas9zIxvSgNu7KPkY0ezcGN7+KhADwc5KQljDK
LVvJprKqCDnuU8MLaDmtTB5QAJf4TuckgMh660jRbAlVkuCjb7BD2v5l0wVjXRGGrrsBwBYGWc2o
Sk+SBW87gJDYnaThjnl6ualQnKKKo+5q7GDb10Gj5Q646RVNj6BNjUJiLTYlZY6GVcOxJeXJ5NGT
7CiX5g4pUHd2bLCTm/AQLPGjepfVuNdpU5vl5RcxyrMZWR6qRfuU70kQ0DDfQ2GKVAbtmvnmgZDy
gQm/pUti3hvWybTXc+/PJegspecECE7+eqk0XR/rRieZhtWrvfWi7dVMDL/GyHqTTRTGpGuwtecN
agc3AC92SC01sABOHSSyYylga8LuchiU1PSJTFcJgakrp4O8exbk0i8k+DD/dK9lBZGeVj0aZGdM
qhSruDwo6eYRpQxRkFZ9No1gQQ5p89LH5Xo/NZJWZSHnYqWMT3ABXrk8qUMMH1yFQG8+slObEBig
waaaWGB8uO9s3Ky9MM9ihdT76W761Hqkl3X3CtIzaymkGjkYC4ILJaOsLwnvCQmeDAbGhxXRfaYJ
x+dtqhOBma0g2vya/CdinR8uA5WUhxaIazrGCD0p1Bbu3r2TGxzV/j9pgWc/q5zOqeKNgZxo5d4s
00hgeNLK2Tpnc3bxb0maOGVkZainkFdWFuZHJmQ56Jyyqh+PwyhoE6FOX7qg1z7Y3W2FKXGuLmdL
pXfWAAdsXMH1LGxXhBP9fq6m18TjAJB2KR0w+YZV6Gztax/zmv257Xi88fGCCGARmlcPdIoqSSHI
aCV0WV0xtsDya7+bA8dsMaQj0WiEzUYTfpF8IgpE77NFQxHbyss5fNhdIvaIAIkSVk4zsCwqJmuK
WjVJsvwl1hM1oAUK3oRXK9D+/hMbg+ELY7F3MvvYW4/nUSyzCd9i5zWjJ1bfMEVWIQDwqUKPNF2F
BQwv0V+fxAdB31Hvis8LVtdMwEPVn0crsuritVu9LzoERRiO6JJIdXOVul0pPBen/MbMcdK/Gr5A
UrupezVTRANV7J5mlPMYkJEAiA3uQVSy2tgL2QD1aopI1im+uYi+KA/gPE0SccFGJfF6yBd1vtNN
ejhr9aOvycH87IWhi+hpqUerDn/4vDNBNkSORXYJ+qgJhJvEBtmLsyaGuEzEN7qYOX/+/wDcuyQe
RtVMkp/bWt4h9ArZ03v2yQdQdQ3BohAAroEz3bIAYR+k9Th1nj/huI4UC67i2ldVWLqp6x6BaXwy
qaoO2rh+JTTxYwJu7/UuQYNKrbRz40dj+4MKWEFYP4lR8gYB7PhqOxymQOulrU52A/TL+VIrWFwX
MUeRUGHGfj1lYpBW0iojv8FiEzljB28cZEYHlJ9F0ENffwAAAVNBmiRsTf+nGS8Pk78jcy0x7xzI
xqYx4+//K4rnkow8leww3GwifsSwM2cbm0viY+Td0tq++rQVylapYll0XKWvicPXXJSQ+A5u8qJ0
11oN5xqiuNXjhAHlkdSExPDmjW682OdQxl0YKy/u8vPbCu1I/xcCIiwR3446PWWsKn86p/2i+g12
DxF/5eti2/BialeOwmFGuhsFZ+8qUBRyw2Db7viRiU2bS2uzqqTKsLRx5PRWxMJf+A8PqLR4qRXY
+jCAJGvdYJacqQkD6jI/nnsPbIANhd8+1G6VjgpLc1D3YGo91A9yKlJUd3F8SDSTc+wNkNYbbE4V
ti7ThTyHntDWW8VVjw2rCG01uU0Nr2/EPKpWqavWGy+//QEpkjJRohYaLjg0P3nUjfsxIwL5JHb9
jGtMpoNKKnKXgfiCfaIPCzjfPB32/ZXuu9lG/Xc0JFqixGAAAABcQZ5COIj/2fSGe8lIojozRABi
fxDu1IyMNXdhb9U7jE7mXkuUwCu6WWhntRnO02fL0heipr0ehFidQiWKufkLBsnAgP4HYwxDW5wG
N0n8/R9GZVeO15ygh+Cn4p0AAABUAZ5hNEZ/RV8X+M8eis3SAz9xeoHFRtVkxClfjiC9D17qVBMJ
7hwrDj/jj8BCmetQaufzStnm/40uAy1NJj+TiU8ITDsE7HG+D84v1twL/Pk0XXVdAAAAHwGeY2pG
f95Du3q+qmR3UADxk/hqA2ZSWyJkB4jbYZsAABQ5QZpmSahBaJlMCK/IXEDTLK3Jv/zlDKA3DdlP
grjEABMbAI/417foGEM/JRji5FX2KhSeun3wtA8miGX0zLVCVBBp69wn8vmWBUX98JY7BpP0dgeM
RZXKL2DODSb76TK5ZPOGZ9bcx5mKs1cI+xaI1cevMKlNldgPOl9t8duMYX0XHQFLucG+fnhAfw+o
wganc+3SAXrGkAcJsm3RMwtLR/1n5t1BdgMiYYwvlIvmC/hNo81GSxVRMx3GVlvdEYsi1FEzkgsd
blqo9e9QdKss6FfY9qrePk99OCJGvDRUkzpdAJxU3CKOrc5v74Ur5jQnhPUiYD9Jnr6TgVOT+sOl
TJz/tkHIdlswH+ZfR+4yFlO7HVu6GnhRD963gPI8Tat5jJ6Hgnho8wM0Y0C4G+TWjZfwL5JQXEOT
51fteU6Nj45ZSsWvKjt2LUHkzx5ZlsDG8qceM76/y04bGV1HZCPgneucipOgay+5RUcQcGfEUH+A
aFfU1FzdlIgDEb/3ZKVcrsgW4BPnmJBPi9mz4Mp2PEVKYCS0X6dRenW8Z8rEyzolCcEJa01AAtk5
z9rFXafHimtdMkqMRBtZIngS4+JlyOhtDm/yKe/9mAfzIAvGAJndwiUU5/im8uwIrhs5++rDnbBR
cF7HHM2yMIrIj1gwnw+9zYlPSLIv+azF/KshSLmGYpW5nFZPyPIOmm8EwJvEVaAFx1tsdYSXUkg3
nA9dQVmJoNUqFFRd7+NeHwF43ymul6Gu7pm7/E74c/5xa23DIKt9oqfq2FyOFaMpTu+olCaMuGzk
w92uEmfH3f8h1z5W6BoGbnPxbRE1t9E2Kj/z9jD5hQKX0yGuG68BIKICG8ksyGKVQ8AEw3RUbodV
gGgFMJk3bXem0pPpnetYVRxQ4poEeVC/SSENaAybVdRzV6gZt/yN9mvUK30jV9pPMC8aLHzM7OyF
iRE6FZtB6jzhnQYp4GvaqLrbJMHjNFiw75JZlFajvqCDI8773tV8zMFOf85FDUdf9WFMWqk9BBLk
lF4m/ObqCk34tpuUHmJeeSYl3gRiRVjJEb/3w5qEdxR3ndDA9RQMeqi7E8m/2t7R+VA9o9MhNuOg
76od0gJynLsaza9/pVuAJn3KXZ77I7PvDMT7bjwrieDAMxDcIx+ymPHNDj3H77tzsFILIdQ3XyBp
Yf5VujbJNF591ruCdjcRsVULwcGvYqcLjK3mPmzWTgpzsjsGUcA9Hfx0IQPYqFCgzHxCMjWrSwWB
wP5cujAPu4p9klDrUHqpkH982EyViLmucw+ghCgzVkD7nTID1UNBUwNtIzp/7k2nCVzxdtDEDLVH
4S7Tx0vfLb61v7REM0ZSBnfp9ICbKEfkkwZbiIy4BACGjoQHo1PJ0PLACvw4Sjv68Sl1TmOHyrvq
P9FaWRBWfpOo8G8oiYoZ5KzexCu8V6J1EL8Kh7/8lsJ2QDNOPD1bsdaNOyMc4/+N0Bc4/RlTbcPJ
HtLVOoyHuC8tzEDLEM4bU/phWhMRjLdFMQ5fydYvW35QGOElAT1OXv34iuN7+cYBdG2JHdzPRn8i
ET4vMLC2cdGEVnP8iHy3OIla+fD5q13mRKW+ieM7PLnpwc+2lkAWlDej2vsJKr9eyAiE1SGWjU28
ye523uVAPQrcaz+SgdKEKTPMe07wb7dYWtqcNDJqqKig2dfIqTK3d2AtH55rq6kn8PGFXNv1Prqu
d/wagZVrLum4bZDgc3cX/AP5m4NaHGVUNLIatHpB++VJ3GrnTPo7RhGTd7MeWUNf2QtXblC/89lR
EGIpeqBr9NSM7IQJtD39fkRLF00qlDShqOmBz8TpkJo5WeMuzRVOOC3nVNrPpePLLfqzeGaYI7bH
fB95CZJawtrXL6Q2EXJL0FpRPuV/6JP2HZK7KyyhOIPPK/amzJ1+ilISS48JTyqGU47U/7oyN27O
YNuLrs6J0gvwMYEw3WvojEAF54D66+HIc1JvDdbKT61IBOPmGJK7feZb3LCmltk/ZJMA/pwuGlqS
yCBTwKdwLE8AMDK7cFQ9wpBm2r/HcUjFoeDQn3OmBFrKNx+pkaTJS6eDQ0rJFVpTQXJfiQZCKoms
vW/bxZ59NulrnB+MyEviVSKXArhQGP+EZFij/VnwBz7d6I9uUDrLcqB7PacinPeYkgwKoswDbTmL
pU3qlQbmQ4Xah9oW0ypqpcXFBA8yBvvYb/d8S2RzQlv/O0uSp+itdduGyJb/u6vQTWGlXF8fESEr
6b/m67Wo6rKGratx8zKraGm6iCLyZmUxlBF15aPQbSOL/7VtGbqz1YYF7ussQt96T1eIQS4gb3zG
FBsxSVHfEQWyI02rQSQpW6oa/j9WLnlvXMcGvfgr9/JsSyHQCGp2hi5pXjtxRkYAGhgFjhWWVu20
RL9+wJ0qpUVDCy/nK9r2/lDfR/nZaLLV/ZIa0Nk5dlYlrJhdyJCvxISbSCZBnOuNwH+ch8j3DwGK
ORSLW4QPqjGJyA/IF7XzqjCabdwRofd2RJve0vdyKdyB8fo6iPzp56l5NBmurhoUFsG3mfc8L325
OXsi8eBS8jslgC/1R2HZeED3OGnw1rBsHwrQth+snUb9AkesccartSFETJoZWfkmL+bYm10nhE/X
71K3eu9yW/P99EPK2UBbprXLe5/dXJmYzDmEfTIJXiFcFhVOo0slIz8SeGo6jPWPGFTZLRM/SrRL
nshYi5nQhfCEkMT44yFEsOYYj3LpulnqOxUnKiiCeYZE+8EbaMrGLv30g2kwzUve2S9mvgSjgg5q
i5QvPjSncLYS7zfeZEvznW1r3GQNLqKzN+E+reOorXQtED++rn8lTkfDfCB03eqzpSwbOAzT/AD6
CKuVbL59cMsktwTjTx3jSrlvpi/H6BSCzFdIcu3m6spNIOwDhe1SfxZukvsIS73FOl9HPp9k3XCF
1YXzM2DSaoyLOmUEdt/FnD+GgiiU7RKdYyj2svLvpKAShxWJqle3/AekD1eynRD72P+upX+t9UdH
0LZkc0doqvdHdgikZPW7hPQqHxNJKUqPFHjxwVus2hPWma92Tpwz2B3Ed8GwnqygVv6KEaX00Qqv
HBW89hDjo/phS2wozJpFdIEN7izkjDTY49x8hkNx+WTcuPY/irZ6nKzQrpJYN5ruiT3TfF9EZEwg
e46br8dGgF7MQuBlqYwtjiCa0/AwUWari47YXVI+8Nbal0UcPcBsTo2encfKN0lcuxRRB61NQUzw
wWkK1CrF1GNF5YUzcuWWdIGrMT6Z8tZH5tUKHHt59ZS0V+HYMOesOT5/BjcJDNElGSMXAEoloE1N
p0Nc8SJ/8WYPF5KXQ5iQuzTJvOhA9JxbS/59rwd5bbL0ruxs2prKBGeS4phfxOsVhBcX4crY3HfB
Lzv9jvWzTiNlCISizDn0ew7ClGuLaq3rvm3EX8zsWuJsIj0zaIxplQyDLkzFY6ZZaHmakjNKhXXH
n0s5TiZcsI3moQPnFDAVksCyDGcDXDHNg9ldtTZSLQwE/YHMIx2jXHyLbz8Jzl2DV4n+dAqxyLo9
RIodslPbggjR37AJNpnaB5glbcYxx0xh5a4fF4EbZeBO7DZHqUYayzqfBwE0c/rKYzhsecMh78Nj
wtDbS1v0ywhkxpFpLZM9flDCB/6fwcSDzM9UCbY6O2i2KUVXCH+BVgyp8F6X3LY8wQHqdlV/aEnY
24/PisJd1fCxLojj9zpWKO/PgnOxr5MR8idpOA04tqiOlBorRyajeKLBkFLzqANUISK0fpobdFqx
rHQHsf+C5IiOXlhodkvBph98Q8jmi4LeN0volsdluVEAc3ElUeyhFIgCHG+5Cowkt2Sd6/0jcmH5
wlQZfo78AHmd9GM5j7qNASY+0/Y6hYqley2V+rinU0j8zrOL+gEKI5egnCVlwyfy1x1u1zgB26RE
52G+I2hewoJHsdXZaHkQxFqblHgyPNRFu0mwPf3ymPV8dsOKYl9G4vxlxv3D1JeDM21ZPW9ssgkB
a+geryJeIBNAozUChRki4xqAvCmiRAfkS3WKFzZWjEhLhvKYHigSXReIZUfd//MjV5PNz0MnbcqU
nVBDqcXoep5e2ahsIYwOj5oMGeQhzW/29XQkBBj6eT3WWvOnnQV6tSBvm6pABj6sGCh2KU/y2WYM
dHEWyWs7mic0H5RM5rwwt40M9hzx7o7mY/9gbqLpi+XOb5dlzzz90X+MWNbcP/z2N30o/8bC4k2o
hYsYkYKSN2JQBDeh7qWqiwn/q1DW4IPsSP1o6H2Oilt6yy8k1kqKo1rQhW+oSa1m7ZzZBTD+RRwM
KJqaSJPdWS6kUr190sPCNZp08RSukF8kBdpYWrxQQtDRjyh4wTubtqDuXqw9wBa39GKMYu1cICsC
XthxVME7q0BSMdnAoaXTTl/EhwDNdiryl0lwn2BWOWHZ2+jNVpKqzyM3vzNthOrrIAFi6N3hEQuF
FDi4b7VgTt0W60zJj9vtLvcshmbK2MT3K2vMpfSzjTsa2N4khNQ6voIdzouCEr5Kb1L1FmdM1K16
yWgcVFcp/cJsA5ZWa6lIncEtSuVKRRq3Y8cogBRoBNepbGpE9FJHE4TVeK8L3MwkLJSl1P4BUDd+
pGS6FEJOvwSvfheeunb8j4EUbO8QASfuA4IkeEQnbk58AZH4LZR7j/mPUvTI9qFm/M6hzkUi9bqK
kGi2yH3awvpF8BDiHUzNdyFxvQ7d8gQxqJANigG4C8QbtoYrFHr59i5H+AJmtxwOTo5SKi675V0Q
3sEM8qpT9+fXvy65MpGY+DaVZ5O+dkutPh4zKJyD06b1mdh1Y8NFah1zz6B7HowwhpnqqGD+RDOW
BtPX1zX6eXRtrCael5PD6PktfM+whm2Hzlv+fjJPoHCR7jUp6JsWdjsU5TSdaw1Hgi+MM5qjUGbl
09HPVA2NK1rQveScaFTwfyiuE24rGElqR4NDwZx9vqX7pGJ/J0u+9Pb1bw+isXkKas0yFyCl5SY2
mVrqs6Pp3BdWTvdEqJTdndZ+RPUNB3DvllkEYgBRD1jtJwvsflyKkvqmjPfnvYHk3+/hglcqw1wR
G9ImmGlvQOdryczLtlt2qTXb0ATQ9nKIajs9AEgU/noxWi7sdAFGlsCcnxG13hbIC7jIHCFN/i5i
FP3vV+vd7Ybfy/qppNVCtYaou/tLDeqdcp4Su8yUQeupbzELfUNGvxCwjmV1U1t75lMkUK0qx43o
nbb/tSNpYXrioU1Ylha6HgWpx7pDeCIP5GqjWfifm+BRvYbFp0RC/Uk14+LaiafTGimvrlNmIh8I
iQBp9SKA1fAf8TX/AVNPFjA6L72Ue8P+HdNeV/54xyz9b0+q1pqvhGDgg+QdkafkUXfA7JggROZN
2IuqAJ/srBQSj4eQEQLLh6v3g6UPIX3RjGN0z3IJSWpYuA0E5eXNrnKgPM9fOLmhBel/EedTlf5u
wC5oLL1/4MNvwfYGBjJl82FvPzE4VzfG0tfh8PoVrtdJRhOnfEN8YHpCFlvXjGE9/+QWNSXAbTvr
RVyloIxS51bnJRaqta4iUqMu2STVukTBgkoYNaVbr9OTmoyDsKNFE8j78+a6SNFOV0vtPL8PPg8Z
s8AsWQSQQQbIyMuBTeQmlPVzkR/airmVaXbCXq+4jbruyH+dyI7tyCmR/MO4RwuqlFg2UFl8IEDj
t1419kqW1raboSzC2ymkGzN2QIR61sJ3JK9Li8jD5b3daRpzk/rP4SqjLpgIbm/cl7lG29+7sLjp
075q0qTZ3hRYEe4YjH5nCM7lv28GbvPcXLurJvnBSjIHnDalCXw8BoQW0wINx/C4sPJNq+5kt7Zr
n3he0FrQrj9Pdj/TmzcIejoH9OpgrII81xL8a3WIN3retyCyvsT2JeMZmBc3dtsjH1FQLYA01G+c
SY1kYFbJMw3yRiNxGLNWYHxiO/a2SBw7IZ3cpEDrYrLxRw6U1xvA6Wt6FN+oqzuJUwiKUADJ+oNq
y36H/6iw6ek22JeNoqN6tUJBNie67S6+ClapSdDseMzkhD8tLKzIKsXH3Is/AY4yERJuFEMMSv5R
a3Q68VyZq4PKuo+RwzTsAtxSSWcl57nitP7/gbAw4kWTXcxSNoAthpI4hKi+ycSI38sArTSyt+lZ
+GggRHoCQL4EgOAM8iMYTe9JbmKa3oNMlOFNoK8sf4+JuCS0QhGq1I5shCeFz2LlyY294x8Wdgyt
4WjF2zlYsqZXjjJWtUP6cjAp2OByUfJzElltTgEjZG4VaFyh7Dtml+JR34QuduSQ82KoRGLOS+lp
PQCcgsNvRTEo2eigp+1mFxBwUXiRip7S6zgkLUtzuZhqOwNYv1yfAyB265ImDvg5q6YDApkC35S4
sMVMn1mf5xh06T2TdUdHNBaKe+yHi+fOjw+HWb1BPOI06/8SQWh/zsY2zlup1ndNH5/4iyHwDf8/
aIPgSGDu2sRMAjT6/kcf0sIn3njPqvsWXTBHCZDx9dNZAJ9POk1EYaRGFEE4FuTQHVPH/pMdneY/
ZD9wTYw6vAYAVghDza4qv7QK29faf/b0cHJiyUZ+PfxfHIHGREji14yQoj/0RMAm21AhUcdcqmOA
0e2pYIlOOXBDSt9cAbENd69zSN6Hjq2arma4LaLMR4/Ltw/3AlVBN41tKYLTuozC/VW0xBHZzGfD
o8DIN/EEKWcvoN/Yk2f6xjDj6PPWu60VQg0xYAYiuBlhKOIakXfF/xZzaXfRsJtX1JU+HNAy4MvK
dfvaezQaMQimxgv1pcyQW7LLu+iDY35hlAlZL23uKZKISV8RYXHnRGVoWcEux9B4EspEOcC0UmOR
rzifIojkzwZfHm18yH1GmEIDUSRMyksOoWhTBlutbZNnW5ubTJffW/oM1pm0dJXoFqTKYQnj/if7
rN6D8UyNAVVQ60grpDF9LxJTHlkAAADlAZ6FLkZ/9MTQYSABajbXyyEroiANwQODHWWsrdY3M38v
af8nlRWIPwy2B1J+zTVSR2hZ6PZ/waygOuTg689ztFbx3LvxIiFEpA2abuFJRmXy5oewBt7mql0C
Jup7OkkrmyAAeSbQZwyCCxKwTUAtoZ8sUD/O9jIIAfgvfXRfTQOmE5hYWKOyO8RZB07q+WMdj4gL
evKq1TdcZVjKABCG210o1TFPKdZD1PoPPN4bSAMT6HnwCcpoLkgcJHLNfY9sXCH9csQBvU+x3Ea+
ub4gbjG6nJz8PSC4UBZ8n4gE3beMhq7MDQAAD05Bmoc8IUtEymARn9kk4z9ISiodTRnaMCTluuC7
JbTLgB5jUEBBMO+d+uiFfBbFNwHTkQwXpYP84A/PW02y37yEjOa1BkYJQyVH0wRqCsHas/qlv7LR
/rL3GXMeBOzpa6Q7AwkukKUaVnTOOb8ScHofyTNUGwLfvsHNkvEYbxzrIIhKRceQqslpTlaeB8k7
9GLUFEBb5t71z16FjMV9oOLpRG16nAU4Cupx+f/3V8SG4nTykN8pDwF2Q7QREY9SkxOv/IIEgCPs
JmYcoVtGBC04IEvvi9e7T9yJ6GGLpNXlIDUz+IrRYuSapkfJFuA1j+4tVdIFowO05sz+oiyDNPfw
whZ1V/aAAaMaas4IC0jUFllJZfGGwZ1jVyko9i3NK6OZ8eGGezX0NPmM6M4zVA+PsYcoIXASj9Xa
e3TnFck8ZPN08uDmS8g5hwXNNJSLUeRgJENoBKKms34rDFHQg1bMVb+y5YNtPxSpjeGl/4VZsULu
2vWk+AxO2VQLSXBW3BOmp0RFJ1r4P9IJFz700vDWRgIlpSJHvmL/roYI/iUhPxltrwa3bPdf8tIt
5AS3ER91YVk7jBKBMF2ax5/xS5as0iOjS+9+c/AXnOC5GZi0IuE9/irq7UvICjWdMa0NZVyUAmYl
AG6HTNgsx5h+uNapC2TsfkabUEtVEgU1mH09rdb7xsG7Ope6QRP4Q5u6Pz34gE0Lee0jNN93h5tW
y00+K3n/fe5Vs1rbPiCHSikj6+8QZE/gHcSh1BQWhXf6NwlR+Jdl8k0ynzOT/JVt7pg4EPx0p6ah
UJ+YLiiE/xkjp9xKkyosPluEVQanS5TzNjP+pweM4Witnh0+/FIET0MrIhTQVuMRublOTJSq0qGP
AekGuzfxBLXIDRxj82pPDXGV7R4B06c392f49YSvqgp7Tg6I5I1Sogh+r2PCtJNTxJD9SknUj1g7
u9bPhYald0uxmheJEh+kLb8rE56DsN5SC6aoNsC6W076yesZqPGdZFYzUI7hK/N979IYVJe4wmwl
QzB/i3qhKYMIjFG4k4rAKshC8S1hPkPYtRWnFzsVHhjUIMEq5kdjEPzSAJjPr5zYT57voqFApGKz
t46s4Vn3p96b01EE4BZfenzBbkNp3n78TEi6iql0m+Vf8ojH9Q+h2zBqdnegDH3JG/akr9fwOHS3
2yEWJuzV9mg8/zfsVjwZGgX7z2CdJt3h0/1iiLK//SxAPkAvFTVOLSjdcE3i1ZuzHrVvUnYnGyqG
d+MMS79J/0e8onEcX7260mHMFo/1v/Od21c9x0LD/yRcbbFYTT4munOTU0qkm//sixqnjCH8Noxp
XQg0jrjMSzpB3xrepGGsA1B06kCXVJaLqc01vrYLV0Hq8QLfXdQfHYJpsMFg0IF7IGzn2dGrufKb
sdiKKSPChrHvFeDyIzSnKv94v6yEqvuFseRan+0U/DdIi/N9I57PnjC181jJmMCuiJTQG3ypCoQJ
/DTofcy/mq0S6CRqLYhxot5qWZ2FQZmzclUwwS+jEGvcKPtMiSWSsYEpTBphtErenslVp4UCBccF
XjFr1J5as/ZBUM/DwEKGlyoJTBXWM7HxGj1doXM/wxVTBnzylNkDDF39OlYLrBGZ0QlEe73ci7uI
vVkt/ji9KSJcyCqCXam17t/OFlKE7WoeSs3G0SO0N+A56iH7FfBuaLScoqfg0YexZGh6BpeZmB2R
j49S6NsfzK8hNl/jZWCM/2R9+Rg2HV8kzSmkY8HVF1aNU3Dd0lyz/OXKxCp356wHNaFbvMVCynN5
dB8LmavKU2GjZit9DnnBN243oNKb019GYGw1kmHXGynx2F5DTEjXxcH8RX91N59W3QUVLW+UT1pp
Aw8Qt80/tEL/7mlGFE6NBzop34J5C1Zl+d9KBFSfA4Wta9xGk6MdnKVzSAcmWXcLjwtf4dTYIIcZ
jwqEL+WeaTlm0oj8xRI+JWlBuAdw+5tSYOld8yLmoDYMy9eTGb23XtOKB7fxzD0dLglaJJMpc7RK
P0acXKvaRKFXhnn3nSRXGtL3Zj95MjSJmEur/0O02i47Wg3oORLlPYGx8uL9lX/WAoefI1RDU1Tg
1OUgyVrctr2JR9xxlFdeTQGk2C5iaV+fZTggWj4KWIImYErjk4TNSLD/246a9BYifT0mVPSOcZHJ
7WJLSK5p8SDNFxgRUu/bXVoe0qoR4mqanGRh4FueqQxwEjEk8KPTp7IFQyA4wBBT3y7dFZfGuLNT
/S6P2m9OEtuMeCficXSWm8Z8STRxiICyhQp8+NzQILz7LBavCgs6DohjvQb9s0U2WsvpfXjCuT+d
Q6g8TteOQtgpfNkb3YxVfblALdEeLs4A4cu1lEi/PyDUjd6bs3CJyoCXDAW2MA+K6SyPZQlUbmJ8
lZ71gX9bETIS+xAXo8bGRzroWB9BE/9N2VK4PvdYFqcKAr8Do1YDy3XXRld2D86cVkssTG9JEDvK
Ci2bNj/Ie+sA7+Im9GE+l8Pmka9AV3ZLoHboA5AmaYz3ppk6dXAGBdXNref9ZPBV65X/lTPHBDYe
Dt61tt4HoKjEz7zxuwWlKBp3VldcAmN3Zk/IiPzytR7Dwcn8966iUs+MVIm8JaWojmEMA0D/wY60
ALXu0OPhDE4SP32bPRWKdVG/0i8dplnIb/pveKkLr9xZilDR9uA+EJjmgLUhpzlSgLUb4fHZr9zV
Wib1rT9pR0kYisvr0Cg5TEI7H552F8wr1xx4113F/FQsPJF7O0g22IGlY7jNvIzdtdSrUxxSY3np
IRpFtKMnX1+lEGnHX4laDS+VuJp9eAsIQFKIOsE7wOOwzwdrGWTS26bmxw2pQSZ4DpPjdLTrBbT+
4OvAFZYhXDyk7Kfchb7PolSKS3oR22wLO6ppCJDbiG43nZebHWz9v0cozOwE6RxbpsxemeLgojqR
na3MxMO+MNE6xV0Qm4Y1zhCRP7tGeXZ0YLYKO7e8BJUVG1flmYM00hgvIa/uG+4GXicfZoSCZ+Ds
DdaO2pCeAmX9NL8VYrMqEbUkUKhiYvLWRbNluSBruKOSnlI26dmO81Tyx6oNqFpSad355pfgo/W9
wFYhweNvhHJjGFhNsTIcriYi5LxZ8cNvB/zf5QVbPym3UeKt2XCttBwwe8wTr1OUvKnvwNbf7/fE
3gzIS7pm8hC0gDdRrIN8phsNxxpZpo2XrQFWLBMQkuDVgQdZH+rY5s/rGAVIDZo4TYOM4ERgDyw0
kwvn2Lyl3e3WHt/EzGEjpR2fWjoduxO1oWSvu1H/hT9DSgm+w5EFTuXxj0JDUTlVGZ8vBBdKY7n6
7nPWY5oD9cX20YKPoHHBdXXTHpdf5P883uYrAJc+jWSNPulEMvgMZG+S+gcqqieCyj8kf+DF6fyr
+Sj1+Rtu0DFB6SY8tPjHu/1X5fAhl2J2bd2yNifNtk0sV9w3p5gmL+h8VXQBk+rp3TtQtP8b50dq
Z86+l6pVmstrm7mZV2Hy95mBcootVY+MMWPQaoBqlQvb/hx/Bv5EkBu4Hw9KBTHh1T39RSn8Cgx1
3zJ5fAt9sE1oCE8oc8Rz0me8E3ENe06npOZLEYoZSmUGj7ogsLytLglYF5Ocx8+48JZ/mcaz9Bxe
zvoSTIcDwVrxWs6Ld5n+c3cZoSRVxkEAuwf+bA0zZE83Bqf25PnK5wYVb6MTm2QWW0x84Byt4ljp
eJgauiX9ccDDdNjj0lp6TFdnIw4M3L9wssP1IxGtZhpU0CgnWHV/dxFd71SLWgleowW70RQHvm2e
e3eftFOCyt9oiWXjOVn2TmQsGG6n+oRrcX0qwwoY8Kln2f7nEwvT8tu2/fQuYJgVXqWqSl3Up8nO
K7arP3J14AnQCcBsCon8SkhfKByPynR7BFgaY3hMynTqRQbYqTi5VX9FyuIxxjf2nlbUOkb6mE7a
OF52IV7l29X6lIBPigvStHJY0m3HgK1Sr4NtdPhX1mNdbSyLsCXV3+UwiR3/inF8wLnihT5uvJCy
Gtiq1wzmUiPgJK8iqULe7d755IvSBekydFlD5psaQYRfEZoTWZ8JHyplUS851doNLM1pQAuKOCtc
91oIhkKV+fDo1r3S6o/yka5THhXr+BXo0fFM0fQweer61MhQsAJPNknYZmqkUbK5djrVGZ075uAL
1i2jsKAwxp6Flns4t5JfRP9AoTdTjtqngxOomYYQxQeEmPXgMb7613dNCjZwDEGBKnp8LyFODCJI
2khDY6sRVH3CG5mrxqaoWKhTRKU/dxM5VTpUHcQ7R645XxybKQ8bID75hDB9sKIYOPtL5KZ9TtII
zGP/p0EyUgjVGfp8w5VydY5GAisA+Mqzpp3DhEmbzPTPNraynWD/crmqPgUjw4soQ4+GnaUecRR0
SoYuWSYy2+9tnu+1+nfcTs3nuAHsnQKQUQ0smo+5hkd9mwH12FAxUgVGjjQj4BAgkUT8Cl2L/iQt
qQrwp0fepW9fp2UhwqKnvm1sVyRbh9DAc1riCuwFbMMCuJzZKc3Bt3yhFRWoqwa3afuHTVGmUZt8
q94TFtXMYTE53nwJQhlwN3qXE7wtB2VH0hOgvionupfbDDySV3SxDJHB/pgAdxfE9lduLnlbE87o
LrfEDLrhTysTEVpKl1aIbAHd8xHUbActv+YrfPyXKZK+mIvEiHVpAcKV8XeHkl6Nx4lL8Ro3wFmn
3MSI4iJfof/iR+Bf14fWRAUf7pYzMEldMvvtam9mYBKyN9MdnzI8T8hSF6vhEy+TV2bGhSJlcVY6
2K7ijD0T0Xu+48CcZIP146Esfd7uHy5fjM0VtulIP9thY+JUhpwMkgttB2X3u8jB+6URBz0M1XQI
nYh6SWHAL7GClyRqN4F32dDgXpLYS0QqEvVxkjpV491jKWXV+nEKDqAK1Z2KNYlbb3dIRWiIekU/
QR5LcGOPL1Ip0Nzibxtx0wsUUfqgTR7VPSNzzRffL72hq5FLJIRwcTTFnPa9Cn4t2G7ri/gfHsda
WnXQ2g6kSNqV2KyKHKBVMcsRRvScVKhUGb4xljYq+Oub9LoqvZKbTrna7CTh47YjQdj+Vf6hpxjG
Ppek7YQR5wGWHmtQ+RHl9xYlxUHlZRO0JdjlFjz3T2BieVEszU64tLGe5t1/W3Htwm/b3ktO/EA2
s5SskXx7kDo2C6+YTuFufCmBkT0b+KCNuR3EUfyBR145mbgMgS1wFrZnt0Y4fYUHWe0KPZC3c9T5
sHco7ev/KLc2mYWI04UAABbXQZqoTeEOlomUwAiP7ZdcypZ3bk+OYFH5Tn1HFez+D5bzvLtYOaq1
KEiIBqbTmg+dG7EJxmhyDdUDji+fSLfbacjR3Xek/+evTmy6CfPkzWBwCt0TzQqDQIbQuU0Qoc+l
054VpdGxiCFRH26pi3Y0jGn2K/lsAmY3BC8vJW1Vah78fuFRINM90W5o0YY494DA6bLTVDY4Mt1D
6Ljb55Y2PFeAcwbAvxrZxpd/cMo7k37YBDJDYAdEBgvPXdLAKzTR3YCsCiDWuwcS4eHrNyyx3qWc
i1CBS7JatVjFkFIUzmxrvXgmIT4q+llhaa6K8UwhmaTx4JT6GKsuW3g0YN9vvMZW9MxA/a1FEfz7
1azSUNV882AfVvtXvVgP4FdN9ok3e67UcyKlyhwHzMfZD1EIbNaskRD4QoXbgsBE4sxNlZgsDOsW
AnFqbsyxDLsoK8MYVeRIrsZq0SAcMhzYcgmxi2e3kx9sSoo7I/hxXAv6Z5pSryo3jx/vqlwJH1Xy
tYvUKvcCeNsOaRcQHD+LE2MMsncRppl795PeS9iD2ZH1/lE0VpwG+ZLtcj11UHiVdVYFbpF8fy6e
rsiKHXkZcQGMtqpUuHQCcaA/znNZX+1ibiqtxrmylyrVt4Y3HR6bXUYrachZdH+RGCvLqaVcumeM
eGdomWqaDag3feCUhGe7E8WeHrjtcgfpYv98gy5uDEj/rs9i4FKwfYppOGqmqZ9H0nyiuteOpeRb
a3D7JJ6whcnp0CMaQ+5SaE63LLkDqUq4DWfe2nEGMAE0x2AstSxJTuxukkADfJUKq05CUCuuX2IM
uPKlgEktNgXnwg3bev3Wb0Q49oWD0wG1LwC13+SipRnz+C8K/QbCEoGb7aULniHi9NXbFFNoF7VD
4bmxUfhF9Wn4FV1WNHjBh/PkP2D/7jDXzWKPomekt0zmpg5wqOJgR4jQhu/IN5TBys4n2FL53FA2
t9pX4Oai4GzegNGY4tL5/H5u0+a3MQyFK/36//6HlDuCEKht87fqk2+7KcpgJChZSSF+d8c25ao8
9jB8mQCo8vwHKWLf+LdWMqh3SIQZcFckxQVdBbmrMvZmKOf9CaerpY/3gq9rtr2VaHuiDcJB+Htq
FbnQQbLTZ0HoaLXAqXWufozt7gRh9oLd3rLDY6pgt+x687GAT6VgtpLv/NqgD3WTHns3REahkzyv
KQFTCiwLeRoGJQ7qc45vqzbhAbXddHQXb1zd7M8+zHSltFtI0nRMRJM/tHTe9zu61Xd6zCTYtzWY
K5130ampSBKU4DONM2IksXZ7umQ3qtQZmorMyd0VljAZqbuTirtzhuyytK3nPBNcHhO21Ll3cgRT
OsunOCnvK9rBes/lY+R5sdszRtu9nin1weA0WnAwAm42SjgAefnYA5sBhSMsK7WrLjcVnA4Lmz03
V+pBoaNNpk//aNnklL3JlGWUzQ1ixVoEjk3Y/wnsseTj07JAjbUd1M/fA1xGtSJA94r+ngOKqFf8
wlWua5QXJRnjgOUeWt9cG0GlvTjmFA+o4mxKi6MyRyYQfZEZK/QS67x5tFLiBaW8MSeTbD8ey2cv
UOrv/hbifhCwpZ2bnbBgtX5TrZdnbKNa22Dl3xbgo6MnsEPDK2rB1lMYfP3iQLm/pk5tsIX8sQiD
xq7bJfo5P2oKVE8IRaP/rzvvASZ1oD6Of3F/H7E+WiEzRF3qKfqTHEtud3fFtLwgbWlMMp1Yx3z5
k7GUqvp0MWNp/Lo3aR/imxOBY3xQAjrpPb05hwqaPx/SyvJ6/SuiUJIAtNNkJ3tHAn6LfbK+Z2oC
Ev/SZgMHjcGPV5gnqiyQUbaUYuPwGgM/D0TxSW+9wDvM/9IkCLvS9owN/Tl2s2ndY4D1oYmIVjtN
yJasrhor28/SCpRy02Pr/2hRM0Y/KBpmh4i7sd9VM7PdyzcbS8RxEbZ0Ry8omAcr4igOch36IES9
bbVtrNcCZp+NbPjENDnXMFevkEXE4UW+j30/kr1GUM+XGLUffRIWvNDrwb23s9eoNFobGE1j+mjH
hHGZlfd8MFET2LP/HvlKG9+JKyt+rytPD32q6Xw+p+64e1g3rnCACpaK+ScpYzxMWO/VJCbfkEA6
GZJL+pdPEbNEgBpU79J9QfxBPMZENz6YgOGSgJJK8zb62F4ii27JVpBlcAya3CKzsDM/AhMlcZ0w
XnV1JrjY+Y8U7PU1jaTN/QBO1RvEJC3RATXRW7LGl7lZK96PpjmqhuSl19/Sjde61dtr81SCZSK5
0u8pDUOe47L4Tq3WPvVDIHhoAjMnWbGDWEIuqh8ZwRqWC+w9tYszyc7WwmVMq5HqvtEmP9URhcKX
jXPJX4NAXSkRG/vA3L6UcDAcH6lV8GxPyYbr0ycj7mlnAH2pRNPAZm4D9BFzky1xcd4Ii5fZfiQI
oodPi1D7O1ZQkXC686YMKEtyBfuPH/U9M62hqwTSqnRCMjozUSDvpxYoScDm8Lg6c/zK92FfoHAs
HGDniSXglMjOvYMc6LP20LWQUCk+DFFWJEu2ghwsGY8Ok92foe1MsjzZ0NxM2w5dWVBiWnDeLxDY
5WtHfvHpVFnz7V+0aBofI+w/j2r9OU6TJTMvh8OiiqosffVDl6/eDeF41pKv+/acOoBvZyb6/5F6
OPK9Rtor8HA5rngG/ZIoEuXtAt84pfVoP0X8VN3mE+A79Qzrt/+sRVLi8ONqhlKsL31STG1Obio3
5BxdbT3zSMnkhhk8UTacGBRis7o0GI4WHqdg2zcDoE8WKpJbPJVqFK5/UThfk7tK/9oJPTQemfwx
Sh6hJB0uZ7cCqSS2FJ2Gy2+/eEqqPe1WysLUV/tIsPBdQrk8U3zAEcdcpGCkpUAmkvpNai3Ji19z
Z11TwpsQPF+iEnxNlY12vGB4GvBKb5PMZjzbYGMSIB3lK+6acR4PTtRHkoONB9pgArU8v/iyLzfh
28kWGCL7ig8IHt2eZmFNQ6MTqUWBOlwdpEmQjR18/+HbxRS22YP1B4eOlwoi/3cDecIRwFtmdxKI
pmQ46JESHj1HVkDjvPzR6liZLJ9CFUru1Xzd3EbWMapEdyq5L2O5OX/auavIbm6TtlWeath3IVoE
tHPu1t1xuBKpUdHLFcWynhftbqcMkzsotRkenYHp3PenO0f3djiLcP0OlAk+ZSYCE8gALXZqjbrJ
SUH1lmOyhC29zFNyypW0cbVXLtFJypcHc0tVWoYrnkpmrRL+eBL7/Zr9nA8/4Mnn2Hy3eEyE33yV
AaGdelZYQ/j/GwrbXY05moiV618D0NSdKLsr+ovuSF16BN3rrFvd/QtgAro5yZkrJOtsW4FbXzFG
aNAc77S+FY4geezSuYBnJhkb1KR1bGpv06SD+OrJzbeKPkD9CAiEG9Cs2auZB1h1OZVs3cKhyXGs
dKxxBktaARJVQR6K/aqQLFGeYx3SAbc6MGdEM9B6GFljE0c4xN30TbZiFtMZxPBvNr75cCJBrB83
qrOJW5bR7mhIAHsakrwdzTG73Q4huMHprM3OoV4moK92XiKMdPPiuqOJhxKtY4D8raMy3DLGbzO5
PBCHAkgpzMaxRVW1D7qH7mCwM4QUiBEjapK/eVTy6FnhnRkiWfvd6BhBij4CGWYUrZMuPMyd3Lfd
7FO04Qh9szx4uX7PitycXE+JfjuydxM7ZuQ5zhi/1aa02kT/9AUSWfBlUBfL/FQzZ3O0WHTlKQN2
kFfWc2Wt8T8CDxhESC4k45KQlUr0wmE9KegJYaa3IaYmHMT48RAFxwbv+I+hx7x4i648HvA8MD+r
rfdX2DnM39zP3clCnEdzMM/VUfF8Nf8RNFzzXvozJ62alko8BIonWa69Y6qf0GTj6sOw1GBLq+MM
dJERrbKExvmo4od9jz+gsNa7/yJuZ0df/8ExdkBrj6TTxJjEHJ+KQezxw6fn9iw0V+Um+jmnvIOA
N4uAqW0uY+Hjbcj9VM4+hIXAg+wytJQlbfQJSdTL4s+7MlcNgVT8qYKs4xvnDjvE2LlDDxaxCKX9
ceuUL7CusBMegqZY2GCVOPVVYWAPsC5T+Fe9UjZtso1i/r/OBgsofq3OspyCu1kKjkInkVpFaxTL
23WhtTERxj4M0pBLnY/H6Ozy+TFSK1oTs/vklkXhKyO+ETIB5bZgkE7LHxIpbTu6xgiRl4LX4rqB
/ISdfOzadVZZn7VebjlxZgyyvjN1zMIBiygUdy3zZQDJJRou1U65fOJXOYCk3fH/ue5MNhH2AXzm
hue7lIQ/thYQ2KFkod+5DZRA1ONkXeLrFawSou42bBjXcXVyKnxvR8Qelo2Pc9Pp3rrKKcabycYe
nDAgpLVPRzIyTIwYsiyEFXQilP7CWCpUyup0RZ3vJzqUBGZMfXh6JItrSY4h6iCsaKzVeGL+Sq6j
cJ3cCCgtLtUqAYW+FCwFt3W6S6CdQeDEgVHWRPKVGloy+19Anvz1BTSUCOis6OythK6Zqjw81xWH
PejsdTZCxYdi0WHpQCvWxk5v28oirvWnUmQsAzZ50EMhPz3Y35X0VmMosRJJiHbebkt8HRTSH9Ws
ltZgApyec1bkJtriCylL0VdF5uN5DsZ/LxDvMC2vqVxnS00w+rLxgjD3HcaExMlSZP56ismJ93D0
FBeOSXYDR5RWNiDBfxryWGDzFm0MjiXLAJMnrTbSi1m16XwDWtyy3NKSjVOaw5ZgUAYC8RbK5RtE
pR7A1/Nqu/vIX/qEs8oX05KDPD2orygP24+gCs9ZjFPN4Jz+Ml8/ynWENTXJ7x+9mUNjDPD6yRid
7MsiLmqziDW7yTanubp08a/OssvwIoSPMYPu99vJPo9j2XiNAx9oPzqwUxxGe0QdjzyT3QmomcNl
oAVJZfr2Lq3pimYhfkpE8Fi/t9JR7veNe2oKZFVyJhwYJztqT2Ss2g0hS3Ri0WObZ7+g2KCD2cPa
nLRNDbj0jZ51jZMbEudhh2J/vmfh8XPIG4oJGPRGyEvnp96Q/ryphcKwW7oprUWY4Vo4vQ0Kjabk
QjUQ6jKZ+ZdisqURTpvTkrfOOddU8CkWC2aG/85Sra8BkAtLBrI4FctTJjfWoC2IlaYtu4B+AjRr
MF8x7nzlfTPJHMn+ceG1+0NDbSgH11avvk8xX3zyHBdromTfTRw5Td9Z377xXNGKPkrS9lj68gee
jiJgQUq5XmAGC1bgh9ognxJAnNlQH1ov8Toxx18nFuCmso4/42oJaOHOj6HXSaSn/WURwjMLx82h
3KvzVIq8VgvLpLoCTR1bUx2Vlpzfb8RnQbfJuSsD4YRF+bD5lMaJEH6p0CKBajHV8zC7KPjkA0JC
4EUtUEPYVXnzI0bBcjbL4LQLsm0LV6xCeFxDDz2Oh7CMuAaOV/RAwKoGmvidyqlJAPbjBl+L7ZIr
S0+fEoRFOpXfymi0vZjwA7d0/Pm2pMx1+olxscpV/8s6O4XWoJitlT0PCwQ5Y/+EfjPz2kGiRzMG
Jz8XJ7RACgiY+Lt/NaROyShkuYBFj8kFDRY8LVaANNpJ+9XVZCYq20HtlXp+cM8WX35HLlplnCTV
Ns2+7xa65hIjjHk/scN07hRbY73VUa5yriHsQ53+FwuS49s4VGgx1SC3SZy0aTcYctpEt0Eu7fGy
lv7WKSj6SgpS0a3Oaqou7lTVOsqebXWd8w9/9SuAwPJoda52zUhOfUEHDc/ThoueOW7mx7CTXzeg
8xRFvN/1V3aV0hUYTKT9Y7Reooe9YLz3xoT9F+Yaf3Yrtl0Qmi6qII1gvnGfX4tlw+XHKgjh+n6V
UPJjlQYXv8nYixXL+JIulfmbFT/EvMVT1QTGUjysaHgaqtMl4WcwAFhDfZgzt0nsVKVJwm5pZlx8
vIYXmM7EcsW0j56+Yyb9SyRmhI+aXlBlm8Iiej5+Fw9ISd3VuaBAjRNoLd/wg54s8N2XlnIfxhJj
GUEel7/QS6yomFXuqqTvi/68raoJedpFGeho2R7dXTNDI0lM6szQHiFflB6enk4k3Ho1Nw0xa6Sz
KD9tfx3dbGNYwWqtftQEkSjIDgyENjO+ggrvjAiwS8P7ocnRt2F168uMFskJwTq4QOiTX19YlF6O
D4K9LWQnfI7v+ozLR0jl9vxg2OVj8M9mBMLdq6pLCqbtcvBPax48Ein8Yvl66MbEAtg10MVyYHO3
B1G+/fY+9lQlUYpbGaGfWZV2O7S0z7c/Hado3udAW//28dCwXTDh66OK6cRuWghBbz68YJP4GNVg
jECKjDVplquuLdqquiHGZOkJopjwNFjIs51BTg5M/IvYF/Mk3hhfthBFc9CfRA3J2W6r/QtqooX1
WgBQc4Sx/E7w/nBxwR+PkhoZKhSMd1LA67MpEzTS1tk8Ro+BEPwN+ZY6V02/8pBbeuw0+3JmzW/T
c1+/b1y4KNlFgSW8mcPu5sSYQZ2aJaK708LtdL/bpWytQlUcyqgnKysA8agxJPgsv4v7hjTrqovs
lsWVXn/OvnOjz56C7XS0qsvyB+PVoscawCBg/dYBpQevJVU4vzHgWuH6F434i4cIG127Wzv886g2
01TMavVOix82vTPxcR2wdW5ACmSNLaKWnr2TzkvXU5eSGdo88XeXpGZi85xxfC2t6gEoOwTFaPK+
2+XXB/PBVVZ6shf/t3hV07XqY+nAaLjvSXq0a32LfQOCDYOUxcW4fWxLhqU8MwfUXykCRINISZoA
A0yn1C07ApBAXKx+ge9mMEgNJmZkwse7k/jwzn72kY/5TAWa2Fbvyjjbo0hCiBGaxSyVKG0B01rW
ap3I3Bj13eAderhaeTK0DRXbbsLzds9zdtFN/g32soPF71yDXjwr8jP842eAGBIUnsu05ZdOCMoA
feoJQr/q8xJ4SyW53jHSBtta3a7oSX8LrL0cICIny4F1hqqIFnLeub/GAOjBpwX1qRd3gTsPQg2i
b3hE3BxKLk4aon7/M8OzmMomjpunLDQxU0LBHuDbuj0nBIsg45ASl0qPs3sY/UXk6h4l7hafaRno
8/+hCXR7U+5H3e/suSLg2v2Anw6SgInj7Y61Pz8r+9VUlLbarcORrIdWcD9zn3pnaeojF1tXquMT
2gavz4fxjycEsgDHgE+n2n2NpFx29wLV62hMyPI8sc4slUk+AGG0xwqjjT9oBpVZ9B+uwT04OVhu
fHiUPms8BRfBHk7lCj6ekNJIXvM+QYH1mA1KWpSU2JquCtqF02yanUl1vvi8/LG4sZ/XmywGK5Ml
sYmNfHyHjXEtrKdI1C8A9fBsQ7AXX8jPV5rJb1cOcLKXaxY+rcoZB4K4qcUecqbsGiYc6zGRVj76
liJEjr2VQ7mJgXQaPXindQPuCiHTGO7kNMxtEMR6Qm3p6vNxaptLp07COUsvQZAPszXBudpEWYxM
OjBLkxra1ZssKSkkWqtHV3r5aMA4dUaDVmZqe5hztvC9u4kI3GAi6yUhTTuQZQDdyNoxdgXYp7zJ
ZqD56cIagMB7QPHQa1TL3ZsVFZTwL9JgIWyXXmGsWiTFwvXh6gIqvgOchLcddzq+Xryc97wKNCNA
Y01nfpoHIjVGa4osBE9MrtLohjmwjrFe8y/v95RLuIt+yC6AjgCcb4KStqGZByiJ6Cr1sH2fhLFo
n8dEFyql5wR38Dtms7xh0eZ4mnEBKczLZiqG+igHsm9QV+BXuJf43pJk9u/NZQaqxwkd8W3NiS5C
s/DNG7H7xYSaRwWh8BjSpip+IIPqsOStbKwFLXM6I7hwkEQK6AClRKuCuYYAYDddgqtFyGe/N372
BuAA8pEiHGb9+sB5Tm4BDCdJBStlogklZMEDF3Ngrej3hxfOx9aeo9l4BsFeMicXzVS4AAAQc0Ga
yU3hD6UmUwAk//JTYUqQBm0Ch4R1WIm2ZqY0fDF2UtszCIWO42zyX/6cEMdx7jlP1cdwDY1DPRSm
1/eJcabHyNMdryt3uEYk/GGTSSRkuleoYzQql1JA58sZF07Y9PER/4cClP2RBvZjsnY3pMf5dnKe
wfSeVSNvBZAlp0Gll264Q1yjxWevarqbHJ1TCcIwwxeh5qxF/aIXx0CWp4HjE+d0iVXsMpOBs+zl
yUE9pTjI6cerQVqv3pv9TnBkdeJyrgG7MVj9JQN8trLcy7NGB+uArb+54Qxk7VP43/moZKKQLjIV
jZ7uRl1g5VHsUC8UQX72apxUQWK7GDG+TtypYM0FyYJ6dCsKvjFbU0UBTuYKsjQzIpVubKrh43TW
M4RZgsFlBAuN8/zx8Y5AmDBEjh/jeq/2f+813GzvlyF+WDG/Uf4dCgAsJktuLrktoPVXGkTtKt70
U/T2MldAhNTts+ovn6x3mCuEdUHvXKN4pJf1aW+Rd5bU6PPTdqm5iFSy8O6QYQDuaCWyfTPCHD9A
hCll5K3F/4pEeIQVEjJGcwjrQ6yzF/A9vW6LUja6JHg9wgKPF6vO0aEDIg8FxYeLELw32w6AA4CJ
x96/1BdK3eZxwiBbsCSAk+oAPeuRfOXGJLh8uJfKYSvQIaZ/kFmJU+YqZenUEmCofcpYMBLUOcCn
vbKtVy3Z/Bml/zVgZ091Jky87wVDhBm8fdFr5DYNc832zU6Yqmb7naibwX7egHCde2cXir3GPvpa
aipFcIivnextP3MWaEs8aWqQwL+lz8iB/smaS9XztBlj3xpRFPJnf4lsNXWJGGmLLNRs1P1+uR7x
5ptKRUqmK3uHMldGmRiJK2lyGphXKWCrHh57XXQ9aidwOJdM6FvaT1AWGy6yEYfBP+SGPyOPO2ZC
H53kpEwtB7pNeevop1WAjscDarI0UacpselpBiqyOPldqflxsb/rzbzEhHTYj+dXsj5Rr6V/9OrO
H9qOmrkonugDqbhYTh/Av1OeSRXo2bI8BipjmkzC/6zfaaYtzm3Wp1Hu1TRfYTJuJoFyZhCU18LF
UrDXdESlx1VnLQHrLm4CwJaL8piyBpgasaRBq8/wMbgKmN8JUUFE46tEx1qCMBRUJzHLSiyPeIfX
MmBaYw0YKYWtWxT7zpsMiWVis1SqesQp5zEWXdwR8HTb9bHKW0mnzWNuA46zC+MTyvygzYDX4O4C
E3GwLgDeQGFBYSVhn4Ylp+O0/z2Gx1WIHXbjilyQKURdLdai/iWR9XLsVEgzJcgNkifdyyHazeGD
4/F9WS75YZ6bBD60KM3DXSQl87528cMbegqADkk0YnIAMzbvCUlqZTm0NXHmmt4StedITIpWO4U9
btXC280pBb2tb/dB/PV/agPANk9QtTL8KojWG2ydXdh/cO1jwtt/ZsNq8S7BvfXjtzGeQlvB4w14
SMdpzPQKmR+eOqLbZP0yXPdmdoRvM9lJYZ3r7Gpm+ufFOBxW7yYHr/4ohrwdvV/3qKoGUF3ixecP
X7BKg4lmbSpq24w8yMBGE6QrpBckSC1u6aBnUd4T2VDgQ/5dX1S1eRAqp/CbAXUA+yTVR1hh4Pc+
esm0oRvdASND4DPPXGBh7dkb/0jrYqpWJLNKfCN5ahZ5j45jN4MT2jpxF+CnXk+2XZtKLXCrOwPZ
wIwLri8s3BrjVjXf/DKoF8DV+VeCQroTDTjyR9JyAjtl/NBpmTcszeKmmrfJu07PcZc9PaS2oBV3
litotDLkt98hMAp0BlbPWnHX76LwNGNyUPaB4yHACPR3ElR7IkcmU97+hnVXmxt9asWcXYX2HVef
l6AWrloZCURh8TCvMRcftAyMrnv6OvT+eKb/WN2I2hL46JgiOvZ6WVN/0j7Ht5CHap9FFMeH20tC
gmXVmYdYxYlNLt+QRnCi8chOapCkVkDWiX3tAo9Cqc9tjBoOoA6nrW4SHtSQmAh0F/eztuT5XdNA
+CtUrxJxGq7slE8JbRIl237DCXrIA9gXKCCNz28Gn93fXJqLrTC9UPmEqy7JSYlbpVYGpkGmi4Fs
lcW3M9Fr8XF5Y2e7CaU53yq24c1AivUFXlLvV7wmPSnU6QnL5LkUH/ZIsj5yzfsWyZrvkH6loY+B
MxTl1/73OsFJl/FnA5uDFcyssUM1S41knqa1gCKVOCSClfh97hvaTktstjkSc1BIYb1QpVPLKlH1
KVBkRM+kMRl5i45beyLFpUk3tIDCvegM0rh99ng7urcQ5jJ9//i0YNwTiNnv2tlFU2ohnN/SL1bD
6koXEvsIGcqiqysEKJZLBTO4s/O5dw3/CWFPPpiOvoLUXYJefFMMOk/D9UsIyqIMYdQ7YuKMIj5+
zx1Olj/pGbkUH/DSazw01j130V9szKbgzU2cBCC3GzmvU/HAPwAKXRAeMhLT9Sf5Uh6FviSDToY6
flruggz+VxDnczvyc+wbYN94fBGgAdwCeqxTM1uIUzc09v180AbHQ7teVOqNKyCkl92uP/VSVzf8
GHz4EttduI9xIgbYZKKFaXNlZ7SmnfCRJk6oafow4+cDU5Wai7PALuvjMfxnAbh/gTZLFQzmRK0B
GBIevs5lJOaFmQnuzJMTMRydcN1kEKldsNbeggguCpbKr79+SPPkDWszcARptm+qZpBts6tjeJVk
KmZD0DfV08u1QeCcetaox1kRGHEWJc8oGXySZKSib2t0Lc0fiIAHHIZLQL77prUk5np6fA07ysc5
DJsLtGjIgfmVBlbW024MtjHZY0x1yc7chRIRrB+EosfZwg/RZdnR/DawLFspvX4Pb7ruhYtRK4dp
VIuZZOHxSJKAEtVQlbZahtQREG7CNUMh4wxrait79SwZ/Rs4LNPwwVL9FSDfhPBg5jucOmHP+ODv
f52feqkqzgSih5Aq7xNPbL87q0dBztx4SZ50dhuGOd8iVjGXTiFeKF5Jw8UcXqQZ1zlsxNra8cDr
7T2U2kOvkmAl0ARiRFh2Dp2Z0l6LMwVjJatIWZNwYuiecqj5bbuOnjg1NJHWhB4kWbuQEHJe0aG/
aL1EKizrOgSJioRZ5DmhHDfQ4DUX9jd27ChQGFARAtGXPFOwPP6o9Qbg5nFYiCW+XPC2AOZtPNzV
DxCUDBV2jjaWIReelJgtGEr9NrxOa7b8HseKQerS8iiuvVonWMdnKeIA+b4IUfJf3PcDujtC8mXA
xNJt+aoZcJMiDDfLNzkOxIWHUOpNHNRvCQiqyos8/sVzjerovGmAlVI8n43YB283IGfR2iRwjDRj
OpNSSrxJS44akBPwCf+B0xrpGfRhT0GdqB31AtnI26Cezu/7sZML/FbmGIRV2y1zMpSSN5GYDwso
90hcpC5bX2qafn6XlHxAc6Axv9IdJ0syk84ddmcaRkdgwYD6itn6O8RLjvhMWc1tyqy6UYFPPTDM
sMavKzbFnGWJ2o8y6k9qrel8Fe+6gLG36zTefdgkqq8wDBrlFSEg99cpHcZ559SGg/TOHMnum8Pt
nmmPB9aPLBi4I4gQaYBRZhbqkxQMozXbun99cSLJxXqBBy54LanfEip59DraVf604vOAYNxHIuWf
8SxFDfCZzrLdGm1ZWp4m3JayAyxS61/+3GQSCUtx7N3FatD5h1cBDuiNPGKpTrhalA1xlwqfgbdo
TP0RkwiA8kgZD/qfrTcRK3VMDYfzarvfAhkDk1h+OAUPoaylSPY7GPSykRRmYIJUpEe1IF4ZExDG
+2ubqlArFeiUkw0SY5sGW7kWxdBp2OEKvlEKRy5ug0Cr5IT0n0Nd3jmaVdF9D5r3/kqLS/CBwAtQ
FeFAQTYIZSwQbOGk42+YnXq4iTtdiv2FDoLfWbjimY2IPLoN+OdVcmj2uT+qbPJX22wjLwp2WdT5
tJVnabDY47rnkntX4ER9TOJMIB21qQYxXp39VVV9+KWjiZOdMn/KlL8ofrCmPBldkhYOWXCA/XYk
jmi1ubYqH45rnY3MwnjklLcK86yQYvzpvG5hRj1FSUJwA4/tB867Fl20ppGcangMviBrzVo79XgF
J7z6uASHVtzEL6n8tP15sjH1/LAEcfa4QMa5iTuzzlMvStY7V5PzqnOrTNnOcPKroFe8wxgUlHc8
Hogl/8c6rZVFbYyvrLGOS3UtCigLTHkSVpjHQkefhKW8Zv0amocYqc8JwYF3OFDAcVRRTs3bDykq
+0AsL9C3CGa3AubYV1uPlQiyQeTWeDcBh8ika0OqJr2zXJ+B9oKUeDwc+SD3jIpwx1Uc7zCmToex
XDbXAcbXIPeTFckW87zhA7xjNWVu73lbOFB0DJNceHZHlUIbz+pwALkysTrkdS4c5JI3IC8kBhMt
nHSAid3pUm6C1sN01okcAcMtTQzeRuecBEWCm9XMKUhl1oGdSzpRnEHtJpLUmgBLFHi5ALDnpa65
6M04NWmX/9IjPZRNb6ncT1Sqzp3JYLIT/qKXH+HGBrcZUEZW46lWhOScM2ta63St59AfVDphdjfp
ZKJyj7TgFHhOBwyxuu4X09jGkWZnOecM0gKFsi9J0vtFxO6eIGya8H9TMJ4zgAtHrKFXmQZu3qXj
1FBadGW8Rzuxfi1efAXDCZZnpOYRUs4MznrOCvU6I+Yns9PwmU6Wwq1zA/ldP74Na8Iut+O6Qwri
1BUvbHMVFAbcmDjNpFWO7oTvJsAg3WeSUuMncV5l6nsY5kz2l9/A5O0sodK5wE1+WHxquAS0oq+k
+XQ38BO4F46Gwl7fJZEFgQ4cJUFJOp/qLzai5mTHUPf/1cTyCeZaPY7DDE/JQZ5MH5qp/0DS2B17
MI9UtZ3ftO1FDfW0IhKZ5uLb+rZhQTNoOQOfDDaqHDjwGBQSQ2RTyq/bO/wTkcEz9mI5uMstenNl
hy7elzJW5SeS4nNmAvoQqmJZEdxwS89k+4NJcggjnUbUaJL6vMfLH9zVpAw1A9IKag38V4diU09H
/2vtbUrGwTZmRb24JxMsx8gFhi0Nm04hejrE8ll0yg6QZ0/9vfkwYmIUKDIzgGDwjKlYEDliZzjS
EOTUjTYO7Sni6NevD3SShbRKYEDFy2w6jSme8us4YhKdEgqB3ycl85vHDvZcSTyl6UsY9Y8LpUoh
zeRr104/yKoffXJHSdjeqLhuYEZzMFwSoedQjabuI8jq6q1ff4+3ZP2PngkJEy91pk1PuxsQp6xu
NwkEDZ7g43m0SlaR8vnMvGquLS2Qtfk7hhqbeMoNLWn3ollNy2yNnAN35Rv65l2PaBidqvZCU1Lu
kCEij+B38Lxc5G2SgGtcXJ/r3nqyTq0s5mjNm//KVrZJMFntan6SqLe2mXFevDUhzL+i3KQKceRb
bHjM1u0/nKV7ywkclqB9gNDK6jxNu/6/yc7+VZIxz3uAONki7SBWKeRplAyPThPR8n/XrFRQ+vHH
eA745RIM4ub9T9QHvt64zlCSzqEcXUuiOtLmBU1YrIMNZQTQN3UU5VgTfyoIiscxRVhhfANaWRID
SZfrT7vMHpyU2gJP4o8RYyS38gkW2MbSpxYMZZ7VyJLixbF3vK5ZHdJ1aKDz/r/SIn7MLUi+4xzX
K6xLk8ne6BGbMJSm6DclABlYJOBm0tB3sOHWztFo6XSOaJXYoFSYQvKb+EBcFNYIIRFFABRQAUb/
8QpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpd6YIUtLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLwhEUUAFFABRv/xClpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWl3pghS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0vCERRQAUUAFG
//EKWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaXemCFLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLS8IRFFABRQAUb/8QpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpd6aIUtLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS8IRqUwH1t
ZYjCAAAAoFVjsmA+trJkYUdAq+fm//EKWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpa
WlpaWlpaXeciFLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLS0
tLS0tLS0tLS0tLS0tLS0tLS0tLS0tLwhGpOdoGChCK1KoAABrJzUwuAUCnJp6uxTj1pTaxbb0I0A
KtsDNeHi000gG/UZq/kPmAz9vucAd/tigHOkEYCmYIla3mlCgMaylrq/I6BTk5NVt04N0FU9HklB
wYY0YnLpA7KOnqqP3ZIACvbfx/0HY7WSvZBv7hClpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWl
paWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWl
paWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWl
paWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWl
paWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpaWlpeAhKpO1
pipIUgsy3OqLN2pdBKwAA/y67yeEmQGwsqAILFgBf3n4D9JsCR/XyYQ9b3xmBSXFV50RiREoTD5e
32YncD9j6DKGGn59RM0G7O1IA9OXZ1649Cs4Ap6RYLCLH4FnfRl48pF7oVFv02sefp8qgQ7BfoKI
rPwCZUu4Rzq3u6iF95MZdwQlgqzjRYQA2WTISGmBMl9VGBcigeRLjVmXvBnTMuOgfaEIPGTjOhlE
0iSplNIzbbzdEtz0CDMTZjLx19Hn3QwnYqJ31Td/FewTdPq4nShklU4T6+gCYHV1VYhcrNfRMJ5p
Q3xQlqLVAm51G5NRURaJUMriQAerPUYMhCQo+CqqSpUZeJFVJkwXgA0ZzR3R65/w/eVuImYxOUj8
X9T+D+x8Ts2iSsIxpQLGU5aJW1w9eUDDitx/PyzB1neqxhLgigTcAB25Ru+jY7GM76Rg5NUwJbv4
xhaeiXEbSTkqHDGaBpzSWE/P8dvh3gdAoNMOhJWmWidpgznSiSiKtICRZS7+Rd58rVWEh5rOuJV3
o6231AKW0TlPFmpwIpRJ51JqSuHikY5FNAOC0U8WU4QzuOgsiFUoTvD44GYXgYrs13UkHO9yyZMQ
/s1b92mnN+ftoT7p6qDXqIMwWhiLY2kMpc20nxp33KXqJw81X7XF9+obb0RydbAAOCFMzP6H5H52
rz/fCoHfJEHfLkUBvlECOC8b7WYa5ErH1lUA0SksBfKtmSSSG9zVqzDph0vcXgiwCNiil0AEOHDC
AyWYNEOav/IbMY0p4GsCi6NpvXl4CGjHBzp4OD/5/m4zbjO9Q/d/X+P+4AH9dUCfDOKdsyeTBwcM
4zJidkMMbuyvdF+abhtmfw2eDw/4rM32HgX2IE+tZYnQSQr+GSMRpHqXi4ieARChBgSvICYAdk6G
z7mmSGPofUXcXxHOP/Sw/Ao232kj+LP+yBcpe+HgeyINiNG+vJ+kemfP/MM9dXeFQvWuNRaNVXUx
6UkNEsdM9Ca3v/TnBPqtmUVdzhAustMCQEvY+yJb+FbOksu54yEKiifNeINzPDrxH0WcEhoat5Ot
spvtZuJ68sBZiUxIO+VIO3StuQd8qQbULquXNLrXtv9nWXb775AcJSWA8oSRl0YTqUPIwtT0sT7C
YMEXomG++js/DcCvbSrEDjgEjgA7sGs9/3BwACiKnBC+vS30YegGegJFFISFGuAsENBjvrI3Sb2L
HeIJI4iFbpvbfniXlNRB6w58vbo/F/y5ILpNZFBIfViDsFwUhVFOLLE7cctlt/W4dY2sc/pKuyQt
dd10uw/+2msUUb13j5ZEJsjvTWzH02c+dm++/7qki7izjG/aMyRZvdedoEtAddkfu5nBbfZHtacE
6N1gadYYLIxT48fZotUSebBha0m/gjkTczay/291xKb8IyJergff3dEjByF6j/+7sh//L22h2Gmg
cQgQFl6CVk1iWTFv1FZBx6IhjphK8IlAjE7DPm8dVmbX+38vToLWcOv2t6Yv15ZcqulI8qvFHO57
K6F6Uzm2Qw2imZhKw+TmrG/o/8fd7U39fax6UfRdwbK3VHq0UxJNydkrZtPE3bNZsvn5lwibXU9I
SpqdPgLDruFrc8DhoXYhjRQea7QFUwtck8FOIoGMZV1ieuv4R8j2WB2psacyA9FdcLH2QIuJtpMX
Pc/yWH6BtBFRMwM7ONzc+oWWUGNzc+lV0O9VKmWXYN3FdgSS1RkUKcIFEYEAWL0MKjghHw0K2f8d
jKx0WKJXFErNUkhA3RIIIIr0EuXJtPCq7Z44JzV6g1ZuSfAoPez6WwdY534wHd9OOaRZLu47juP/
//8GF1W79b7nVWDDtuPbO397fcvb79ZtZxMeJWhsd5znbcS7DLxNdQggibuZSuZWwplbp2qEPNZj
7ZKI7ha+JxLDmhsN7ummtUHU3Fx3DuAJznVkfffeOmQBMKAFAHAhGo/72/7TzUV1oVkoThBgf4K4
Kl5OSahDXIfF5XJU0OTTVmXMBBR+uCK8DPkvBATx9Q6ox3B+kfvGGwWDYZBcPv4B2ZjnwmOYLoE9
GFziaTiDcT/Q4f/N47/6/JbAeWuQpA054Zzz+72X+N0xDNNcY9r/++m/0f4EEDefIN4vpyd+4/ez
s9v93f73f73fRBPE838Axk836/AE1nMHAIKE5DDIIE0CDgE1gsGsOwQCC8gg3hNs/l20MT/fxOJ0
Wm/t0eL0/rf9/+z4yVKby5TRpNbtImkqLw+n+H+jwuJ7Xt9PwgJuS0RyWpxWUGAfcdnw5XaVeIOg
ej/+wAtLnPdP1GvdfqQbt+9t5O/b5dmgz17/3n8+Mnnh80DMO8mt5IOJme/7Iv9+xs9hw4gAHDf0
Qni/YICfAT+AgAGrepfx5pq+aweDzWcdenM4g893/iE943+fiXDB9+8nmPL5/N5vP5Xnefy47mnX
gmgeFmgTWDhNJqHIYIEE8LyEACaQechNcPg4AE1nE4nABBoJBJpNAgs5AILNbY05LieIdULl/IaS
AAAA4CEaj/ve/KABOWui2KhwaxgwDqCprKMDjjecQtlDQkSOyqcjPwBPVZMlyHB2lLIKflZOTbEp
HsQc97N6oxLP/F9t68pBs7Pq+2KYgMXa7Y+KfHfz/AQlfhwDF25BynqnXsdYTSvw//trf56ex3tf
e2CuC3kB86Vg3uhv7t4enbSF11DxvtOhYczxOlVKN9a5SgOXJ+X2pt8CbnXNfZozprVSWnoK6TUF
kAG75f1sLMVK39DHb/cl/cev3xfccv1axfDcO3V/y/I/lX9xjo+rrJozZ0YizBMazpz7HFQIyiyw
CasdNsjDoVhoVhgIMAats07ayji+oyUtlDgER+d/Q+DAJoD5nG6bwPNiHuywBOWv6rDRhJstCCOg
y5c0g0Goqmqz81mAoIigQZ4a+zao3BE1UY7BENH4fjqeVLGqGMxkTnj9fCgAAPxmGQW27SzRa9VL
h0Qvgz3qjmk/D1hVqWEBVLHf8L//a5Q2DH+iL41FJEAdurKVtVN3vOq/Qxci0LQrWA+2Cdl2BXAR
995eD7nO2KHmnVrxt6nPN+4H7m5y5zZRj3Ou6HS2rF+jBjFGfCZ3IRqP/3Y/qAFHZoMgrLCbDATC
Cx1A4CtvZ4NPKqWWyhY55/ZJ4PkOMQwCugbMZ6JSWVZJGwonDFl9Em6WA+U19j0QwpHRkikrO7sj
pTgnMHcscOecad5RLsGX1TB9QCcZF5e/J2mHHHv2PAut+G032G2X4WnPuZdvtMuYbht2XOfdA9A8
/C52f1MeA/YRQ5n/+68H6O0h7jb4l12tTH7l8zKvIrB8Di1b+9qe78IkCMzH9gg8GE58aHvk/uRj
1diKu1vfDt6/Jzezyfq+6hA2MJlnrB/MRAnrTBrQ4aHYaEYQWA0SQyk5tq7glLZSoc8AcAUhR2gc
TPzXT989VsaZk63o0q9U38Ml1xV2L+CqqLzsN5znr89re1F5iOy8xwG3Ech97Bk67n/ubYU/gpDG
aBbGISH4kNGugMwTACdmC5Mlcbw1tAA8vbX0Dwzw+bw79/shIjhkSFfr75aMAbfZZLSsB1eEcukT
7+zlAIcziR3IsJpJ2rCRxLpjjONPdLunnLB0LRGNGSXOxr+0eqC4R1E0XplUArdFz4x/2+MDByEa
j/ft75ABS2xxWlyWMGAH+FgoMNYSBNq2WSfxf01YWL10q/vNO8Pj1cQ0zTw08PC8IjwnXtOtm2gP
7v7T7rT9O0/TtA0CoHkHxeuOOCtqZEWdR67Dv/ri2+OlyaUiVmAloIvoGn9c/9+uMhC0DMO28g92
zD7vh/XsPg3OkGmk0585/gmOwg0FAPN5D75z+3/V/af9ud0ef7w8x5Xk+/8594POeV5wnM1gnXgC
cznr0FAJpjuMPB5zOZxBcM6+AY769NJxq3YPa85mgAAAATnVwU9rANrckhoLhBjrtH+QNhrESi6A
AmTH3EDI8sXEu0C2raqJ/5y2NAtvMeYuQBoGgadbOnaAAeEmkHmoQXr85nnu/hIJJA+zv8L9PU9Y
3GX/dV/xs8Vgju3sn3s9dm//fqcHnE1nM53hxVyD95OZrNIN4QACDzWCB5T715Obz9ZtPG5nSPMB
5wD73zn3g73vh3v0nffcvr/3Pfd9g79CHCgruKd3q/g3lff+XzgPIcAhGo/r7/f4ATF4cdjBgEaC
p73KJxdU0g6/aQKKQSxEAlAsE+YajAcbx1laFyeUnK1JPxPYukuF5hzEG25gAMwYGUOQAHINsnDV
pwcOsQHELYtv893/NU1H8F/ewbpKceFCaTiDTh7//ZbbtjW9Vsb6jyCwLKgs52LB5xOZpNZzxVOL
DsOccUBf+G8RDGTyF/AAxs8fz8T4fPf8Ht+0PaDzvKffeV5POeT715n3n33mPOFs2xoOnaBbdsdc
23bWnBoOYds5D7ryDkHu/+GYMwAAcg0+2eu+u7a0ENO0DTwAA08JoBWWR21xAGSAwA8lbGF6KAsD
zEAnFhfok8FIcsWP/7AJ57Nni/z1fuOD/GnDTp81xyAPFpntKL2CE41aRQjqD8XNdgwTtb8f8YAD
HWGweD472PzrRYfCzQIJOAxxOZxjZ5nr33y9+xuippB8c7EgkHAPvR5PO8nm87z+XzeQAB3h6ud+
73vR3x33enqx3vfd8PuXfnfd+AA4AAACKEGa6k3hD/JlMAIj/8FsOzrJGjp1+KRvjM8v/Nap37hT
jpHUZogNkvqSLmwdnnBsNbwo5V1wTvVWgKVYeOCjnwUvcoC0Gp+pTPvB7UGNv17Q9mB90ZsowzD2
FXnrhJyRtWc6w/dcuIDJ9T6U48lHMSkojvI/iLFC0nYZf7Y+Kay2qqFC418ZwHrKY0SAnZ/VnGNQ
uX7P1QS//SyWRf7hb1tsAAS8hGEIn53GEpI3mzLADHFqUkp9BagdIwvKm2fIC4uzKImRjNCUsft+
qqqRkxtPyfyIeoUbfmzsna5PwRgjEigdvb7SeBjkYq6/nwQP3yjICuSkdHcAwrN43CpOYDllZTkp
+tKEWWKLTGHdW0FuHiAyA56Rsx0TuObZLEPqr8qKYO9z38v/C0BkABEUc9a7pygsZhd81fOmF3pn
t7viLtRbwy7CRgxWubBnfoimdGP/PMfVoi5iIGgVsP98sWi8xuwoldLA38UqouW6EhT6dlktKqtB
RU0RIOyRuaW/hvqDA4xtABEBSPUVZ/lQ58m/izuDfcO1FpkbHcielPv3EGF5WMnZcaRmyA4j2Lib
E92WMQ7p75F9fQB+ALMrPB/mJMqbvi5gw9Z0Xj70Mn9im7WGtUtN4Nw6g8LU4zJ5T4/+WKajbzYh
CC7cv3G8L43/Rh56O8cvrfiBjhgbJJdYdVSlIkUVwhPWOtn5ucsfPGZtnWcSbu1VosVFwaAL4mHy
f2YmQl2yzQAADSVBmwtN4Q/yZTACT+d4P9enDn9ZHrpId12JCtVT67eCzzw42kL5j36Nacv1Zpck
aEkP8GZqA4ENhgrofZfR0t2UDn0+AXeD9PGgs3U/v5Bir+2rM6cvAio0q4VTln/kSYWEtVOTYc9k
z0W6Cn33vKr2PcbR28ThZBf1U6CkaZt4kp8tZpijloMiFZ48MQVzJ6tNsSd2jbteXESg5FSXQ2GM
tMunH4rcZjkg+8NjW51UybR2js0g0gsKplPEfefjTsrDrkcfN4K7MBhOSEeR/osk8kAGz8IwUeo7
F6t2eX8+O2mr2lXlfX9ULfVTA9ZVlVRYXi/4VuX4tE5zCrIRHNZon4XWs/LT24NLetJCu3fgGHMy
+gK/yxZQ6WSlST8vfRCu2jAnNXh2pjbh3oS9tdvQUJT1rHw3g47YMQWDvrZN88ji3vgYQVnhTuDn
9+b2tPZb+aH37ICk4HIGwKSRVMfCWli3rSQ/jLsrwudB8PWuHHusRddvTgLpGbaW2QlqJ3alXW3v
l+/KJdTa837GjmUUqdYZsGfP5lOaz9sOERV5Hc17XqUKux+fhI9IstRgbgW0O2c0f1BQSBqi2u/3
CXrN6VJvyN74765fC9Chl8y8Mv0MhTSmFJfi75Qd00k4T/rg0K0odDcxj1i/anXTtwYiLSg449wR
Mrvm3FVMbbetYGs/9GUfgnEXgyA+lqz2ed4MCCuk9hqsiyPNtE6nMJb8wlT8FKovmKUETfh8x6KA
/NCZWqOkfp5vz7xh3cEXyKF9D+f+QMVuGRaGK/Kil2n+ECCauwHFPhORkQ5WGf6We1vaFFIm4oOu
P9GihH7xOat5k5DKxK5CXquNWixtE0F3rESJ7VQ7juuIZZ2FuKJG881FemMuLV7hA/9kqrLAl8ID
7DujrdEgTZovTwWRMyUbaBkaGg1UIGTg6lVkSSSMQsoKQ+RXJY4Uy1e9DiomUR2FjJkAhrHXOWwn
eu8Nngwj55CJ+t/EiDRCls/FXN14K8EnhFyWc1yVDh/3w24UdeATYhv5+BV2O4p/8F0CqclUf82d
EpsVqokAQnTKjvqjQS64W3diWXAfabi0Ziwtx2qKSo7wtBcT59u/oycisfHuGXjY7ES+EaD/xCHA
TkSDYFFuwrGgvVx9IYR4dqY/ckksiBXo8JaxO/2MCouJvULrjx0d4QtwnZyUDJ2oiKv1T0aQVA8/
wuvZSSaHTy3gRTN7UF29Cn9VLrylu49n2+URthIf9ptHfQvDzVCExJmPItULWIhBn/veJg7XdtO0
i8G4H5cpziXOfYaaTMVtq0vqv675y0dx3GzRMWPfqZUrmgrzyzLjxbyZDeiY6j6m/24xgeJdDANk
4La6R5Q0lz4SOChuCmj2XorPpf24TZVPupx1koCUHP038pY8dGcg/9ZfNlYde7Uaq1pD/hu+Y08A
9adciyBnjjQBUE38JprGX5tqf0zDQ/RahbfPNwRoSnOnrXjXiHXsT4QYcpvPD61GcvdJeF118y3z
5qDQ7ujSXj3AHoyLhHDEmah8WwsbH+z7/ckG7CQ26zxsLIQ32pqH6aEpkrkDPQyIzDH4+H3SNXDN
fMG+OcU7cflk1bxH+evkWRo9d9uhe225gxvk7aX/Z7XrVSQRfzQGpOeXlVLnuQRInU2/BgmWpsNY
kyCeMBgsStVk0mtCTCMb4O7eq7yOhwFuOy8YXkF464KFTCfdRcXTvUUE4gddNo+mU7aETJtUzNLN
QjVfBhpTFxUsONURjWjOJ/lr5rlb2cP7QIpR1m2I7ks1V+k5ZBSsb24BKtEaWMd5039Ydj42W5e5
DR2IFEgTo5fYeMfCGNM2uws+60lMDBO0un3GO/Amv+Mptb7VwXVdMSSr4GT2bzYyKULkvINNPQSP
xpn8L+nVi3uRnvYufhRkRk+2mxs3xw/ZxTPMqTNSfrwYXQd54kLw6TM2WTv0uGbmZpk0dTgQgBD8
Ixf/jFQ5FZc5bLkBqgmHck1+s0orbuI3Aq+a/u5Y2H7ZrSp9apI9b0tMbNmpEJrdFof4ML9mCpRi
B2OoweiFGWBWf1upzODSyWR0M8L5hqL3oCmS3snF+ah/dU8q4NZSi9JqFXO95l5/bC43vD+BzZ5Y
54FbNuQESbZEkkkcpuZKdX2Bz5RGo1vcUJII2/SJExLeFcjX6klnX7ezrT/dTltWUFSlbl5zTRQj
tNw32HV8LkMSB0TpfGdzUU01nva5BIHnkHdGuuKeYDt3CiWgQ19ZQ0ogoGtITZVPwC4VEkypxngn
d1YtT2lgNsMM125wMgzz/7UluPCMV9v5edwwubxU1aU6Xwm3w8tIxevP7UPrNn/95mGQdPundwhJ
EFVQZNR2M7w51cdkiKNpSzb1iubjn+a/wab9ImPIx0vLn7j8zsoX6llGnOudNOhrwRS7BRnWY7VP
zN4GrwxmsVmdYD1EyLHV4BVQn0QAcSol0dAd85smCO8iyDE727nV42Ygzg+1e9WIgSDRfsvAWcTR
5us2KjdtZMg2lr4Z6u82jaZDaTUp0OT9k//vvBsg75hPpsELqnTJzSSrA7lBgiBeOHJiOpVPUhBG
yZbmWwpGAbc8THwqG1E5FdFv35arQCEas9pJ13P30dR23MkQLndTGYxrsW/5efwzQeqaWBIIcvIi
j4jjxOhOFvWoIbjvMyrNCC7VWYQnWPe5b1+Ou4cM6RAwyjb4rA6bl53tYocMFrMSoVL1TJqS+RfS
r+wKZzSrvrTpppveP6/lE7HfnbzKQgzzOdC0c1tXTe+U0fz7jy9o2JWVvlhji6TEqP+3VR6uply1
dR/pYSeQqog/jGYMhKgJZyYA02topc7n8I+/Uhp2AqcN1fu+huNRyyXRzSXtSQ1vTA+z/2+N4ECF
AG+lepoBtIff2MlrvmOJosXUV3HYF+zcYnzP/bh0ujf6b4xeAIaY2JDDTTmQwiSD2vBjjCqm8/kT
s5EWgZMkz7iTRo1j4jRnP6ZRcYJ+IcyNpq8iWu0ByCYcNvp4nmBsRYOvxC2ntncExeis6R6duLK4
WjDSOao3Kt7JyBLxkXbCmSNKZkhxgtum9fA+CXb4qQl86ziCluoZErg2niDtLZKYiE9KW6AmCUSd
0TNZK1wjbMk+6pbIy5iUhtY6C+G8ov0YsQM8FNiya0Jg4pKfiKYBNj6JlyzUiC8mc0ED++ExAVqv
KHeaWPtWUDtRT+KYeDjSJPrSorox9pGjNq34Xcb6917a8LcHY1moyr1OsbOPOt3ZSrh1EG7JVKuN
mcaoAK1SPNHDByhRKL3ftn3mZlyU5Xpje8ms5RKbJgC3ZHhitfadY/XakShDLCjuSCj0LvKATyWE
RnfOLIX+I3uuu4x5ff8i6ITRb9wsAfy0K8Fwg23gjOZGGZozjgvUo3Vk6TTvCmAm2OCs5U77J0PJ
V/nl22Y8oEwvH/Vzt0955J3eV9fTBjA81e0jqZL5jnTkaE1YMS31OGSJFN6mdFTXg2bazsjecb0G
GJj1ROIxLZfMmwgfMNDxIDXs6n4PxUX1FHyiBbYO2bZ9FDsgk75HQ1pKvoUUkiJBSOespoBXH/Wb
zVb3iZV3Ikr+/ZN2U34w0KjhlxKXY0RQ3WZJGmAi1o+eNUWziMeyDRp8r9MxhDHPPVOPVbUi1QqV
J0+HW51OeD65axpbj0F+Tz3EsYfauUy6txfpOSJ5Ct+Z5g72hSSRVcmvwo5y49q9brpfujpRB0A5
5+yNqx/yPddLjVdihq0UzlcFQMRvydJJvPfSPgNfeQTpl5Or77E6B/3SI1b0g/6SjdDQEXBvYPSA
8m66UbYZj6orARxwN8S+giqh4s7y6gIqzOHHMVnrLC9CKSTdT6n4sgg4aZm9crhUfsWpt/K3LXGb
mLLs/7nvYoKAuwILrv93oqsARYzE06POHxe61QThlwbsyysApuoVGrGk/2L9nofwx2oSVELgrOl4
Sx9kYOrgESE97E9l+pBPEXAXU+xSQgj0NiGaU/tFfZpXoaa1ouTc7tWk3BarosOItXTryOrJvur4
PjKxkGfJjbzYtNZCAOiTITEdDFw2JKhS31F1FDnPzyid/zRE0LcKSxx29pG/4y/H/Neh3n2Ft1rU
l7T/5h2Wm/+mJ+Ii8pZqU8VqWhN1dCgmjIfWbVZX1sYTGvNAfIBj9Zu7HJfYA6sV5OWJsuTD1BvQ
va38FZiXboWdxDU4uwXs9eooDaCaNtl4nz50jJA83XpAZiOatIrnYJSDzunQ6SP+iy8sJrX6HNPk
LuYoC72gcJIvDbsD+lREfigkPxOEv5aUPlMxqitDfNQUJwVfhldPHyFRLDGAWoXM5GdKiH5JGk/u
d+oYn1/dR5g8n1IA0Fk5mFtWP/RhySHXOUjquzOofHvr4TyND8P/fEDu0Qz+ZuNDVKhj+VkUhRQ9
jhkA7Ahwiu50YRSiEjZrSAqFC/qPUnblbz+3cmpEN5QwtmMFObU8sM/poiIKeNTH3YnEA3fzuf6l
fjtjwvizte6W1ipJ4AAAC9VBmyxN4Q/yZTACb6BIpWEBkkkPEC6iqj6RHn9ESnEJTKIeYYUKA1ft
qzXHWNJ3Bip3bQ2TCxVd7bJPdLEhhplaHFLY9vYK1Ef0n3EfNrxpcA/7QPAPMpDO6RWe1gIswT4W
eoI/RNyndomlx71q8kfgMaj5JC319DjkzIZMRDRavEwHIZmnsHxhg3gAasTBR43VL/0qK+TA9L8+
BeUKZMb3xN5WGZT/40xcNLtYxAgirjXh1Gqkh0iusKWE3eVNoPi5Zv5NSWUKl+EZdSDEkK+hZVlC
MvWJXXJiXDCzycurGcO6dmp9e9MrC0P+RT7Isixcfeiph26gr3cnDWOCb/QqdyfYce1d2BLm5eu3
9JSHJwoO2V2E+8txvNQvuWVTIak0ekxRLNZz22u+mypYCRI3n1GV3Hkg+kWSHD10tvd/+tewAp97
EN1zETL6Dl1jXFNbIcnUOP4Me/E0DbqSrbmcRTabvkOhwZr5BwJ4NF6Fw646LYP5jAsvCC8pGnoW
zRfU7kyX69mrl4TNfSFI21eTIRJH3w0/s/d7PaSfAJTV50AwRo8lLnuAtg6pxfuLvq9rnYPyTKNs
LYP4GJp92A78xtFQ4cy4n9aR8oswBklS+eg+CrQl3jjlYCqzDORfdFoAYsvuim9CPDWbyJ9qKUiK
4DZ79FcMqJmmOwt12w3RWpgh5Td+76e1pd14iuLh5EuHN8Cn/qQeqw/1lIDqqsvo9pGs5BI+tMl1
pzcqLntk1YfGChQoCeklf3W1EprHmSjMMLn0TrKdmrOFU85Q3w3SCLVTOs3heIIWPzD4mzSAK4cg
tKx8x+qKTjy9VNCu5Mn7k8v9iFMcWt8zYQBZy8fZjtJ23lFEgn7ixliMRZCAbDOoWvzADz4qe4Fj
srjE3cHKlc1glqrfKXcZhWAGtCWcrIqDvWLLNRUq8XWjCoVdyhQhp/QRkw8ve64NrCpQ8kWtAF1M
Uu4AZQDOdYUQ66BGzvPenmhv9Z3R9DnxN93HebTQqBBWs+I0Pq2SARohCLfz1nc/USmIxjzjIjj9
9WuQTrAKkU0rkONDASIFMn/Ph2mnrIQk5MN8oIywDw/zD2l6OiK5bULshoJWd8r06p41yQBefIfO
XtNtvJMoLmlAzKMjPU+WjNzKW94G3g+HTSQkvQ9K0b1+ihLc1zTf2sd1LutyicR6YFxlBOX5+2OY
GNBfxw6p4JBx8eyih0MXwWSJY37NHsyeuotdmB7Hys76T7zrOjfCdBilTU9grFkJbo++6rlb5DL2
evocRQnnO/IIA8L51ptHl7JCbBjZ+tdH+BfImSwCA4gsvdQaBFl27tKv/UrNeoK91ZX1R+Av+eyd
FrGK9qNBgzKbEglnXoPmXfSOZQmV1itRQRBIKFo/TVt4EGacZsWTCwuq+ffA4d1bCqjndKHQhAbe
h07WrEJIS+Bgw15wBPGkj173OTgh3GHByuZonF1LC1dNumb2vjDG2eUxabrV9BPjp4TsM9mooz/K
WiwV5vkIaT7NGKwCCymVQBe3WqDWy0rAjaAv4FlSLb8z2D7E3IUNYcMVS4JWEUCSBY6t3NDHfCXI
kGYZN96LlsbtNOQkgtK32OhIgXlacdo9RS8uQoLABvghxiYfc/K9euejM/JQigaZldJW8RROMNdr
3t9FYuA3t7tOJbcPsQCgBXIlZdzJA/xD53aO/yAwHJIWPZ6kQkAhV9MUrfjblck1fLL5ZBKpq6a9
yW1GgiiF5zEhJMNZhIO6C3kyEicGvOg1sMF5LL6lHerLk66eZ3LxVRICxCu3NB5U/mrOCgIITdpV
RBJFzl63mIdjOiW+Q2hiel1jjg3njZO+/22PvnmE01jPXJTjKrzc9rmTvSVsO6BbDZ7IDbOTA7ve
sKn69+UmRdBAaNTBEDyXe4k+HcthLM1QtQfG//wbDBUaeKJjT/BBDlRAqs+2+WuwVSE/YocxKzAi
xSEioP5kG/0alG34rPa6mCXmO2k+n2OKTAdUC5kNMjRy36dPyGhzRtadNi6EOd1BgRUPOPYDWW/x
r52ZtKuOsMGBpc+CRfydbfi9ATf+JO78GXnwRB96F3Ve9KBhKBkvFtrPY8Ag7rLTn8EVxYNm21Ru
R5KBmFfh9Po0wwxEoCm0aKoMhZ0po94eVRfHL6/rd3g9kSmKc6THxdzeTrdLZrwwEFA5mEj3F9wj
WLb7DZH3RRm0coQIuwycSJKxoaoebtJfOMpV3+w2PTkiqhaz+NEIMqxWQ3mgY35ZcCjWRVOuzURn
9KQ6Z1DiCuBifoa8O2Det/abEgn1cxXwrldGKLI+bfVD3HgBqQX9tdRYgCGz85GdacIQDrnDQxO2
PcytIiurrNOzLBucPoQED5CInGRVMCAruPYSCz6kW98uoojBFn7ESbVoq0zth0U8uqFgxPUpQroN
RW4FgogkK4j8Af92tieqUHpsc0oKDAnuVALz/XG/w64oqpoquqrS4C7OqPZ3fzjVSNKRi/ZVRGhx
N840pwtO3OxSlMao3l4RgM7sFQcgT9Fwn99vKZO/Dvv+/i8CFaB8VA734wgPiDXJxVfkC9LwAD0+
Tq+zWoDskuvL0kn72YQt9vEKReW/+uJjkT4BRxSCSUDqs7FcD/5kT/N+HHcJ6eRxIuw95rMFsF+4
Qx6yCnagSvKRrxuvw7w1buK77uaZaoCADN6cWbC3R0RTvmWXRPJF5G0Y10A3MZ2nKDaEWVydHUCn
6/kyHbIkxewNF6Pc44pmGwU7iDfeN4qbgtZzoW1qsKG/w+lHilKS+x/DFm7a8GYzWaCk9tz5/LzN
dDjHu5hZJnmO1KcSG0MheJn+SznRs+v7aOB3atElWnSlXaYz8etsx8jFvYUrhcdOuMirl6Dl7TMH
1VluSf7moRIJ1CpyLSoVAB2XMqNanHcwnPL5y0410Cj9Aiwfrpr8qD3+GVosqtZ33illUxPk92fA
qXqRLC60AUwyfxBGA7U8+pteoP5TnX9Zahd1+TVhGQu6jVANvN0EqIYry4y6aEh12kD2EcKrpkjs
erm8FYk/RdFBLOVxMVY1gwB11T3AHsdBwDavxUZugjlBoLsmrRi9C8UpcG/ZJSxv5ACyeUsZweN0
iipcqKQ0xEItfPkJa5/cMsrXTfTPm3kONXEWklPdVEovq1ruaD5KeMQjmNn3X7oMQ8lL+x/82/hU
fKsbVnwA6OFgOyXA5zOPqmI1UQcHjZ2k5bbQJuZeifd+USjZnlP1ORH/dPBn7DNIXRoNJDUKCstR
NE/XqXye3k1szU0alPsn+fgejVvnLLJ4Rcm6axkyyj6MyYRQkoExxrmC4nFxn8pu89BQWyW2onk0
Xe4hwe8YxqPnHCtuXhe2PwhSHXc6T0h8YwMpEhzvCitAng58sRlcfxNzWjHQkezOUvkNdTEWfal2
AAFEloGiQUl56sX6FQc3pOGvvYty8EhMMXjpg74Q6yfUFp2+/QN2SnR+LFVM5oqHzHsDMpZozKDa
nQGjITMKPoi72drKOCuDUCf6u/Uz+qFOF0t07myEKxcYp+v8xBGk6ple6JgiUc6l+ZwnuahPiZpA
xOVB29fS9RmDq8Tq6UioaRK3XAdx+ya1WKxX34RBE5BmEAcUco9yw1p1zQdljOHu5UErUnOkPWGs
6llwUo88e3jQQ8EjH2rKhyDhRqDxzWPQJJnpaV2lClarZG1m4L4oSFoP6EW3qdXeYeTUeMBeKJ4c
ceFsi09qNmhCvxL68/uWWU38N2DSkqXIMABWkuA7LUflbLMEojKwnFH2085Yqkx0aEvRVmcgQXEz
nvQlhczpMJRnmiwBB+cOIWX9j6C6m6lmEMzWFEvKSAwXD5zeJV1j+0HB8gc+M5qTvcEoBX3haV8n
hfl9nDiTKlKyfGmxnG5ZnqRo8WcoPOdZCL9rao9UKv20ESWx7XmiHB/oOd7leVuKsdZuvlqhvhL7
PXkO5HxI4UcLGdIR8eWchNxi8rGaZD0njJgLFEnj0Foz0O1mNyz1/LJUvJP7TXt+r03AyMvKSY2J
sk+GXIv5jO/CZrWuds+Ay/RnEpvQmQWsXAAADIZBm01N4Q/yZTACK/+wSRrHK2ryTtin0/9WJLiV
oXCzl7tILd0MzhV1DCcDdjFC2VB6WAqWeq+KPY27DpZbZwgf/ENtHjVllCn+cOfiN9dv/f5v59Ns
cRsirebbYuzcwMQ0n/ghRn76QYullQIl3EQpeQ+2bhbAZjNmUuim2aqA/DWLqiUiGRkgu/nmUVQp
rAxSNWsF7cDbn9QN2lvSTDJ/VPuVbokAB7+YsjwaW2UyEV+7F+POCZdX4UqeAf0FLX6gUNKIeAQg
ZH6r3e6ddS4dWE4udD7wKI2RUXctvUvWDQVOONVwj0IAa1L8ru0tT25YuQWM3BF+28MSs6OX1/3j
U3GTHcVQL+Gyi53kYbLh3cUytezd0DRzsztkaDSoCmUBsaGP3siVgJ+JUcquADIqj9QQb29UGSSA
JaVuh0JJZy/uOOx8Y00r0qit7lrfHz5kaGEVZ+TdthyPcENJTqCN6AxKEaEysriGFcBkoPaoSIwU
d8LiXAXHUStgiJRMIhjhkv+cnErT6UikUAq+xVK9AwQnBxJOUtWB4e3WRYd7A7WvOOVrrXt/8m8P
Hm2NJw0/Yc9aD6flhsbXfPg8LNc8vsssJlTpIRdH3R4f3ovE7f6w2B59Pi4DxldOUJy7VZa8ne3m
HsdLQO5cI7JKPwTEHxiYF+gVHD1SOS0EWBaVheVFqB3aCikfBn7wOYsKfn5jIoXGbDCMw/llful8
nGH0sBGK+gpWSUb+BUKF+BT1bd6nMtC3l2P4EnNh1ec4edHVUGPdcY2KG7S26jmQjrIEGFmqde5D
2NhOEFCkQzRPrbaT4xpoOmDpAEQGPxD5wUy+EvqAOuvKmihmRMFO/Hrawn38T9GsC6A7kDOtTdUT
H9Kvly+DunU1ErXBWoAyZdf1/ddLeU7MZewq/O+xMn3c9KZi60ZmqKqYF9xKRP7MtAR+wM9IxUXP
+3bWwsOKG8WAD7eEsezeLQa3o1W3CO+lgIwoiDcrHmiZZ1r1IiKLPEj3QvcDjbkiFAjt/geFQdsR
olPG4SgxJQ0qxFMZAhW+FH39Mtj1o1bTKkpRdktmiHx+0quZcCngIwPHqjpCJShYARQggyzPmZt1
G3ss9i1/uSzJe2tR1ywD/1bGPZefpeMKZ3DBEktIKu8IglyEQ5DiFzNYTwk7a443EGxNvePGsxyg
h9R9lri770EpnNPw4OVCJ6CnzyCkvnaWNKr7kTSNpOwFQtFZSYTVJmOr9MDUE5RckrXVbzvznLIu
JIhNGfX+4LRgR92gMj2tSlR2iCO4wdtoUVviw/8Clc5DbcPRNzD7PVKk8+ois5kOYBx+I6fP2uvd
twRvOXBnXWeiug2ivPmPQ4ysiXyYGn4ZzP5bYIZx3RCV1zvV4f58rq8uHW1S5d+oH7OkY9fjNq+Q
2VIwwFdq4er1vSVLXE2E/H8fCBPXGiEmtLWYQYULOwINSnL57BgvDz8kty1ZGdwWC9X8eptVvBAY
L/L0BQjtp8xatJy/x18IvPGytQVeRV8sY++bjgVhyTqe/8pEUbTrzF6Z7GjXLkcRJioSTW1469d2
QRs4w5ZBwfo+HaoDKyapbrhf0hoUHcaK8ub/QytO5qwX3OsYORUF6EnzsTKZNyTvr9R/13+ZY7fd
WFGmlrdu5QJcMK15Yt6J568gdPsm+cqFtTxi3XcuFVhYASZX2KRZYWzPmM5/FkVV4/ceo3/9kI09
YJcADwB5rKsl80qj8Ame304YG3nIYongLm/jYYm/XhMrnAGkLFxMuVnCru7Zp8rMQBQUSvSgyBDU
ZgbwGZ7stubN0S98ooGRwk73Gbdzi1Stg7lF8nndw+OpXTiR+RzeuhXZMLPkqYcxQ1oTh3deVWdw
h5XWpFeYYb5UJlRsoZbB5nlP6N2AajRhbdNgtY7LP0ACjPoD0ySq8huobhlPtG+JcwOtJxiXQY1F
KOQ4CiaujyXP486ee3qgFemqy+o6lbBPVR/Us9VtocQTbYcUxsnzBjnyjmXoHyeqZKMJ0DF7AnBP
u/EymCWLrilteCo2lut7XOPVZWC5+Dh8IHK9kjTYXNal4aEXoa4mpCQspMAvUqiGUYDyfNYzezIr
HsvDoYdCN96tX65xPk/QgOulmX50T/wTih4yEq6OxBU1S0jbjsnPOdjCuWkA+KSyby46hyB4bdgS
75ibHG927WYAYZBN6uOzylnSnAAGMdAasqpKOh2dRtm6VHfTOOd5SE9/pwAqXxAiukodtMgmM7BU
o3QEXHuz9fZEpASyKxII9YOlja+QXQdVa4MqTPg0jSzzDq09LpWhIYYFrN/6ZUXx/TB9+X41EfGy
GJWiJCLnED4YdpDXhMQgcF6mlrviSD1yH1I1ldyvrnlUp2xmIYP6Zf0UxlUWxj07fdm/YuVej5nv
buyx3yrZtavNM16tfVuyMMtGIQW+yhUXpAOvhVyt2RHu+UNhYSXZP/bHik06NTtgaHJ01nCDz/Rj
m31snBtFWLHaR4FFRUg0ak8aNL5nMGnfj8VYjLTaGaRFMbSdbV3ZG9CJleJXsIePFOTzb1U31VKo
+E+QTnaV0ljz7Bib1uiA3b44I2P0GjhFXXyZwY5R/sLOxpNswaKgAt8/RhGD6SVEuwpgReS2L1rE
i7y4qVOIL3AtTJtg9lkw/JPgmigj0JOTR00xlknVEf8NtO/OYBixm7CSP87M1rR3QxA05MbpAzNm
mPdyPtWVafkD7iQnObwUILjr8wYL3w83UifIjQCIPfvd43zQ+/p4KQTymvTr5y6sXB7Z831o0Mfy
V6kw9X08a7GEUk2gpbWUni5Qf02E57J2ekmNW3x0qHVHXBL261clfzU0uMgcAZLiM7Gs+tBKUDGd
cQs2wYnSPBeMv6/Ndvb76AEAMkjDIX5Je29nvwyOYPUjCTzgkHKqQHECKDXvR5SfAFisMBLMtWvj
V92ojEFIAwCaTilMDHz+rTBHMeSlZiIWXTyh147Mo0ebamJIzbjwZpsAFUpcSElp6UzKpx/rOD6F
yolyGjgBuWnwsKR6EdYnnrUrq2sH2KmHsB50Dr+bjit+BS1G3h7BUDp0rKeHDIrazB57Yrz5obvm
pZ6/sVOsQtHmLqPA2DIQ0QjApzxLCLpHflqxVS3t/0DSFDktn3+HE2/SSdc5dK75wjNwxuJLLsay
Gq8uux1trgjpVcgFNolczGkRsjNSHrQiCKkt15/MJZ7lrPvReKpOWk4UJxRmCNLVNBMwg9n0glSC
bfL+JuyXsG0UNCinteP+gCcuxkh5Nd5XlblA9r943nFtldXkB3eE4Z6IzrNMkr8F3ckMUu6fiyWE
SXjNDc4/DWqwldSHEcEBEYGfb2Cq12JrLFEl8MvC7xaOF1jTENp6tseEYXn/5pylXifG6ZG9cu9e
65kU8kzVuw8SrhCkhI1Efv5/wXFCOTL9/02ccetUr9qPrWkvNtCwbJVkn6t+5jMpqPmW2NZP1s8c
6z0ORjy2i2RsxT08PCNXtF9f0hRUFu1PtSWnQCLVwMJfCVDgp5/rBiXhh1O67FLSBc7vNaM4TyMm
lyeRNGW5M5z5/9BI6ikPAPsI6vXPS79tLAPhRL5g7Q2JzIo7viuzAQx4hTrKa7d6xmarvQL+Ftfz
hK347ZGuOQnuHiIVNX5w6omTWt4G3YfJw2Dhmt19xerRNHbARGLkwThfYZwPY+X80iUsgcY0FvyK
IYUkk+SUSbZl1+g/1EbgRvUap9iYDsVpjWAl7hBT+4O/ZQHFcZ/r//rHcc73nTHXS7TKtmWsH5td
bTJcekT6b3qWLcxjmfxwCsEgpECwoKWUpqW/x3o4Jth+XrEegf35pnt2meZlAhtYi92HGymRomF4
rOd0hkjBNt/hukG1jrrow1JsoDnAwzqRemuEabP9BCgYsQhcvPeEtYXSnOPT6T6RQzOouMEWL+pJ
IlEOON4mWRhDD0cqHMeCU+N6W500sVxF29qCuaSShk2kfJvQz7Y4vl0RknAEZXgq6DdDCuHEYgDD
N7/26xWE/7d1jK+5yK3ATijz1qb7A+fppsGzJpYdxhzFGjNIi4vInuNrZwTqpmvjRgv6uZoPR0KC
hWwpPLofsgfLb8uwv9Z8MpFy2LBnCKEjiiTL7K5Kj1kzF3IGQDa6ry7YKxiRVV/hAREpdKgjgGma
CBEhi/pO3XNZDB/+0wtdctYFb2ZDG/RjlEXzkvtN/zGw0MVc5iRfJX3ehI/B+44W/NDG7eBJaiDs
NfQQLeUZLZLrfyqpPG2WKjqojBhEkmmGmYruOrFabJ6kn643a8Tsnm6khwAADx5Bm25N4Q/yZTAC
I//Uu2kRPupxteXDBhrWN1+gdpvAzTRxzGEIwISQxsCKxsyS6JNkFkQWh85+fd/9dLDcr3gKFM+n
8NobB2sjjxeuIQyTOfYNX1bsNbgrzR4UzzEN6sGAp6W+w8XGQbKN7KaoAblHMVjb5f9sEOf+qnO9
2+98QwIZtiCaRDp9hV0DBjuuB6LhHPB0k2KjR7gfIBG0if0rbIPusmKFwPVK2zLOzxZ4Ix9J5Iw2
aZclLSUnxCGS5+XckPP9ZnIvTu928hqEYMomp2kZSoBCkoz2/k6gHrqjZQ6N82TK+0aF5oiAHBbL
3RWxfJ2G0foe32UYmzDEuddvLLDIg+ylN6h4dPpenjohWQKsoaIKzxTsoSNQztBLVBV3xnJXnoJY
Zvq/O9cM8EhsZJerfxqDjInuxRHiX5kk/SulZNx+Ykzkw66jD92fO15SgNOGb6+dfA0P8WBXmS2y
n9uC5CPLeQzeRzkhtMlTluW7GbTgaa4gxVzyxecCCZpBlpoIxwll0dwZJ91kqVpjswYtYlp3hKD7
O2Qvs13755At4MUu8t0ZvGFiS3mp4dcQm/lZBUZY005ozMPQ/6f6cfsbsjD9LpeGJRm1w+gku9WN
qQgbrY6FkOW8M9bwyNh5YtfJCCWtj/ta//1xrGwcLLlWyjhKdxPmglTCN+lzK2MI6RgnM3xY4Y1f
encdWwK64KM8KFxksGF4Zs9cM3kZqZZ3F1eddXTJA1te3Ik5FzxpfOgXXESMldwFy4pRCxulh+dj
bvGtrkE1kHhCHdIQSIILQ9OZTlamoHSsiSz4pe7LU3J27qvsC3lHyu2R3IW6IjCmWeZ1Gg+wMEdX
Rs2MCCIAcf0XLLoCvu97HH3QDs9vEdDBlmoDji0SDhilF0PPuvIFIDyGof8F0SJbospS3IJBCKc2
ucd9ELVtI4KGaq3BTj0g04Qoa1Gbd8ZFNj4F6Y7zaTyCxirac31pmL7F6ctugNeptsgRbB5Lv+Ts
EFkxU80vXMPpjpqNA7yierv8B4YQkaAyTGRl9pGmmhN0hFPKAdsAhymW53bBfL5Uo6RuZuZwvTeJ
OUgPL24TBNTor2ssP3otShFTKUqWyzb3ffpVxSY44BH4E9gqxroAEKNspbTINA0R81T5tvB6f300
bNQo0YWj2hm7rSwH/SZ4H7k5RuwffdPzmAOPydvkK6/bYb12lx9YUiazZ+ZVAaCc+HMVM+TsqCDU
XB7ypDq08L6TUb1AfGMT5ypSxptztNezM9yBoIp4YMYLsOKlC5n0I3pNgXiOZn3XSIBAG0Mr8YZR
J0/2R6HM+S/1l0vz6qTXbytgTHWs8p83QepdzotSfL7fWzLGgpgjzFVgynMMvTvPh3rStOBN+Lf9
cW9jhxJkt4q9igPHlC1W6jPhf/eBj+KKi35/2G+vF3U//GVMi8IdagTvOgo4tySjZuGDAGev+2iz
hmiCEAZjMV4wijs0Bj8yN9NPPdgPhD4WZBlrmsgxiJsSuNWa4whXP3iqzNinNTObV1HHmUKFvxt0
FCFOkUzaR9qCYyV8d/vx5vHWJiB59riAwUskytSCjX/tDddhZSA3BrpWQlGcG6ofdh/fFAhrn/VJ
q6inDgBkuQIzEPTtaGjixtYbVAJfIqOOXU0JmYgZiugmnhHL9ekYMefebG9R+LJUf2JRRRsxRGWh
L704OGwZHI7WUhZ8CyluHPOEEMZZvbCG6E1Cw55sp8j8MMDZgj8jjcDv9Fq3zOvee0tsh4PuBLWY
Xb+h+oepKCQKlS5cxP+kfHj3bi7Jj3ErqIwOczxK6oeW39BJhZVVG98WZW55BccJnW1rvadGnpTZ
OjgzEDZrDPcNXrOzWWaMlbLbHC83jxnkqjmb6zGfwUL7Zh4wiLD1vxGrtJ3A3NdVUaSJvmy+hs8I
hSh9/qJ/ffLTe2NHLlYnDdYY1wdD9UasNnDKBJztBv+dHZndIvU0J+YyPkwASFPiCm5WwFwhRulH
XUlBTVj/9MSP6idsavmQDpugrQI4GZMT08EB3LtDm8wGg49YxzIVDjyCdRtfE5Qzn5lZ2e0d6Yda
dOzfWD+jRAxCrW3Vx4D6K6am4GSUJ8KaHthB/p8KZBITfJUlimGBx2DfTZMf6dsQRh0M9rZDnlH7
fVvRKpb+a/XPGOOI1dMp+xYMmcxTfvxQJQfUjNieYvhJNVmrymF0AYfdgSoBFHE/inj2NWSg4OSk
GnL42EgIswDLxJW0JtSyYQIlb7lMvtJw2hHLkz3NV+NvphFMl/dKT/tM4gY1SW2r5nlS00Z2W5PT
xB6ZpzTM4a8Lu9SGXK6ubIl/wE+d33DcF/CDYJoqZWV+8k14y/ODEnlOBtrvVvo+lVucx4cKZKwp
utPvsq4jwUIYTaIcH8VTTPtCSj4EHGwp9L/ggC9JqTBD1SobQR1rk/zByBoAcFhooD+6aj8RtWOf
9JQtMMbiG7Wt33UcywYfVn53HpTKnlKOt2de0mmAMVR094nNkhjr3H+4WtribP6Dxsq0Etu0fXrU
WT1yeLDmKJZ/RqwIGxp3EsA4pZLLNDvPIg63hqc+9uRWCZvyP3A0q1tRTzUDpJsfj++5sjllOB7o
xKXjUWXZMQC6pm6lAaH9NQ409AeHu0DXppSmicb7ogBc89oluD/8tYvHyQe3ylsBWuzfESIWfrfJ
fkleCUReAHNacwrBHnlOZ5wNjBFsd3OIKzgc2MxgxGYC8inynEQPP4Up4mZve2eI6SI4+pfzXGZP
XiZYNKt4J3pVCNp58IR+rc8XQyQQaHc5DW8Gk9wYrxJI2RZ621d10FoZRxO50Qakn0WKnkWYOZcx
7IqeBX3xXfaR+2rLe7CwWmrJv2Vg2eaxdk5jFyYytwrKTkG6jd2uKjONWEE0PIeDaTb19muFr/FC
RM/Ce289Duw/TLGMUHq9qBW5HA9Do5nJ2FvRx8WpnUX2UWjimXv7zLtNOw3UmWuBh16u2zk80YNG
gaCN3lj+Hg7nvg9XxtJqqqtt3OOG+JyhwVLHuR662Eg75YhdrQvKQpHiBlGEw2K5WUsAe744OrDq
ft+/h6Kz22R1hvzYykx6IMphxURZ6tvfrIlA16NkkEEwTrsQFxWwPzDHPNXZH6DFTpUjATNcPK2q
idTpQQjrBYeyGEQz+nnMkVLfz4dinkXFcaTmf93+o5u+1+R8tnHD/Fpa52bCL37HEhVNAKRre6vh
pPa6A2dQzgXPjQfB+gwJDGfs7JB1aMYc7eq1yM2sXRosX43hrbqzMMzJytfkK5thlt0hJq5E4gjk
X3zMZgKP00NFSg/3Rys45XY9tMHOfgUNiSvaNthaM4Q6x6PnpMxyy0HZ43mT6VH82mgD+T+gBpz2
wltjA070T4r8BycObyp+SPHuVy5G22feHpx8BiUFUAf506P5Za9jnn1m7dyJwwTONLBrGfQiA7fn
9jn0T9E2W9DzKhJ1BUEHRpTgxrVCGDYJcfPgZtBk8wuMw6/31IyMxz7kVgBy362rDjk1dW7QY0X8
zR8b8F88Nx67DU1ctu4pxK+uBJSYlQrU8hcZS//zcX88z8RMmxIC+k8WF70r7LwS5LYwDHO47cTt
j1ZU+7/g8jjk7KQtpryj2VK4Vgm4Mno+x45V+S9HmJ17IWCpRLDXsA8rwMXZDJHmGQPAfqtjwcVb
1lU/M6pVh3tFHZhOgI5bE1Vm4Jrb8gbV78tNd8Z+H3GZ0+AJZtFcv11AkJ5emjmg6zyIzM/cnE3G
lygSJemFvXYaou1BGoda34onVUkwJckXgX74V2uHQOuZob+J4JHrRvRlmXH6YFYgwwWc+ijUgg4+
8t8VcqfqCAL/jpkpyWepV6m7BxNI8sIF3pQ3tvSA3rH9G01Wz7KVtj2g2hB99vmMoZpoXx3RmYzT
wP7hwWajHYf5IbCOCnZB9qLSU90yyZPh6QA2gyx3EOyojgJzX94fclvQ7bhuX4nlEKCfuOO0uzSE
3QWr9NYgpjDkqmrqUZr0mRFi6OuPdEglPMNga1cxkPlvX2ZshaJDUfQCoIulAqPAlYxBrmGrEpkh
bC3qNZrIJYVN6Bem4oF1+QUDFNXoZbbtM8ea0ITpfvcMIeLN0rhGr70otvlSE9+E7XPCtbGAZKqa
OjVyzsSa4qXADq5l08VjNQJa1LenzpAlPMLnTJPBYMFLPucOKQw/B8ca3w4UAUEprT9qwJlEuk9o
8beV2qQ6dwqjd2iNFro75d9LIFkCajETG4khKIdCNQoiivv07uolur/6O8WlMSfpu2cGFVaxjJA6
WB/NFqRzbEEhJ+EypW1D+ZOhOd7mHghWtYvnfQj4GGK/gXXsCfBShGoM8rXuT/DoqVWltii52A5Z
iz0sQ+OAADOM3gELQkovewT1fO/H3cZKr/Ux2XjiSFzwYp7kKRvxwC89aV9YrKFqlUUkrbzNE/Wf
UCWZOTCXSQn7e19nZw3OjWen+03LupUnwxV7fccYjEXDO6oiBC7joRQUAaDL+9H93u4hEQmQbLVj
pAoX8kj/sAnPSDFNJb35b7Ic6326K47Yqmcj3+4/poCfArHQfOScch0HlQxDidRO3A8gRqApvyjj
qyYjWsEEgt6kRfur6gWezPuSuhozPsd0iqm1X5P94CCvDGwZ6Adps90u8YiUtP/HD6ToJXdlXf2J
DTtC0wd0t7x3VFaPHFyd13sOkxIi1z+1zFgKs7XG1M6TOE4FWJsta3kXVOLQDL5ZTGqae0u7WLBe
ht9FBoPrbP0Y+Rv51uq+XM6MI51TJddun9sXJygE8j8yTTH0sXLczm7+oz+cKq9Y0oy/UnTU5UPP
ThzeZfgxrrQ1vqportCedT9IryavLHh9hybE0xZthMKxXG4k6ttE+8L5le3M6ZWsNlsybjcV3GAj
YqPUqihjeE0QX+jm0rqGNt1To9GPJYPPHbusAeS89nY/mtt0M1BtGWmg5SEwpb35yTB6swb5yEHl
HofrbilbrlbyBeM9Cr0IO29NYg/ezK4ti0g4sErdEtWTmxyuZoYKRYx8kPbunv172GzVCzcZn6Ow
dIXcPtpBpZJ0eOFi5U9XIu9zmLfsEcP6ireI7uJd2OPuBV5Sv8cj7et59CANoGPvWcBSTHL7G5og
Fifk7WmWg767qvYku9TKFraO9sPqbwbj6NRs+aVLftpjt650/IhD3PEAAA3EQZuPTeEP8mUwA/+a
StqAaN3g9O+0pVEpKGIO69sFqB+NQrGamKLqakt0w2tFI11lPN3ycSEcoWADwnR84ZkYLZtz8m7S
nHjp0MkWy7WvC9kPCI5Ukxo0QPEB3u1PqC0ytHwasuD1Y5zKU7DpyUl3IZnq0U6jRII9jY8neoTP
rkaLDEFvRy0r9zF9lmbsasZc/LRsuPMKCKa5jYyP0Btpf6viQ+cGfg1/MAhgdarfLKmnGNn3uess
qV6ruIovmYWqtQ6HN26mrWG+351HLOHZdmvCqTbjHCn+kiGabCQPmefxYn4gVCOuaSVxPcaEfmrP
BD94eysPV9ftkwW+Gk0s+Ww5sfBYJqXSEUebRXvxKJBM8MueCvwC/y6rFfJV8ppWoouq7TRpF/fp
zJImNok8ZWtK85VGGhoHdlYD5/lKJepilz2nz/2aGGn4T8wpawhngXjlmlJlYGLqiV2GhEoikgRz
gD3fLTz5UP0EjmROehUI62Ii6fetC1b3NXC3QMuKz0rzsQNE0E8hbngor6rSt++wrC26S4rXFhSk
UMcfySODIJ4SIP22zoLo1uVE9HSkICIgPzLF0UrNdWRq1HBZcB92K4DJBGF/FdNGH6Qaq/4UqzQr
xxsuv7DY/EHfJOFjxPO6fWLLPyoT//aEZqBdobUyLNwzrOuZvoP9cuA7bo+Av/4ERlb8UcmnJR09
G4GRymTQy+KmGsY0oooa7HIZKmkqPtAKxjBN6WJsPJ2D7sCxXFnPkG7/fr+cnVVZxlKalHhJTwJq
lTSv3YYC3dHu/gRTDq2NV4nhBUVczuiR1HvK3bGzrC96vXGdlSrrUsGrh6ZYG1oVXU0daxeimq/p
m+SarpMp50bH0VRoRvlt5aQ2kabjTpMbjhrbDIJLOLq2JHRxu796yycItmXF62JHhOFIYfDL5p6/
6tPCn2Ke+RGVaSK2Irprmtg2N8v0w1BNwf2F/FK1qARdmhiO6nCKPkTkdu64B2COAQXIqbSpdhbk
Y6VxP/ximP5spXptsiTZLoKjJINKBD992zI49O6gmIRAwcgrUNe27oSzMpuZfmwe2c2JfunTnNxS
wLwzcjXyE/h4Wsce32kjWGFpdfJjGjU8h2UlaNlGO4ICZ96TH6yF3yDycYcQu4ZxGDA35jCWVJ71
bN24AYMMhXJ0nNrP7k+UpFxy4SucuezPtG8nAytvYiKMyp/09iSLvzFYXPKEXIh6880fyy5H2ACX
JN0EFqYwwcZCcAeL67D47p/lXoCEcr5twx2Z5Q0u8Yl08DyyDL7rOaKABX+UDrxyd3sQjvhlWASF
M44+bgqpQjAl8cjrfdIBpII9L5J6y+jpcRRhBBYkxkW1gPzYd4lUoclC35RHiF6Hg4tn398ziDTe
oq0SwCx7CDYdseid48sKSh+ocKh1PZTIWoxZIkV1Q6On945/Dg9wbW+csIOwcmKyy5u2/4r3hGTb
ggHcUO38Le5j45jaObi8hqrgVsszUKyXmIHN/GIKdAAWhWW+SWeNF6ewiGZZThfrbChZDuH72Z8y
7pCxGwkop3zHvk/VSq4JD+os/1jBRgLUfyNt59aGDjUnTfcFDlThdEx9wrjboPtKCTnSC524EdxW
DPv5SmLVwIpdynsJpRdz3Y3xSgzbxRXoiayyjFCOfqS3EDDFHt7PUf5hb2hDwzEnxLyF0z+Rb4j0
R0ZxW3Fjp7bLKRSTap4nIyk3lCh9LecbPMAUDDBMtPaG1QBBEDwo4GG7StlEblI14m63M9PXpw/n
4W6Us9Rtdg2/81jZUAZsaT5l4oNkTcq/uBytl43WOmfoI54IiI8q+Uy/yTwdyUoiHcsGWmh2/o03
jJ/MyeWJhnDpBvR5omz9rdVV4NM6oRmyfkiILaHCvECR9dd8JsUEs5t124ywRrkEGV98hItbIL8/
iax/aE8Q8Znqy1Jc0MRpW/YtS0xOig0/cMeYKBnKhekXhr59/zc3gDU6B5CTwfQOy1i3TbaStLoa
I1ifu49UZ6gZcf/kiWlMigV5/d/6o2V3wskpqxpitSH2BUdUtjfpQZpLIXnkmavIvySmUpiQ7lm0
vvB6XU0YaEaDZ9khVU9ovTaRsHMz4DtByY9G2GZsEqovGqQtgmX2dsWUFsPmfDex4nBwP2WB/uyW
eGlh0o2mEvs7rMEGTC7AXLVpSx88O7EOb19mXj3MVJ1UV1mZdqoSWaihhsP7SfcYKN3NZhjMCgHK
B/qfDHbXqxG05OAqohdhac1qYOVuTD2YgUWunZXJdfunR+8rcS65+iNmnEaqwA1q/+flr5Smh70P
RUXPOkvpCGsdIiXkSfXt3s/Mb5lF0lquDZp1+X8d2mgqgSxE//dLj4or+MqhFY2TyxqxXb1sDQ30
TrmXI9wFqmTM9jFUKh8fnwRJXzff6rcGuTjFyEkAOlj2bU6Wuot83n1S5Yq+nH9gjVYIZI3oqG0i
FwBaRnF+feCs2wGRckTE6xLuxDcu7d+W4pGvl+OLF0gzoIVaYWdJ0WyE1pKhT9t2QO+uwhTE1LW5
rQoWAHFmzxiGf8zldQOisAdhIJsBYMWbI8FC9h7l2iluQkWzY6kzyOqLqXNzYodKspnZGMOVQzkk
iU3DiyCOXUgKl7ka4cFPj0EIojyAAX/CRxJLJ8z0Smy+b87G15kZDBcHLDzFQ7weHewZa7W/+IXQ
YdutOAq3DWV7na4eKEqUcVgNuPaY4RStIvhtgqjchj3VsM06FbVJH8xJ5EaE1MO3/TnYKha5E5N8
pZT08kVEBqRottyYGz2Pq7A067jh0kMc+ZDApI/1vbkSBhNcma2lP6KsjUWqlNoqtugqB+dazNog
/nzSZKuxRFlPsiePAQ8+gqRPpp9eDG9ichKd69mQoPD1wAiqcU52zW6e50x1os8or7iFSLMMrJTx
Yf2nbLkPKcqOZ0ey9qQZ17M9tmRteXXqxZgex1aLBq5pmE/e0oe7tblKlNDkR7w/El9sbM5geRvv
jvwLyH+90pBElua8s3on41TjFv6VsIBDAiK3l/Zu1I8veqC5HmmI8z1N77grHbLVQln6LCRwzC9+
M5H7vaz+cHWXjs4FO6paHD5+Rl5E12+R39qKNapP/umAGx0Mcsg0NoeLgk6M/oU+BTg2uj66ejSV
ngwA/7q8ybFp8VF+QUkk60nDTwh1lPNboB+UgQAUJcBQbozM2wdvo4t0l0zfEkwCJejXPJu4CZ+3
xPrz373tTCD0FbDtreus8zOZwR+73RVkVkjmH28iL3lIUa2oJyMtIJKdYENF5l+XQTgS0L5FErA+
9Nr/Y/iMsi6dlXlNpAx7SMDJa90noTpzK6IhBMxPev0miZ5Jm4XIsVgrkzRk7Q2K/C9DVWuqzgAY
vNnzEZ1EZtkITD9sAHBv0UqMb86BA3iQ89eNNDFGzz/GeXkoM1XEjthBfTlyTsE2qdboCWD/y32H
GnclXYRqw7TLXJoxRBydp3gYwmsfQQW+t7H58PML+3qi0RoDEuiQUyet4UEYz1YtYk1Cl84uV4Ni
FgbCkPY1BOI24WVtYfZIP91DWgfSso3Sp94ciSm8N3FJYaOZWpKxu9JiMT/RKMCvrLoqTTeq8yad
fqYV3H1VH7dO3fG01GzKChpMZfqkvEwb6Y0OPwqE2zWxxpmvkPeif093ItednakeZEwThlFlF7Gv
a+hOMW3njD4WsCAf90YzHjgviBYg6Cdz3Iw+MH+DWRhBkDjoH/aDJIT/dpBWAi2OWkL4mUuGZ4WA
gTIpIiwB64BkEa7aGd8g4iAbhLmfx53OHTXyXrAN49CVN4JdPRixtMRoXUrIrFT3HB8dqASucZjC
dotlXmNqTLwyU4IOx+vMbeawMLBNaxnd+/zADaWknk6wwI9F2xs7GLGjuxGH6OuqRkmeJhaVozTg
vvwFikMlONpR1zYk/W4ox7tukLLItneQuXrXk2pUGvJ5ZeQLr/lPrOy2sjQl1ryiPJKYF4wuabDk
RR5pTF9U33xfrk+2NNlGGtOLdc1YaHgWpiYxkbPpIwHhPwZZWyp1xMagrLunB7O+Flh6Ex25zd/+
3zJ3QsEwsI+WGunpoIDQ2t2l0H8r7tkjx5KEXAZNB7Szokbay2o1D31teiAp1a65ZN1VXagqud/o
mObsOfSBZhVkhRygq8fz0l/ITlUVPerA2N1Qt3i0cYA9uJQauO1LN9R2vyP/kbANsV7hfPm5VDCP
DU7jJf9HIXJPTMz1i5hmgDbrFisv+OkVQ5y/SuZWmkcjuuyGQ0BcA7kzB9A4sGxkY8ONypyS88g9
O/vHKliiFxC2f4UNwpfz6Z3E6pCwA51z5WgrDBFWSxQnZm3u8ieEMwidfbgSptIuWy+i0YrNC2md
w9EaZtmnBFady8NnTUUhnhUztQFg5btnJP0qGCMXsZ852qOgGRqnDqAxGzACKV20fLVwGGHmy0by
yf8ZX6U7EB6HXWpi2J12qkMF0updRgRaDDXZFJ3Lewy2+TqK4gck5DckXt9KyuCZoZD385wPG2tQ
rpooO9MuzqKkI5hRgp3nU0jU/cUiWogH3uJm9zgX4i+RzSkCVV59AlhFKBbWJncBbZJMzLtR4BdE
mTF8EoWuJnf9hRW6L9zJTDwR5poOnWt0YZTXq3kt2ZTBxRKg8aCvSpHq1cbLrSmZ66lr7h5d3QPw
bEzD0cK/p02WrS7JV3QQ57eirV6y8NrdECYvVfaqsBovFNEAAASDQZuwTeEP8mUwAiv/q3RjOegM
L5W9uxyjx2hP/ezp8H4E2My/9hDlm1RlVXcmqWv35xXTM6ZB1DRCaDSR0R682RSrVfgnvnfp29HK
9ky8I3KTDoK9JjN5DSf37cKGySGXYPJDPnOe9kRu5mh9Ud7aE4bRWVGIGnXXRnOSWeKpToBOayIi
lt0haML46N07vF/tKeyhvarxjr2Z25+3BxDLpSMdtasC+j8K7cPH6NZXEa+BjPZO6zPDK3DAMso0
4Fz9INVP6qZGNn2PC5U1XwqjdubyZoPjWCdYTttfT6CM17m5JM4i0EBczxQo7O+gPEdSOVQCN+xe
+1usTrVjahHSqpV9DTFFOcEDZ0m5PL9rNG3PQysZS4e6BYQ+MpBjBZumrNrBJksxrIfv3n46aB5O
GWQDQNlmNxR5l9zCutlayvAgxUxc9X0uka43L40kLYuz5INGPrddGsP7HwfsrkhMQXXk6Ej2nbfB
OF5qu20M7WMbLQVuJ+NJuRaCdGHVeUx6eN/oGUb9kZNQLSP5IKzBo3KLGB294T9v9CjMC0Yr8+IS
Gud7tGYfv+fszIxZFFSCwLW7nMJn0TdS84OthtCI+8Gxo5kwX3jRalaTFTGTsnD+mrYFDE4Tb19L
TjGko6v0+X3DNh8fzjpDCN67SnZY0jFuDyCU3RsXVcejxpFjp1dcpmLcqIGrBukwSq6GAfF4gC4m
6csZyOlwzehhoal4xco6WeyqvLluSb8Y8ETuZ90WAIO/FfT0sxsSlnt0t3dhC+4yZTUbzXtk5RWu
woShQDYwqXKNlNEJRGydpS4jZu6nQhuVxtKv+FB/vNvCiJBUbixpP9L0FqCwzmhY837nHx157ZJM
abdTvR3JnEAAn32cZWCQmMSclEUw2apfJuQdp/KNz8VzFcXYBnY+npH3fV5KEgonQyS20OGqmSAZ
PDl/R/lwaOSYXbbjcK6VWESyHs5kmp0hhf46NaPDc5qut2VYBNqz4vtWh75Bn0QX3KX7/jSXiJjW
EhAmCXAglozKTW7yU9ANZaBCbV6/lfgQAg5b7OVSElPYwLVo1wIKuEQ1QuPXqyixN76c/ZwAMGtb
ZcCYbRay23gEtb+eNlJh8g6ZEjIoMQbNm9sjC315do8fy1UXlp6vGXszB+pFvZiDcOkHlgS9vu9E
j29LzNwxO8xmVuo0yynrCixbf4+EnnHK9teuvwd5x6mVnC3ipFtkFeVvPou5/XUgomxe64oaLpmP
rKqWACm1OYki/yvQhrx3elgQ/PkoLGg3il1VObWYY1MZYYBV9914J7LtMvGZRqo0yRvxTf6DRv5L
IcXaBV36QIiANb2cJDzGGPLcRdMv7i/fzFCELn3TcqP6Y3CoMZlDhmNmGLpFLhz449smy5Di+fsi
aQrp7OB4As20N/6EhUoH5SgTnkg5lYzzppknV+8q92AY+ll7PcFcZIJOFhIQo8434VzXlPY3TyyT
r+hEfE/e5kwlqBy8CoPwcr8aTq108fsPJYVE6sliHEQw86efioztMmxlE+xtWmq/urtCO/ugAAAQ
pUGb0U3hD/JlMAP/mn2ycMRnHH1whqKesMMURhmx/mhXGcr9bwAjQlMpVR7mF3v2/n0vxXF9n6l0
vcVuvGSeh0AvNc4c2neCd5qACsdyYlRPc0yCUw40YEFw19Q8PVXczIfzn8Ic8OAeLhOMJA25zPyE
qPFEXLhS1T84a2iHWTw27KT6Hxrn1X7mMGxvRmaRzCI+BI4Iv4a1HA+vKN1GsnmA6kwJr+tSl3zD
FpPwBZATpvG45hbq+W06zVnIFr5MMTWr2qYebv/VXkbaVhG281FO85cgRc7MvtUMfPHQjivQd+5G
GBoTaQ06y3nbc/YvpdEFkdgzmxCPfzZNYzl5Mut9lzwkht4E2a9r530ys9N69XyDfTpXD8V48RQk
/hWyY57nkI0f/6WVg7/QnU0yyMQVXJp7+eXPsirBB6HaZYnou+ClqTbJXdKksa4j1LwQXGgaLV06
i3JVqF+DOZj6ebrC2kYdABT84QUybfFAeQYnCpe8pgO1SbCZVA3v3tP6nZTD4Q2YPT1WpDvbRPkN
L+3LdH/Dd/JyQPmAlb3oLEf2A012SGgzVcauxOxz4X4SNfnNCquM7CEYJI7Vuj5/GkByGJaSzAiv
MTtjuuoToapdrSaaFckeYXSKIKVQcdGDMbzQ+b+fFVpggmUbOTKLEoWEH/Xv1Gh+dpeGmdv9HjS3
EVEPW3Cl3t+7tgeUPtYE6ijuAB8SMIjIXgeUypmCqmO75bMPthx9S3zeG2jYxDByKddSsuq38ORG
uqFlMqMm9UjgCUDjblOsUuBmxXpU7/SDfvHQivhnUVzCCxTl95yAea+jsQBz55v4ILmUw57Y0mF0
w4ujpoCV+CIJvjv4vFB4UtbOdopj4KQ0sMb85QpYGAyTQjn5XUas02Z2fDuLKhaAv/aWzLqYPRcu
Y2ePAupzxDLaqy9VVHGsrCOEGONXwiVqPIa8eMrTJKlEKzMy8KulRKG8tQWnxenPksHwoAg1O9iX
izXJrYnAXcW+/VoRV6xhwO35N8L/euOPO29Aq/lrxyh/FxfhXEvA6Kn5fhT5NiO2EtNfvElGiaxT
+TQAldPDr1bVcwTgpB5J2Xrsi6/7tkWnBqL4x+Fxnp9EW+EiqJQx4oA5OLXC8HSidMPUDb1zV6jY
JWvdi8XQxpLoowHFqZeK8T0vdmwa+n91AOwikq2YBSqKIPHAcjvKFZlThXV5AXGuTjQjN8AJ8pub
jeMdm8CKkfVfD/N/zhsT+a3z3Ab/HyiFvrjN8Irqp/ActiYw7WXHMVzFimNO9LL73EKWDSrZlhdh
2jxNYdibG7IkCpk97cBrcjtpGGztj/q+L3Gr+rpNl1wXWNZvTJ6T5uQzFaMcXouBLRbQMlwIKZTf
xwyk69gKFd6yDucGVJaVxz1bsAFR5yf/6bv9AYO7eXJ4hyK70La4XyorKZrZMDD3kU5WewdBIG6r
NDipHNtyEFF0Fq/eluZPgevW+ihor3DQnw0rX2Ds3bPNb2byeM8aMzKy7hy0gP8UlzirJBzL5SsM
0Uo388T5DgR2ACTLh2l8UMb25fiEic0Bd7qeJ31cpx1bu/B3WYmg8x9chprCvjkMoFLeC3vzVPE6
rYijo0mR9CcjP/P+OxlDAX/uXGEJFOTGSLNTCHDQ5K6RSBVllJZU4hkxaaGLU0KNJlVu5SptKWmG
zKydOxxmQptviNrQ4pOyndt1oqJKiIr5bm+H8b3B9fe9cnkKNyfrY/nqxRDSpw3ircuC767GAzxL
IZgF1tJZKPKUFIS/n7Oz9ZnVctObKAdwWzk8MM0mKz0cW9jaNJ4TIGxbaGLd/x5c2dhkNJmI6F1t
8TbQulGWelqrgeRvCJiiCcL+A4pNeZxHnTREUePo1xxfFL4aXqhaBQSHppLfJ++giP14FwszKJZz
qeHpQ6xkMDGSbNTOckLWQihbPTmdXunThshS8/fgOXJ7ZoaNJslkOND6iy7Y64rU+7RVnRSPClcI
g4MI+JOV/SKxxpDT55OLf1pxWnssg5Kf/hGtwXklJVMugPxzCEUBSLhJ2GvOhFA52GcY9YA8gJOs
hOq+wr1/gr1eFM0wQ7Z/lc9dnIhq7qt4QwjM/kv6NpX3LKNXExDuNeaaFiCuoYknlrreEKDGcA83
VzuyoH64cZpM1thREDfNxH1F9Za7TLWZNR5msTHDefYPE+k3Zn8HdkTvs9wgk9rLBGtYqoEWYjFn
vODdEKFQ/WhndhiVcqte9G2yAZmBRpcA0qD4tzouUTZmY3GZvAM9BvLxMzmShdxWYA4rjz5NK6X+
awLbBSXTKwbven3708b85pGNOA0agUCzL5GtSZx7yDwLXWxjLWBgaskcv/EWqHOY0N/xjZ6Ft0MK
EaXb9ZAlA8VtjsVDcJzVzX3Y4mElUWr5K3/fzsvbGb/O1HZoF7eqkprFjrjTzydoY5nYJoNr4GpE
LV8/b0TQfBwnMrU9yQyxRBQt3cahHmSSszZ0Df6C4RyWp+h/lgt+y1G2dm5/tzSdd5PejG5nxMJS
Di/lMuPO38cHpYCJbjQ/1FF0H7EVIZkZpSUOHHz5m08kFieJG3MGmkvrNZC3dq838xlzWomxchex
zldG4Bo2+E+mQ/6E6J8kcTZpu7auZU3zW+pu/ABhF5RFe1D1vEPiWt9t8XiKlKiTODf1Gz2cepRk
HUCWgWfXcfWD74tB9oivfQ9urTS5b7p+ZCPsj/P1N7XNftGnJd0Xq9ChFuhulhzRco6s08/VderK
4/5V9TzEFaLDWRZp6l1Q4Vgi+R9N6NfGGXjCRtIDdWLqQip2HUnkN9pQ2vdEHHJn6p2z6avpi6O8
8xbI7XEGlofawxDnDgH+ieVdhpnFyk/Sd64iLlrWNTG0mP2ojBY444cqnggPwN1EkRiyIYQfSb5V
XsOeOuYPswvX0xFNVe86v4fR8q+yCzUv4/8e9jlUx6s+xI+Y8+6+sYF9wxMN4HSukEBC2mOfRduu
WEqSvx5KkQxjgkb5694OFGlzDB8n3hQQkJutPxCnjLpxoStplXMKDh7wJ8XCc/gqPyPh1X33bl4t
exQqW5vCSsEoGdZfLtyp3VsYz1IkZlbnCJuWRbNzSzcUQ2dcJr7RGvPNoplIp92Me52dzE7rsEAI
p7qGIIJ5nOZYe1tj66JsCG30BMj/q90nlCc6WNrnLs8PTUvRsHGcMM32FopZgEYOV35SQYh8FEco
XbjJmF481bLmVayyTktr/l6+GYtpovyzqR04Fj6E7g5xdMA54yQhVOGN3aHch19V8T4AVxYBj/PU
JV50ObjEphhVjl93LTONrNoXFErNy2j0UuKf9kICa1yUFkzziztUsCAMk9/ItY8MqhATQHp8/YR6
D1R5eriXJU8k8E//CeOmtgJxqO2qwkRd1bCccI2jnr16PR0IA/VYfzA+07KnjEdvTXcoy/1ZBso/
ZdSqyDE+l7iXZ6PotUCPVANcOYrH9mW6KrXnW72xlqX2Pe7aO64iKMJb1gNwwtnxoQd35DKsgkju
EySmNaMGtXy07wIXsu8QkPNCrZjCkj0MbKBU37JRx5LNFFgLV1MVnVaPjyKvmrVSZnRATK6S9nUY
hqw/xCpSMzP/NUsf8f419TyoicSX8IEsC8zvUlLuO3SNFQhSni5U/m24W3FRNErgx6GZJzzuON9D
JDCZJwPZU8kN+bk8iHXamucjuTgrICq1WRd+w8utKD6be0Iy8s8190hWiVWfbW8yRJ7PdzwqJsjt
QcTIGe/v/1Wk/WkbGHx/KHuIch9IIcGqwg4oLPB4IVT2oBbxxnJYjIjmCB8AwPEllQfKhBDaiKWO
rBuoFtTNnf8ficCnHiNS6GDujhyisotKGe0ODLDQOC3bUsqmmIs5Nr8CiJ1GeOkKBKDtvkP69wPn
VvMuAH3TUWItaLiC9Q6PHfvj9376b8dMdMh09FFDSNoJbQXXWkJgscVa2yWGK/rE86ktvqWUgmxx
+KOU9JXMeBmRjq1ZeVMaElDcHxuwJGvZdL3TUaLThgV5zMn2B0dB6KwQJwlMPsnjHe1r1XI2s6uy
QopFuhPCLuijfOYKNMc65/DTrANCpZ8H2ij/qw2lh/XX7ZcKlN/Hsx+gxV0bQtCNfFarQiVWN7SG
Ez8gK/rSSrtcw4F9eHFvAJJeHRkmySGo9iQv42CuecZwVzdPmTydLwQrcCJpvnO3cvn8KWyYxGTz
mpypomx5Xs4dOSdngjV4CfQsnM060ue94XDhSBdUg6ObEnlohC1BUt867ErOAu4x85Y8K3kWlUNM
Mm0PnGgVYsLSQquGIEl+optVCde28gT10BWf5pegnVlcXQCObs9DQhNaBBdyA/qiCBW4+0NsyDug
5dhwlA895jjbTjaN9YFsLNx4bF4pFSbkRRQg/h7op1VNKTr3DbZNqPOee4t7OK8g4/SztUR3COvx
POrc9SuY9Ky2tHja2Wz2Jv58p0A/NtJ8WnAkMD6KC2NIBZl3AsteA4LyyiafUeg6E4lWzYdcUXV9
buyUFngogjCy8dsR9hbDH1QOUJnsdjjaDarVv9NgFZ6i4/ZEJG9eBeSO4QDSRRRiMl4PzRg9zsdS
snqDacGAZhbfVEvzxRvXtTuY4bzkUdp3E8lxVITu6O8FyHmTuokoBsMzN5Jl3pBV0Gwfp7SW76A7
bzzHpCIHU1zEWI5NEvpopJmyTSBwtvxq2ewCm6PnK/JnPTUzlF7KJNKvFbxTsGdV7amfbUofC7Ja
MmvgdWEfxOYP6Tv2KAoo+ohQWX2xKR9xRRS5kydCX33mgAPo1NJodZDcDNhU1vwaCHdmZRLdKNwp
Cv8aEmEkIyZ9vu0fuzPBykWnMqJ8hCvTVrVfQFNSTSUycMpfZnRkdl9KorbRQONrgY6UrGhxECIm
MrIMKckwAkleXTJuSS6V4jqrT5avvOjOE60e/wAlwNx/FE56alS4AT1ZS7VqFrdO73oX4EhQs3Ha
+rYXYCmUpw/24E76AW8Wi/Rw8O9YLbGn4X8J2o25JLOQ/4sxfLYWgZazUmhMUp3+Yo0GZluAvUxQ
amnE55o73K8kFWAwz1VHSraHH7KGauTfYC5Mz9n9Co6IL8IyJWgEO9ExLrTCSLmyJnuTWagZ6lfk
yGQ7z6eILi5aOCT7qQnGY0Wkh4IPKYwe6jQXCMHLlf/b8cOBGTM/kNNM+nZSDFhvRAxh0JKx3Fdt
x8COGK3AWwpAcy0HzF4cgBxb9Txs4rHdLsm4hGtXRuDpITbDZs+i6GI3LcJ/LaW06frUErr9TLOs
CEIrC1iOvDzY1cW7rFxgvwZHj7wrRlSsYxuyBFbLeikcb43Gs1va8deL02QAdpP6c4yk4QdB+Ip8
nL4Nk8EINNTtgq0hwx3+d7AXZNi4ClyqPESptOSjlki/TgnIBSK+SV2bBZyr/juu9LtbIBPeYdc6
pRCfDCPeyy+3ZuNWUhpCf4MgQ9F5V06Go7FGUMWoes+x3OSYPQ1iVY77nlrkrTjcd6l8AXrTu4XA
1NvuoV1mWJEHLsOSJMPVVHnQNox1ElSU+vbWULfQO/jbkNzBYnIxBnuXJD8RRBqLEfLnHj+kKTkS
F5JjvWUSxHeQxkanTFdRoMqeb61+iust0nqX+wGSVMz0fo6OE0zzdLY2NUS53LeQlohbpZ+Pizzn
HBLsrQy9r9PZnPeGNFgH0S1WTEuD1N2e7/C5nAQMY26RdyxEdON57cBHbCAAAAu+QZvyTeEP8mUw
Al/Wk/uLDuq9WnFujx0IQ+pR0xw7ahPXHEx7jY1l/5YrNhg/ukHeWYRj7OStN5VhogNpAVOI9ORC
4uDJJfZlVX0EUGjJOQEnReSqhmLCPoEgnTi+7fbKXtafqgON3quet/ZpugGyqCr2QYCMLNfgDV3L
nbqIm32vbvrt0bx9YGwIuRKNcupa1XZ7MuXpWGKD0XZ62Puqc0glOEdTA4xag/E8tnrFm+1ww2II
JNnD0LvK9FuoS0pn07M4PBRwoB8ZBS9UdO7df2MXshWyCtG853DcT3c47lcX8ZR63IBZ4wJnXEgn
uH0m9lGklXA9Gft8ekuk427UE4m1T+FnqkewxCzMFCjZgTkIXAAdTP2fS+wM3m+3q3nqxArmq+wo
nmnw4RtJ0+Z7a5S4iTznp5tWQJX8LerbN/KPUI0X7UFs2ucR2YrZozt2aqbeGti+SbudZiikqlJO
sUCm6VxMbDos8KNMzK3r2xEj5/495B540zQnPQI1hgI0hma9GT2unc/WqVOojN0ziZpllfWYdRZt
5hLX6PptSlJOrQaotHUV1lOIcFCO+H1ejdL3OmHdDU7ZxLLCUEJpPY+Ivyj8F7dFSh+Ippv+/OX5
081mEeXcduNtRMsiMM5XJ45WSK1kKYoJI02sALaga7Mfdr9odp0ehFBkjduwPClJ9E8Dmi8aF0Yn
6tG4zS0VQeauOtvFLdzYHX2V4l7e60gB66EyNdPVqYOvEBGkI2GkpBYB/7oHcQiXKmJFVOCSiZ67
Y9SmrYcMhA4qHpFfeLbarJefmHCEXEtKBwf1JOwb4c2RALRhVN/ItqxRFRmFKYi724xgQQkCBo6H
1G1PGBXMu/N3+AIjDJ3u5b1QSCGUnjzXPZpfkwDq/aDjZKFyiLsfktX2XLbfOC+IVS46nT7B5qHn
dQYy2n97n+Zv7CPkrNmrp+yCh5+RahUarlhEatSZr3XCCaEUt5vQmOs74J+mY2+oaTV99Lj9VASG
PIToJS24Q8x5T/R3/9RNhrm2zI2gPRr5UrVLNLNYcv7e1PoMDfENaNa1kxt1aP2+rAdJdrXKpcUK
6420DxRQudlXxdMqYFTZEcM5n+0dobyPZT1gHN0CsaQ1dJGlUEhcIBXEdz6oeUgjQl2RYJwi8pS/
V5I7PNJXsQ4jO/ihm4nk39+40MJOOR+9g3tY8KA3RipKRXFWKJJ42dQVo8442lOEoRIWgfTD6ixJ
+UFl5CqolYroCpncnW10P0URv3Ko8PTX2sg761YUJzaVBCO0mKgCnJ8Csy0QigG9drGNpyHFgNIl
TZtLPRucrKc1jyQMNeFvzRarJMkr4FyV6eaHIXKWTQCh0BCR62scBr2iboYY8YQFE663pBlpmik7
aC+a/fR8GhuCxUuayZkAdYXSYdnzv2Ie1iR3b555s6Ob7WAv2fhNCda1SnzhQOVhaCAeja+lSwSF
ngEVaMqKJIbkXc8QTsoZXTj9wFfr4wSLpsq3Kd/Mkp/zV1xGxeCk8nD5nzHCIMSvRSdTGDn47tmf
7DfjcM10jY4kDii+u84KnbLw7VgaaSAPnVSvb+MY6tV8FHQ7x9XB5qmKmTcj09C0hTS3Pyx1pcFT
FABQjAr6riJip2o3Szcf5HLu0cGH8cJjYzOozM+modblZFmY+ez2eQdFRpbwpvFR4uI+t4ib7xNQ
Qq5aF/wFQ9utI47ltbiYwUOMvPR4bJdiEprXVahT/EmUOacbVf3cM7cx4l1pylZ/obzwqPgZmR60
sG1qWmMKZEActsRlSiNSudgeR0JYqnNvolcskV0MLfan4L5dUCN1N4BO02FsQXZEpnAu5gljT+Da
jkwrO//tGVzXkATs1fGFr+lCy7TD+Y+uAd3kLjuOHvNkGdsfFw7DyxGlXOqOVqiP7Jn1ikIQWA2J
m/Y+15y/gUTudD/eTUlQ+KIg6Dq1XD+F0mQf+IVtWe98ei8joVLBeb+Mkosc10PeHCgf7EErvtWh
PoU1UA1rMu6tqS/KOhZZ8zt3CNtAZFQtO3/0QQy8+LBTXUC8igBU4JhzUIo8a9tnXtdiHb17mZmg
XHA8F2k5rK1f3QJx0RAx+Nig8UTvmvSmmeqb6FxuOdFhUwLJ9PRcwbFnHV09pfuzWh65Sx2MGwTX
DNO3yiuHB5+ARC/uAk9MFPwAiJfE7F7IcNIVuWV2xheYD56CCU/iBQT/qGvVtfnuDgdbXkvY8zSB
3+qzpGe8GOhl6IgaJT5TZbcYzsjj28XdnlAa5MIjr0JuoDqHFpQWQJN1935EXgj5oUUAuVodKv5V
JpFOau2ANWKyYtYUqNaMmYVVCkWjqpz75D+U7M/7xE54ofG+AxSMJoAiNAkUt2GJsaSDG5LbjgAZ
kH2FVBtoDqzYY5/TvZaQ8iJtBGdf7Vxe0CWHhzm3bz38DDXY2nREMfNbKq+IrlGOS4r7tYeytgca
j/oP+JkgF0geBhZRsSxoYUKuLi0+hVw1eMejsVDA+AfGj+n8LRWctY28BEh1jqx+e9G/tL6To56D
RWbPdGLFMhjyKa44T85F41+jif7WkWDZfcpt/maKKQ/hI9JKGKJytrHgNgbb+le16c8Mo5GoQjok
baMVgF7Sk76+Z45gve87G4Lw08zLg8WHSBznU7xZ/G1MKb3nLKX/ZO2FHPi3NWizEHlZknYLViLU
TdPrU/SFJ8Bmx3mwMkWY9Z7rNJj85Y0Paa6FYrNlK16JXO2xjBL22yXfnkwT6tU2F6lVc/s88G8v
VF9oe0anah9pm7WdXbwSysLaAbLrHx/d7y1juLF7+ucS5XTziLwDxxBo29U2T1a227PS/dHO/wKk
7aU8ed02dmCvA61iuBXkMAV1WsMutOJaIHbfpzUDyMQTlY0gBhVf2Qj4iXwc84Y+PORwfxIUmsDY
JvroBdz5iEVG8kFoGskGzU96vCLUiSpUm6KWOfwjUmd3+03ZGRbLI5KJuJI1vVw/JD3GCzHWSl9Y
0wF69rCrBwUEzsj1VBL/BaPtCKlmqn9Uyh/l1/0hbqzQkmS3xyBhitXGWUafSMVINp+DLpUi0O0I
TU2qgVeX9s0Xie49RwL3ciGLDzGU7QR9UlHlPv2gPCRHlfzGmWUC1n9Uc2XvemNV8BY23PRZMXtJ
1xGv3uYLAXwBZB7Nmem5hIUfKi+Lwqawdf65HQPvWa/aPq2CbyVsuG458Z2I6os1iMWCjJY2U5TK
tmlF9ZyAIehVg+jBWWpd2DUuyvpMgCxZ8/7fvWT3Ny2Cga4mt5O6kbM32CZGzJ65nhddj79FcjjS
TL/dzGhEHv/hKqHXfTZEJhoDmKea1kQhgFXH9PoeuQW/6uyiXK1OKp48tGZQztuevl3xTKBY1pJ7
ZDDxZIh/8Xhl+qqJoyEolqTOdKkM38hCIyW45ol8hQQeLvwJUrsexXEq7cYKtUlXoz7B9epbt+7v
K1jRF9Wx0rWrMVhGJf0TCx1TFLgYf5+6maXi5iIp45ggYWqKydjB7jczwHo4If94o7psn7bkwc2a
KEbSpC3ZX/JGvfK6TbdItZsLNDtaG2Pvw0/EKFM/7DqoX/C7NOQBv1ic3KVFgUI8b0h6y7ZWx50k
AkTK8t2BDYZZ+CbMPYrwV92pm/NdJFiHNChA9o0HfSffXhNICAXP0yiSvyphL6vUuXZSUFwFwW38
ioZNk83hDiJQgBUI6gMAV4MsJft1jlfWUZ11vROyZSppqp7wL6NcE3ID9HUSbFQ0qqySN81kDxof
HmKi6fTW1qflp6OOD9g0i4e/MElMddWKxRDj2CJ1Nc0qlR1PDxfRkd1Cx7uPcWCebJDRk4nUwfxP
fHPXq0viOr5KO7Oq9pdGB7odrym2pwNCeEMJuvzRCqDMRyHP8Ss1oy9ii86lF3TvH5mOdrqHGENn
FHJwJSrxOFekuhuRZyaEyyjmgw4/9seXDjj4tNkgFYV9ECmv69MQuB/E12RvnoktZ/pvwFVfL8Qk
SaRbuDKjpYgJeNUxfJlWh83MO3NWNAVCO7zCRQjgGaV1AAAKwUGaFE3hD/JlMAUVE198beRlTnmr
x/H344K+cxKKJiw2Za/aGktR4ETh3vYDTNDR5D6rOgENSgwqve+81ibn6qMpkWwsblgQGe90AAmc
u6xA5vHhGpYxmT+VQlargUfrjHzG2zleTArxr1MtTjW81ewHFHMPZrM1uUIG9FA0YGk2xIQDzULG
aXiRiTnEwXq+bQShVkRAqasg7faM1wi/w+8DZeK8sZZipSwvNo/gOT7k5b57c8NacQ41q5zH3US4
RmFmQWGC1CbQ5Ca6WDH+uDts43b2sLzISDF8e3lFnigDnq7ytaQf9U3p1SP8U0jFwpGHBuxn+DmR
4EFtYbBi4SDG9DdYgz0uTfuo2z+UvRp831wKkGH9fVkR27ApGcbNad2t/ADUCDp6PHVc2GTnw1Cy
ghsNynKYKA/vnfXwdn0C7cII2nvz+TjBBI0T7Lznh4k5Elbu+xFxWA1cI8a92X0BKFA5OJKBp7n3
uegxa/+MOBJPXw0XAAZ67kBs5shMlIGrQmZAycty5BYkVkpAZ9XWbrSaDMGNO00Dv6ZaBeObeAuZ
CVlcJzXohIoVe2MnFnFRPJYUEH1wo5vpq3ZStDLMDTvhm54y7lpFBMJoXdNK3VUt0IR/1x2MnMXv
05ycZnTgh9omUCT0Qjmwcm7Ty3BVt6nSE/LwdivhunhC7IjPSmYZZgOsD50NIk3rVjNo1ZlgqQ8r
uElkFnUHYhjoId2nOCMt/UPpL5JXLjGfVGpditMIJqZ5Lrs3+zPlF4HIuR9KNQuzgXCmWNlryRly
Hrjy1lOM1MYLpLjRWFoOzFcFzotJXfwy3YugshVptLnMId/xcexwdoQcjOzBPgDzGWmgcIMwD+H2
cZBR8c1sYBK2VgdEmqqFkybH9Fx6PB1dghUNTTXN1omLPzkbPWrfRy6R5TxeYva/EIhw5zaAvJ/S
o17HJAB21SDz/1AW440sl6JW8pHUGCRSjoLGg/msL0sEjTgg7655XNs5mHuAmVzlwZC6ekGCliu4
g4GQausZgDUqd5PCaL+0jZo6nGpuS2l1j8lCW6m6aPYRIsXA0YnjG3oFaVrIAoSANxG0CT1e7+9f
Jq1dIZ0QZc3AIao5HeKAHVPdqyndWgy1DtnS7iAaFqhDt9pj9APZR2lUBijd5C7IgmS1abuxooYZ
98w0XIuy881J1zxEpMCrEYyjUzuNmwVmfLg2tAsC55tjWSLfkFC1XpDZ0Q0TVZJJ/HsWjpdPSwK0
YbgeY6DmqJEGbAHoaULFQmlaGn7CsPT/5cT9X1UfwU6gvFOgVF5DmvOntW03wu3h0kud/Oca03Kg
naZ5T9966YURRWRfGclb9tJ9uNDnI8geFilA7URdd2b72w9yDE1jk2xxq0wVuRpZTpZoqTVt0rrw
CgSzVxEADNbpAA/F+rN7KeALp+AVzX/wp+3hIWZfccifU60nWjt+RtsZmdd4PgNtbR8GpUMDsn5l
K5tt8jePKAdla0VI1dJllOeEJzMa0hpQ8CXTa52j/gRKtRwnyWTCwmv5Pe75NGRrcBpTRDidzHfR
cG/oDsNyxrTdlHj0EEmwwcEmcj/q4N09V8lSg2dNlxdZ+fHm3Ko7vOEEcn2mT5tmD1uhcqCSpQdN
WxKUG2NjRwfWG4vlw+24TbHcCgBufJSFCsglcT2hjlGbIaGE3qVgfv3Z2sM/DV8gI/imGC8j2zbC
W/0kAvHQ9osSzgDsoDqqf25aiHg+8ZtTKw9SF4Tsl/PnqDGuDotXknMYjNJiWOwa/Eq79CHRh2yw
nz8SD8VwCXkzC4nde+z2FPEL7HbkdIeyUr6yRejidOzATuAYuEA0DA3GlrnFHoeWZNij2qcyD57f
73KwRL6aWZalp03owq7onkD2Cf/pF0LNjYnLabB2T7O/I2DD10UYqSZmFJHbcU0YcCT9SuhRQv4I
4Vukib4uXFyYy0Be2h8lKcoCvcjljDaZtBZs+xl9YOAOEXQ/20xFd8mXJF2eTm+s1X1EgWD6xBDB
6H99p2YW1HBeFyZRJcua1xCsefHu8KshG598dcKliandd1dapQeuftzsZdxns+Z9ooKUAiMcMCEB
r+iFQvVDoqQ9gYPDyINc+lGlm+5ubp4psshGQqhhoHe+6ZzHN0EYTxTKDso5190Fg1I41zVlOlUj
0RkD1xB9rsg7t/FxFivQPm5R7CjgyeWvwvUfJtHRilRYvZRPy25pRlVxOJptnnHV+JhPfslcA64y
ZLzOOEAhqSzyQ+o5tA668X7vt0KctOK+vKkxJ2AsrDt0SQfCQgdi6KdGaKSCNT6Yj997kwdMulNZ
YfPPaVe+nikp1qOGGkxumJjXuszuD8Jw+66gmA7dhFc0X+PjOrYQw96kIwOhOVjtVQMbWEcXSsUU
H7YjrCBX2V3DV2wknT7A2KzCXmK7uaSD90yXFuXMo+w4LgrDYTlhx0L3R0evia35GoBwhhMliVLU
hhZj9cScMyFoFggE4iHP/XZbohdl5yIxYKZ9pfMgtt1KdT2V1ZtzBAVqvee7LX1q2I0cZMqbIx56
oJgZ5a2hd9S2iAfZ2Cy80nfDVk+9IBCIui2gv8acEo9EN5VnP34WcRgXdLKCEuantyizsQOO/vmS
NjTYD5evbrKuBGoIXHW92o+bLlr/f+3CEskCJodleM2Fi6VKANnkhXiJjs2OLO+k2zIKd5Lx98FE
RoY0f8nn+tK/z9e3Aco8rJLD6k+5exW47kG4pJU6I3XLkYYLHuY+9+YvNXd14I/r3FM7hoQwmzJE
4x9TiFyQaxV0H9DE660a/TqESMUEhNu37lFWiFO7DK9yL65VtrFAa3ZA0trdsNl8UfMNKVOAkl6D
LK7Qz/biQY7iPTKBo/org12AVvQ88oD8VoIs501tkUJIZy4hlf5UdtKwg8VhNOfo47IbiM42ryA0
AEr06MJtngYJTsub6BovoW0yT2+xO7Ze4Ej6vtWdEvoq6UsmwStmg0OJlyPPSH69z45n1AkSqCZx
dACLKo06FqiKrOs4mxIXVezTj9pb9TreovfMkcvqjFM3QD7LIcXaE7p8QDgUzXYh+roN9JAV/mkb
RAGpXvffXw4l1rjz/TNyjFQA0zU8kUvawFDsoCC+96wT3w37Bghy/rbaOcoBnj4bymRnPJB+ClOq
ZH0R3qgmix6tSFOTEnm8eZNp29sKMNXFGiL/wlinUBeyJwX/ik2AOcu881XjI3fG0VUV/4hCJoFu
+i/3Bf0TaSgKXv0DB+fjzAbNYiVygxux7DkmJQK2pqgInNzgYCQaxnDizbVxgBpsxdLWnIMD7jk4
Jn8A0gpYW/+PpfDJRtRqR3hXzfyKFKt2SBAS0WIfbo6yt9+fMYhonQyi7z2+qNVpWXIvUPoGMH8d
ib355Bckcak2dtj0It7X9mxpe7lUrBgXpqL+rknI/hIUIBlrKGEif5llc8xoaix9W8Jvrc2LgLV1
Xjr/qx2ko+9KYIYrsNxgxUNNTR0BMR1/71x4f3ia2QW00qnhVnmKhMQcG6j7MwFBChnOst/gRZ9G
li3o185+Zt7jUkA0onhhRPOrkFDqogOOZMMWxwki1fIBLMoOy7HPSBaB+W+Rj22/lwGaW04+7VZW
p3zr1OYCNoTEdZEp3Re+BVeWLIUx/iR+gZF8tHaoyhdDfjiXhY6fv82/BajnsFDwLr0usdRIIRqP
7Xs/+gFHd5EAbIDAB/gABEIIBnjrXmiaEUO34zUsNrWIQSDl5kdLAb/ENOtjv/rkA04O/9BDTvza
kLx0v42xrTBsTwnhA2L173XMW27aABsbwocg46XASkYdigWeh/mYM4P0OFDmLMf+PIeQZi/6d+af
bAddWx13+dtvv3Qbb64toA/Lgez+J/LP9h8383/YwA23MHumYcx5g9AzBmP/H/EL/PH1CeL/fr99
T+pT1+hjQIGNf59Bg4P0cGBYkbhQSuaeAxgTyGgd+TKLTsgC0G2NP0ENBtsACicticdtcQBkQOA/
wADs1jQAy+WD9tQXCyvdB/+G2AGYv8AzDmEkiBaYADhAWkiiwBtv+XjhfddtDbf+nHS5iyaWgSht
ge7f4gG2dVQf+EHSEyJ9B/6+0waaWgHwn53Y+xMbfp4v2M/m+phB5wEF8JNQAB5PIfc+390Aflgf
E/5f4gfEPZflx7P4gfl3IRqP959/8sFJaZHaKFY3DZAYBH+grLBy8jdePgKm1tXwXhn19/Y2AuSf
zEBD/kWADY+xviD8vezHzXMn6Nt8gCXgUQAAzFtuYcwhtgegBtu2e68gzByHkABtmYSbC+gAWTIj
ufyYP5Z30Wfuor++ut5up+/nb/jouyvf26InEF2Xbouy9s5DmPbP8cw8h/xzFtvoP+Huv+bbAAMw
AAf2f2f3/2hoFtaBoNt6D13p3+1s9/cUzjeWYcx2RyD6AJcFmL//g22QbWq+czB9ku8LhzYnZpnK
n/QxnDuEBK5uJTzjeJzzxG/z1fwCillsALhsLhBwB/oKUMFcMAO9+eDidd/93oA+lP7v9O+nPkVJ
L8weECtw+IhtvuuYcwcgDkPIeQh6CHoYch5BmAA6/sXYnCg2LaUX+1xDhofjzzwziV+C/YziV+v0
88N/R4fOZp4Xr3ChxxOQAMxhyD/APQgB/f/b/eH9gAA5CAbbyDMHCFzHyAH9h/eH9nAhGo//v2/9
kUN0cNjkVkBgH+gOdKcpXDbzO++gZS3V+GSgWWm9tqKelcoEYUAjiKBGQjYuxdtzEG28gDkHIA5D
yELLsHqaC2zoGn6DyHbOQbaAdf2Ptgf9QnATiawYMbjNV93z1fuPZpqma2CDzDzW338GnW0FRCDa
/1v8bjqKlh7etuogTScwWc4bsTr858LjnvfpDvx34A/L/y78t/Lg9223kGYfQcwch23JrP8fQMw+
YwT6nttl+fZimv1EJz1QGn62aveSJUZu/LY96GnNTU0bF2NjrnXYvPs5xzBgDwoQUApJVaqFY3ED
wTQ/wCnKLzhQA2DH/q9aMBp+n6BoG2cg2wOQbZtuYQ91zDyD0H/r7tmDMO2ch5D4XYvhAtjQdPs0
XfoAE4/Q6TnLj2eQQCaWEF1vu871dRTk7fXU/P75f9rc1lfz967ctqoQTUIOGO9ih4WDzT/qAAAA
AAfdfdPuf+4H9n97+z/9/s/s///7+CEalRXCkOGimEEiIT2XosKg5RqVhv/5BWcPR858D7qe2ned
hd/Eoqf8cw9fw6D45gk1Cc45goTicBh812LOQw6DTUJxOcdgE0nG9X13dzk9fb9PXd1PeH8jO3+K
6997osRooopsqbLiatZs2LDSmkUxt2XkuTilNZbbn8I35K5tPvvJ5fvg+9RRX93fxRbxPTsU5fxR
T13Peg179V/LsP9k24N+TwsyXMlzJvJy2nTbj+X7FwjsaBVMTXBdS4M5MtZvF2CugoI5Aye6FH/t
ABIAlLK5aI5aC5qICBIAWDDCMyPOZf/NgDwtBlzEAeggGGA8vl8xPRb9d387O319f7zfxejTl/5P
OPP5PvvJ5BzOnwB0fa8Ln5/C881uEt5Hl83k+9//fJ5Tzeboc3T4PTzBy9/od3K++2NuzbsABubt
jf6D0N96Dq3Vr+7/s9juvdpbdtKaNJUTeXKw7aVULw/7hUfMvDfdH8HzvjN60GMhnhasSyIK2lrh
xtToggsEQBcADiEaj/9n/v0VQ3JySOyyEFj/AAQdojTAC3b68Dn5g0L3oRhyuFh+gf4ky0SEMu2b
ZmIADMOYswbZyANhfjAAbaHIQ2wAxl/x1B+wv0OIB4XwgB18OvAGxDz+TyHmPP5h5/L5gPvfN818
19J3vq/egd73h3vq5+Q9APwvQ/R7/jez7/fp6C/T3PGMnj5ygBVAHKqSaAYXyI69c4O/ZWwcwWR7
R/NNOKYLOLC2yCby5B7TPGM4b/NwyVgfocIafAT3jJ6v88bG5/2NNPYMOnEFmk58L4SadfmgA7z+
weqgFBQnXQ5HQZG4rGAZCDAB+68WwA02Bq37uvBOqFL83l8/3h+P5jz+fyr+f3m70+i/df39+urL
E771UHq3fj693/f3+/T9/fXfq3q47zvHeD6/33eO/fcgPP5fvfP5vKefz/f+c83m8vD57/Rv/DPq
X1D6h+iHD+JZl2pOo7XTRYPk+7qauYmAFaHxea/z8VdUbw4pnGYZptvSfVFaGsRoD7n9cAchGpUV
neNnARlAgL+ggKDL1VbcOjItkzeQCXSnEqUPQFUbPbZxoXafMWmA5zn5uY6Rzc/NzvB6AeHzHR4X
O6XP4QHOdAdHMObp8F5AA8oB5x5ACEZKWUCbDnPMEPSxtnDvKPNiwzyLfOcqd2d3pqbJweVeh+dO
bpvlkWHzMaIzjde+VZ2XDkpw5R7EdTdqufAZqUZw2vvWPg5Z+JzN1+QVd965lEV4NztfHBEQZ9D2
5JekbCyNHZyOnSYWUGMP7sbRrjU1hGjGPkOg/h+r5P+gwgAJ4wFIglhoIGBmO6LJQmCAjKBBfsGG
+hLpzWp0VYDyfkYVhJcL8gC8MAzyxtxoC/GgAxC02g37A5LyjzPIHl+9A8wfegA8/kAIorLKCY7C
cEM2Pwxa9c5XTBsDW/11wKN9bNipJpvuvI1Egxx2/Lg4d41DYp8bzLOTEunQg9Gnr31zyWMvTV0F
AOqiTPS2rpAkwoXhwr3A8gf5FIOOQFcaCAR+GLZbj26kMnQf3+o5P7AAnEN+ApgBkcAhGpSludEj
sshcYCcQEAAAoMpRa09gIgkEYGQIdY4AQzEAmDAWkjh/EeGcTt0cqxv8AAGt7BoeHp7eXl4egeWt
qBoaHgDp5ujnDoc4B5h5QPMAAHeAO+HfAD7lB5xBukrImllfveKt5cVTmcwacdU8h/n2zbOQwewf
/kvhnM45253x1z7BMM8JJwYLhk511+M8vOufzP1zU0PQPbyHpkG2LjjYobHx2E4AJqAB3wPuffd5
3ve/SeqD78PI8/n8w8vkAHkAAHk83neTyj7gAD/2+4fb+6APuKN5UFy2QBOQAuMCDofAaCDFG8Op
PoD4OJtgDdu5ufZs5W4B4fNz9Hg9AAOjmHTzJs2U0bTOl0+AH3h5Q8/m83mD74Aeby+fzAGgAAaf
begddBp+nWcLrgNBD/fTv9uuYNyCwfqPFEG/9QXMMEnGYLbDP2g9f0F4DPjS9eT2kGZiAB083MG0
AA8nmAA8nmDmDodHSAADZv+79x9r7gAf+3/p9x9r7n2gf+p9xyEalSW1zARwgGyyQAuMCH+ggLAc
tpcF6C7WUolcdFoJIAGYg9D5BgLP8MwbbtgByDbOQhyAMx7Ztu2BmMAAPuh9v7oD+/+8/t/tB90f
bv2M4dPeNv2M4mH1LiU9fUw/m4dPX6Eqg/mv/6P1HGcVQf9Gc7xnEFmgbbyCycwbZJgeECGH4bz7
aIQnHXvCTTHM58LBcchBoNBppBuvgE5AJz3wO++nd6+yjvnf+rd93ve/NPV++7/vgAcwAAc9zubz
eYAAG0eCADwujn8vm8nl++++8nk+/HnfepwBQKUOWhuWxUEBmJAgNwgQHtwANbB2zD6FDQpEAPo/
fd6ereq+rh9z8/3vn8nl8rzebzeR9/9+D76finL+enPRIovX+F4U7f3c7FEA8x995vvvJ533nm8n
neR/YH97+0/uP7z+/+/+6DwacbbOZzBuQbbNeKJxw+e56v3Ev5uEBjL/f8Zft7v530Xfbqfvp/ef
X7x/6ngd/3O6ANkWrqUFJiQADzMHIRqVHZkLYXNYnLQ7C4gCpgIAD/AFsW2UHSAV684u7ryeDtYg
dBAYcABIF9xvo/4ecgFn8we75j9Df/v9r+wH957Y+/+8++Axn6N/nq//U8HB9Tv/8wB5fOAA+0AO
nwPD5/B5/CAHkvor6+8OK+nb+dnovRJ6/32fnp2dnYr+f1668b2Hqs5FsUU9r07sHsP/W/YzVM94
zRP+E836/Txou//wfx+0PX/g9sAB638XrAJBYAAcHw4fL5fLhxc+fAAOHJ8eRyBz5c3zcQAOPHwA
AEmA7S6wC4aGA1CAVKBAPHCkABmnAHu2YP8PQMFBxMAxl+4mAX+a9emk5CcwfD3n8wPOffeUAHle
fzvv3k8n3jzgDoOY6HSAHlDy77PxT3h38V9OX/hX8V1FOz+/bzF6LO313dz91P3/hTt9dX/r56+n
OHBwfED58efILRlpVSyAOI4uD5fLgA+IAcwc+bjwOPLnyA48nCEalT21y0JzUNxmYCA+/sCwrKW5
PaqNABlOOYc6KeacuhlmimFZIggTMDHWOJdLjuC47smabw9pmv85MRt4fUrKmuHQeDgB5QB5fPf3
U56+6nJuGly5UwAHl8gABtBsbQbN+zdytzdvG7w4rvfr/fL6K6iut9v8StzJbz0oPJTjzZBi1V3C
XVQjFZVelyxKxV/I8w8oAdI53MdIOTy+RvehbPH5HK2twAHe/xf/8e9/xv/f3Pd/JHf9wD1x64eu
/Jdw7yetpkobkANEcQCMoEcAnbjLSOqgDG7HAAOQ/5gCtC0CwNs9A20MP+pQZkAL3uRgaII4E7JO
uBce47jur6K7nJy/9D8v7H/Z1bXt+8OdnIonnAB5R5AAPKu76e3qcv7uK/i3ifiiu/RpzfJ27iur
6dy2t2Rvt+Pw9cqOOVs9VxVknaJCqLGWThU2RPgIvAA6ecAAAbghxdK0QAqBUDMfyQchGpUdtcth
ktlkQCEoEM31P1BYVaAEpwUETV6ETZWo2bJ0gXK5Efu1kfSSY4NZjv2NnnQAn4fvL9/1IDGE9z3O
YLB4P533w+98zzDyA8jy9nYCjRM93+enq47/1T1Z6sD7m73vO9731Z6t3wHed933fCCQWaTUAg8F
mmGweaBBZxBZxBwAAggeFms0w7rwBOJzzthsFnPheFDzqATjD8NnGGTWDbw8/gsF4qg1lfU4Ptlk
2BYH3Ed79e77659zH3Pvh3h3/fAAPWFceIzpAAWkJRBQW1y2KROSAgFRAMSgQAfhoKAOcPosAAXF
RXrsS5QP6jbI35shjgtwaacdDBYLBPz4aDp9t23p1th4LwvBHg+GB99955+Ol5+2JBILNMcBB4NN
AAHe9/6v9y9U+/PvvMA8zzPJ5fN5Pvg+9fejpAdDdzvvMvwNP7zLgcAPjx+Yf0OAAbwVDp6gALSS
UgXOIRqP92b92yEzbgFY5G5ZDQZC4jGAhCBACQ8jYWUjiKAHdvHcGQXzzjiagikovWCOWo2YGTEk
Z2Pl0MFtGlLdfTUE6pnIQfHM0nF0jeXhp67DQPzgBp4WwAafbYBp35/v3Ddi46gwTj6P9EB3oDvT
1T6V5gB5PvvP9+APM++Dz+f/Sfffe+T77yPN5nlDzu/Prvejv+/d73y/nru/n5y63mevt+nrue/z
x6r6s+a9WADwvC6Ohz9HgnTzG8DkgABKvRIyGqD5lKwJ+2GawuQBUGwgKggNRAIQgR9AHyA9rJ9V
ZgANF1ky/e+t6Xwo8Z9I4SpPWMIwR2ZKgmn/9gxrwWal+JPCu/p3TjgsabHr/3LpXpSQmpokbzPN
5wAPa9Z63nAUc9P1Olu8TD2KzLaXMG25g9B20OQZizFmLMQc4eqXlMZG8Zo5Gjzfmuxtewyhz5cO
PMDlwAOY5fBxtigWOCEaj/bsXfihLW1x2NxWIAySxAUQgY2Hkg0ggUagzH/OQfiiPGvBNpwfzxLD
8Sl3ekIEAhWwJLLJtj/uQTFs7ITOLIQshiDbevgGxu/uuu/7YDbf8/oP3B/+f2H/6f3df694TYuY
Nt/x91/zZj/zehbaAA/9v/UH9/m873T/H/r/j6D7r/l/ze6chzFmHbdtAAB8gAf5B8gfIAD8sPy3
8s+JPy0PidtDkIZi23kG2+67YHIQzBp35zQA0/v7Tw0HQQAAAJgJW2uSxOKxAKRANwgQxgRABCGz
4JB5AB+tuysH/bIUP/bjiCCMh/7/9TjJ2NyezkOnWaINP1Rf8ZPw7Z0AKiTMydA0/QQ/t//gH3Dk
AbZxVZX7/6hxTOQ/RgnnAf3ebzuQbbmH0DbNtzBmPQba/7W3p+ngABuPmvp/7r/dv7v/dvp/pgAf
3gBQAAO4DiEaj//8//ihLW0B2RxgNw2MGMxuPuLNKUlgINSBNMcl2Xb2dFJJIRi4AjjU50WTgJoW
U/nNbwyUou2gSYXkHIfQdsD3a2Q07T+/bZyCK2dOANA23MfiO2fj2cPccnA69mDwtJ6CGg6CAAf3
P7/7z/9/tD+4faPugFs6Bp/50NBtsNOtjrm27a7/trT7b/OVAL86Si0dOmQVsWxbVtzOLbPdiBS8
h2zkFBl5DtvIADbAAKJx2uR2IBWKQgGRAFxAUxgQB9+Oi1gG6W+gcTwxvDvUjR6UYe/QDTtO0G2M
bfw/n+oX6/fUaALyDMOYswZgDkB+RfkT8iHvey/eflCJ3kZ9a30EYJfx+yPzLeB/2/OB+c/3/O/9
/++xdi+EotGxtiBsf6U+kfN/SvpHzQB80+lfEey/Lg9kA/s/v//gP7v7P7v/wAAuAAO93AcAAAFS
AZ4zLlfNiVjkpXl9vE2AQGHhYAIWvTO+9FEUM8Y3aAgVgcczNrGARmAF7aXQ4m2Yh7aSa181uU9t
F2+VK1KjW4YJCn3kZQJ5khWYWQpzxNNAzmt1KCtzstlk27yUYGjJ4+LAaBgzqw9bBSZA5XrsZYui
jLNDQFefKf15WRkn3lQ4AvIL50Pb3aJ3h0YsK5P5P6DU7mULXlKT6dlrUBYHLgtAkzJIkI40Smki
jw6xaftskQb7vD+sqKVcaiOnizwYPuX+Ww3l90fP4qfx/o2u3laK4JN1GEqKkxSj9NG1dP3tRXSQ
KktGrYoxJ32OfMcr6W5/oT9KzRJXY6WG9Dxye9dkavVG6I48gipgFBnCunzK5fcL+CL+osfxXtbT
p0YcyOZgYXYLIOHgdXbaMERjR13KzG/SkBjKz+pS7Ubxxy3s3hnnPbHN8xjc2vtyFA5B0sAAABRK
QZo1PCH5MpgEb4Mf2ENjD16jUMNeryMC68EL9xfPqdNfFgsIfoIg9BZdo62S770NFfe+r2JVmQFn
oGYtSDgjqve6Rtm6Zz6u+x/LXHg+4ZVTV8wwEa3xu5yAk3DUsmGIJ2SjYYuN9L9Er+qU1GmNnqUz
jiccGqMpokb6c9lPfdRyTTOnN5FfLlssKpbkWRgiIz+Xo8QqFbaSeb9IDBvFl5+L3Nh3dp0l/G1R
1pytw9slIIRQnXgLo9DRiCZgZf6EFLfIzHq7ILWS1NtYJfCbq9nvY732Z+YZvABe9FSx5bHB8I0Z
7Zzh/C3uuoX+wh/sVlRdOg5A107CvDSksRNNWEJj6ijGCB6umEqpTfxe6SvohNZAyvF7fm8dyTLm
bmnc3c4Mc9EtNALHrWEbOYMrimt4jmOXKQFCevrqwVQzPhlksxUDfN5Dx9o8Y5hW4TlB/B4gxwOu
1QWJf3g2bPs9WTbOGDJSbX+tPJqH+o2K1ivK1+1ACR754koZOARld5d4hBrSOCApgC81m4V/0tDG
TTsNwQWH3rrleAsFGotL1sC/TCe1ANVZEjMnmeq6eoK9DC/DigyG+i7wUdohllBZkKP+2PvxkG8F
f5mHRavuXmyzRwcyCV38Gl9AwAK+s2icrX8Kqaov32RzCMx5MWz8QjhRne9uTCTYrKV5NMihgPW5
W4VkDwjH6bieflXBQK78KBFj7ySn0wVe4iYINRfCcrl7QXKfOGwjB+mkqzrKZQMO5j2uBMGPdG2+
UpSQwX+Uy6j4ObELu587dqslFXcOPOsD8wcbavcJ/8/fFZGzQFNq5W9mFSqbQViNADCCNspR4956
KyF/OCMzVjmGVMnW/zV7yBUVKbyapoV2+jb8x32w5wYI2lyiDl7sU0C0m45Ztmw6BQmOgWhRuKMq
iL0fPb+1gyO8Rxn7KZltwT/QK09uiO3cjfGO1x1moYjmdOAp1GiM2k492HgRPJhZkASPo9pKRaIX
10H4vcISC2yjDB+ZNQoFZo7d4KGD/OEp+gaABxU4CIDRTxwBDBjCWy8bI5sNu4jUIDeVQ4VsCrnq
Z7s0qmAW+ckPdvLR8WC3ZaAtdwgQPwciC7l3kjpeTI6stzRu7rYy2KYma4Ak+vCj6hoYXSJ++IQO
IPEtg2jTU8f5CXGqsVxZI5SYWdbR1rYv7XkULn5002HfElyss7WXbAj0RvbwyPFUOi7Fpsxc2BXo
RiCiJ2gr58fpm1Q24SYIV5yKTJHUDMa9RJKVJg4aLYk3S4t3HtTbxyw/CX8uBuNjglXyJ3wwj5c7
qtOtnZlbhJRkt8K4Cr+Fl3Kw769o6YHTFn+/LSUr21BHQjH6sXQyfFZRpGOFAFbgLKAIjVdTuGsj
RygENNY48Ixur+HWKPgEobqylLwYG4Vg6eQrrbkSRzlrm1zVuQ5dThoY4LUYdHQyl1ZgMY/Zi615
n0l0+vW09T4Q0l0xAlNOtq7pAKepYNiqVomUYRB544F60Hx+KkVWP5wpQIGptuEOWew9ojyp9hJL
4l0jK6P58cEMVQCk5NmUkrrAKruJej3DfI2QE0IIAu+H1f4q5rzijDmy+ED3aKAbOHcflijqRBC1
9acVN9xUyTfvhWU6XQZUUrFl+6T+glK5gsCScQ1RBOA139V5sx/hMqcS0E+ATk2OiM53liJrn8SF
R8wBguqZMQBHQruJDBvjv6ba6/p2iOassObyACWUmzuej1j6NVTqfO6MTQ56sjHcBkIg/n5SlAsh
VP2D18K/uao1OiVYjw1uMLMevBQ6J+BFA5Ex2f3+tfC8V2vERA+6+L6Wv2GDNOACUnKB5vHqdI0w
out3wJTcG5m5DJpX1KJ17xE8SGtQa9CDkfFPV/VTQ0iSu0suMZ7KboNTotJDHVv5G3otsjBC4kKK
zj277bVabxkt/6K6Mu6D6UyKcCXZQrWEWiL3d6b4nveFvIwKcH3peLTF+7afIZYIMhDJk6EFtgQq
u7dUXWC7xUKKfS+2Y1Z1s/Sb25TzBn5iQ9YkixNGLNdViCZMYme2L9dpTFzJCimrLyGQBbFUqZWW
mYwock7Ma/kuHtDTFyiIxdA/WkrAwPMTMrMNwIAGAJ9FcmAwbHh2bVtY8WxbKfVUiQB35ReFSZ2c
eHqDzD8ytRDyWgSAMxEAV36CWQ3jOkZ7yIPxi0yr+b5SAukljKO73WtnjdcugzCVZHZj9FDXK4zx
GJwctU41uq/NXkSmNaryo6SV7AzKA3024s1XZEnm2nP5jESppAqesg1ZmqD1ATl2cCJO7MpSHwdO
HNZ8Yn934WBFCBdKgmMzme1A5mGc6H+SK789fN2qA82TJv8/NM36QBvMkO/JX77x7NFHVO/+h47W
a3KIj/RoHxXxttobUWAi4o3BbuhyvL0dGnHFNI111UoOe56EQmHCMYWuZXp5mVQwOOjJc67cF1z4
IOAbMnm/xP6PfMqc/V7BcL38VEW+fhyuWBY9SP6k0qKoKjhusT4TA34S9KGORGP567f+ZVVUfH43
eOPdbhBJ0EwBDw63qZIvfSh48/zm0fKwGLj+kFjq6/yVrxUBtkATJwiDfcpPCoANItRg2AY25bMi
G+W3ZoyGiUAnVqFJhn1e08CZ71xB+QWgkd7Rz5FBvC3a4+BNGtfgzQYAQZUASLmpaz26al7lhCOb
j2BzYatGBEmKXUj7Y8l3xuHzcV7aDCrqYnwTrc0xQw+1pNyKtJ8YQcYTMUI/lN2Dd+FEjSq/0oNC
OyEeM5nnh7lOHgSnPQNw3VEk7OHJ+EAB1QfGm6T6pQBu+P2st6m1amhf6Ego01d+Ss/649CqGA9G
zWtkEkZRVtkuH8BU0EFQhpCwD25LxAME/5X+MpPNVoevdf9vpoEfej6NMY5pBcnOixdxIFqp40C0
pykr2mexYXcwS49ZqR42oBzN20USZoy/PaBxivbTl/M0BTZKv9ow4NZSg92rJmQ73neLuqeedc6w
qr9JyN1i5WvRI0uGlrd0VtsSAgAPE7bsYSAMMvdG+D8x6FPfKsEc5RrsMyp/9RTwfnj3gzjl9kXC
78nBnGZORbyjgPQ4THOhzE3KTbURcUWH+4C2qfVIi3lrJqFMfiZhs8Gkziv04G9InTwhHgYawQ/O
468fcw3PFNCsVQ7aVmUq9bAsQOPweDuxuppYgdD4LdXD5m0G4UiLR8Z/qeVAcG4SWGDOekpaySy5
EKgz/yy3Zp9NUM7p5dXOW9CUVKYmaIknYE2GzrshgBAhVozt/tJI50bLva2vvgzCEj/wnslp49RR
x5YWVcSBPQjF+t0zjc9fA3xc+7/hmmI4J5lrtNrPURU2mxUka8Omz8Is0hVN2+Ta1nbSK17O0Lx2
J8Dq2MajYeXshm7ryg6OMRB8WUM1h0cRK5T9R20oHuQ/rgCVHcGN41P505d24VqXOsHzauCiIlaL
i7M6tuVoQSUd2/ade+dU+H0MIY0gd13/5UKmtDy6LC/aQNld0lkzVeowsykXBvRNL2S363fgh87r
5YJSShOrIwYql5tz7fUXLiepEuEGWhH+xxyNerferrU8sLhvS7k20VtdYoOnxh1E3kbKBr98Rwud
eb0wbf3sgy/pnq2HZJ3vhuVwRTOmVhkNxoxEiT0Kg0Gu4kpTHRYjcPhAtKNXytnBpbFnAPIW6QTl
lgl0H0HX/mdMc0hw3Kmb0ZGghVIPtwBQKvTXM4Dbj45IQnAMLEGrItY58ExnfRmBoJIa3PsM8AOc
XT05lrY3KmbcscO0X42ZJisgeH8crcPBFxqZXsvTUeU/B3RwMhx7eKukBqopvCEGPUFec3XY9A3v
gHET1OOb22efIZ4rS+3rJd7jflvLV6oEED9XomWiDZ7N+OJCO2PtgsW/82ivDcAaA5kCXBEyHQk3
x34T6T+7Ytbv0erg5xvcovAShPSRnzW1qYhntAb2rdcW00L6ioaPiGkVCH8WmgfoYbiMWFaVh4bi
A21avczoekf5HFDU3wRyhGblX91mKgY10QF1zAznMLK5m4drPXSZ+ZrLmOzJ6Bt1t502eF5Gkcpf
vaMEzaO6QtKPFo/a9COcVj8uPBVxNcGy4JLMv2BBMpPtXb8D1USS9CDKi0abOkEplnO/NlL0438H
Fldb4osdMp52D6xDpI1SRv+4E2n1Ykx8Wvdn8wxSO8t+bkr69xn6XkYSGDAoubRJ2AAPKYknUab1
Luo42A5pwNq8XIdreuYUuOWeXeujoJlKbM1kK4l9rC3DlGiEtXEU9S9XGZ0W2DtM3mOCyuXgqz9M
iivFWSfFlQ9ULBNFFC8SaFLNi3t44N39hK/+IFGY2H9oGaqBeFPqFlN8SBlqAd2ZiovvV4z41UDF
O1Q7MzwQ7aQ+/X/moHv+6/VA7Imtem/9cInrkCP6Zk7CZa6NJ+JesEAVcPuHqDlVpHaFz46DimGF
TURjEfS+GGlJtpku28+xuIlnFmooLZL2AmGYD8hljrENhnL+3GZ58nxNiMsmtWQgoSXGswn3X71N
0IZmrsNelbivFMD4znePWUGAy/yqScjzhfQye9zl6CKGp9a7KPowYFou5CxMZiQkmQl8+3saPxiR
nsbYKsEn3kuj3BG/lMU8jdF5x9GgGXAwhIFyKz1nBfrh8i5UQaMeyqK8WZ3nGkbTxQiRG5AtX4S8
+TdLxPco76lUnAePChD+DO8dKgHBRxacxVqnzP2eWqWj5U/GnwH+4Fr559uqVZcAfL06ZH3aukHb
FolzzVeERLvCvFoGiEZkNYqXr/Bzv3b1XRAtUoZ72ubMR6FvNdEPR6J4MOHN1GcdDgYxRF7/BuUq
IrvU/9eFlNHzIGJsc04gJVLTwKyBXQG8FrvDNjphr65ViMmeaJVRFRU/O2ytovLh1DX5pg6jj8AR
THsKj0DdJZw4ie5s92nvwRGrhTTJuNnTSGr3eFsllq5q/OYsD1NsxXgc+qD8Z3hcCfdhxkkAd1kO
Up/Rggwbr/4/R/7N3SkLI42f7tWLpVBc8ADCeR5S+9TNHw0mOFuRhdIheQi22h9x+TLdQvOIGPf7
emyEAZG9PXq3I7KQQuL9dcOudt9pBnyMHJm3xz4hqiN+Odl6OMNV1S/D/GK3MFXbefK8rdQm0AFU
lkndOdMnVv9ZO37L7hDD8WC5RIMsB1EslybP+XUQYy/AewMl03m/+tYblLcWnpDbWK97XaHr/Ttx
TaG3Nkcsr6Nw3rntvT/UUj3Q9bKLWumXY+A6F41NgtvlXKrVED89TJWprl/uMCIaAytjyi8J8jM7
HvRc4zDkrVzymgpOuVjND3d7m0SdFZI4Ec6ivL18VY5dppmDULadmRHEEdbrjNRtVOI7WcMKBFuc
IM9n4ERMrBvhr6EjFQ21fP1lC32K9o7QJ72hqMQAztuR/tCUwIwYhOKaWcJEYyvBL4OvD+seQGnC
ei2vWj5s+2rr/agc4nW93LvaW9Pw9amfvd0SD4zK/Pb2izn8b02G3uPTkhO/bC26IZCBg3su5zpR
P9EluGxJmAHrQz0KkLAAHKTbXwKuNyWSZLZwGleF5nKGhEs29tfa8jq/RxCH7vxfLA6aM+a7dmQm
sDpAyNombYmYvM7qyJdwYBRy6imX9ow44EzuqNbJMfjDwugwXkhi+5J4e5YuLObRb81cRDM7Z+/p
utfnPTK+hiXeJ5pG+IWfr1UYCcyA2ZGZ73qE/D/QpefDtYHLwlyasLbRqNwR28odoTZ/+9HdH3We
9uxda5dftjEt5DoffUxUZShy7rcZ92G9tjye0NbxIHA7SlNVxjWje5+MImVDpmvWHEZkmIluzORM
39z8PtPhz/i04YJ26Xvagrsq1lypVUHM6lJm61kkpsbrIBXyZh+qZ+4kuCYHO5T6QDIYMXrY4vx2
1kW21PYwmtr08nTVRO4Bn2mK03PRJTYOIY2yi+ZeLmKZNeRCtczbo+yZkI1OmeNZm/KlQ2oAiakm
2uxtiYLziQFsK7zXkua1zmeWb/iQK4fKhYFq5c7jeFbnY4/4rjkj7a2bNvKPwxBWCCJ+I/Ac1CiI
arPrJxWymNInbe79WmFCMRzxzu55aoL8hqch/VgXkXLnPTpj56kO9KYDVPCiNy9RrxCnn9EnZag/
9ep4N3N+xjcdb7rw7g1aj8KOzoTsv/HQf9x80xtjvYg/lpi2KvMFNAaDdk+LJMXR5dkEhNvfEYOQ
mdO31qfdxXlqfVsZbLQMuuC6A9U9yVmJFOfoh5zJIv7I08rK/CYB/Lvz8brnGiT1ffYXctnFB0j0
MKwJv8rElIKGD23v+VGILESkX4YQrhuyR7x299u4vBgC7WiUGRPESnmXaAsF70BDPQgDDoBZ0wlJ
Lwfh3XMPNp6H1YkjGEuy1oI8ZHvep/JowLCuVe4Z5nhRhoDN80/rvtU1d1c1TmPFPMn33ySwN/jm
jf6Lz0HHCdDbdmrcp9vItwDXYPxtGE8n/YT024JQ/YZ+LkAd/rFeRQHy3jCMNEW4nfWy/ckAgou/
UII5xv2hG2LtYUHXzunLdzSh4zz0HMbl7L4zHlTMl795e/MEeniBQCTrtrIQ/RX1x25ILFx85UUl
kLO9sbBTnhV6APHu3Xg0JaDLw7ht6x+Dts2ejaAWqN+MOOVSR3/dOzxV/7Zr3BOwgFU02i7UZRUR
I8HKvuF3F/22k5BFCPUfHidrWhK7r6DT4kCkqaobEtYnRZHdVl0AWQOP0k9M7HGGQnt/HEij/kQp
VimUkeb/T2gcWEV90ek7Fui3rjKn+I1wayhAy4cqM7GtFSalyK/xtmoJVpqUgKxysDx7QQAMzQ9l
e4ClV0oRzlw21riJzdozntOn/HaN5PWw6MlUvl/DVC6rNkymrunUxNZd8oTwyK8VHWGjYclodI+t
H4VTsPKyXM403skvTeOnQgAgD0JNULut50HhdA4a6jvopWDP60MV17vq7QbzfeeIWJRHKZ4C3SZa
plKAAm8BdQAAA5FBmlZN4Q/yZTACJ/9OTCtWwpZkZg5tYmEMPq4qhEewhXi3B1HJWL2RXv/W4qlH
2wgqA40JCfBZCDT6o2Hzw/Ucrpfh+AD8eRltDX0v9Ea1lfyNZV7hSlNCGiJhuTZm5lq/WIgH65HQ
MHixgZq/+1FLJ24rFhl0yRxrlOR4nuQPUJUFUCID62yaHBUV49EcwZxCbTjWkTDQ7kVMhooA1FWo
NgrremxnyNoCY1LduMcMI4O0dfVFAzNfeCtmC5TgC03Npk22bcd//+WgLDn/B3rfM4vreTmexK96
BMhukDCOvePe8hyzO4VZFfLwtrCuDCJP+NAkErXLjx+Yzu2F1oAQlfr2+GUZzqCRqFPy+uhmIsNT
dCh4HVwYEDsxtDgATsupf6gHBnxFVh3BzxLnI0q7HAuRdWCJJLJYEMN6JVXBmU7N7If957lo3i/f
+F3zQSMRYouTkkmNShU+Zf/syd2xOmeJQegO65fXn7TMfFF64hWovHeoQlEZGOaT7zEVLakL06JV
10M4fnv4zfyWS/QPdIG5Vj6/nK9/lHiRr33vxzv4MVMh/vhVy3yH9GX5jXVQGsZMm0ccU0cnKW45
YFrxLs2PeqM3F2bnM1DgpqYufH9uAkqTX0Ayck/sV7PMaYdUn4t5sKVxKZPyk/8XhR18nDG+bEmW
TrzXewpnZ+wRrXoHWKlTjWtLhMfZlYp7x0LkMZaXsTIbcu7IjiZUUCAaBixq4FntGpmC+lwSapVf
j2N24YqcKOc3KpL50tOwrgNlJB12ar/d4DCZ4aBZi1VP0BmKN1vx8vlnDfhLi1VGoJYWm3RAbMZM
oHn11TV0uLVz1bG0mlGs2+TgJiSJx5KE732o+duOgHF7EobhWRZq4Zml7uRvVHphHQbsT7yJhiCY
Z5AKfOP/CVJbm85sOmioNMa9m1WbVF/MQR0QECltrL/4UgccOrjRPpChLOQ4sn7Bl/5b1CFTMUcN
TyXMTr4d6UeGgh3ki4KwBxm3LhJKfUkKM/4dAJZW7bkF7Lr0FQ2PbHs+6J7praNFunrpbsXVKTqq
LsfauLkCcp7pGD4AX8K1CJ3QL7ADb+msoP2lG8QD+XS5DC8iSpnhCmWClHVakWcGqGT22J3qMakm
cQ3J831lYt5SdHVDg0LCute5bQT0M/+sETb6UgojBPGNKmwJizF71R4G4uHOZKCRS7WtHN0p4llc
xJ667lxCOx1gYb/wAAAQCEGad03hD/JlMAI3/0aoca5b/4Dx9oSgtfA3/LBM7Aqso8vjlUYlfHb2
UdFDufcSguv8nRplR/zchhfqPKuHloOG0gZps+EhbHAJFH/AoG7ImQ+KMD3HEdQma91QnKSLXmwB
JfI54C2BcuS6RFmdfVQGbvT9TcAeUjhQZ/7RygttnIfALgtsdRvFs+YJuP7u3nMjbso3lSNMuEGf
fTojdP0YGgN7oF9gr1SrttU1EVRS0Rmh7WN22PE+oeSUtmJ7KhDhNXzgC69AdFS3Y+xAgGP1YEA9
B9s3oOa4gc5ydO7hc8nlJan6twPvy0PNyqc97oBaQw+Bp35vvoeAdLC89kOivRDDWlicG/jnTuum
zCjzGdyI0ywr5dVof2WBmAHHPArp5+n6TY04oTw5WXVT+RcUlFJzd2GKhm+5aZ43nnSkCb+8rxqW
zODFcApsQT1Hbmvr3fa9ZrGCqPuRtau4S8yH2PWkL1Mnd6OekYi3q2yAAolOTyYeKCKTFlhUKDTf
YdAhKPQL4GEvLGvAs/BXmVYH2rx2J8jc0nscsT3CzS8HW3vU+RsoPVOEpL31B+YrWEOyAiezpk6Q
sb6lwqyPm2oc+lFpdbnlAz/SNMpA/dkCvAz1qta+hlb9d/FZ0eJzWfb/dfsYx3DywDPZsLDTTjkV
QN5lEHwYKiPXL8tFQadl1iHhTLQ36+4oD9+gCMfwblytqH+TPgxwpzKTbb7rjIzNoSrKn0egighw
kkPx+HogXiU/OJQbnK3Z/2rAUqQvfOmaIq+o5UVVAn7Va69Pft79H+GpNEx9J3QoxBAXz2J3Klw8
7z3HuEtEHHryyGd6MW4w4jZCWjGJnKIORASgPtRCPKEPOLqC9VCyHrIdP4y0FJjWySLOEi5aZ/5U
j6NkXF+TnpCllI+F+SnqjWiXyEKWFvyfY1tydbwbrZW+CHcNEzPW0MQs8VBr9TZfKr3125alWIer
n/cdHhMveznPJd0mtKQ5b8weio/U6BJBkDXFo/SDRuOYXA+JazWUkJFavyTCpKM7iyi1OjOAMNSk
9cr1Vs5LOkR5sCk9iThJJq3EpEC7KlJnh8s9sEAmIpp81tTPuHxzcxWtdWe+zt3D1uHAW8CNtOih
c5MTjtyxw27Uhs43EcaXyNjumpBKY0c1pLlTXGG4OXmvGe4m1xpvkakZ1T4/12scWCZDjC/y4H33
G4MX5K/PgGgBO53BwMvPPORgJgeBguQmChFMNwEoHIgFHpQTiB+Nf1UEq9ePr06M6juDyH6JwXF6
CDKyMnq3p/LGgJTqKrQN6ZsPK3XG9oXheG6OYOBnjSakPleErg75uKAU/yc9zWmbte/0U444glpS
dF3MFBEHVMpDau4K5kfvHytWTRJLsHl9PDuMXUMrsFVPplWPzMOmG2UUk8KXVb+HMG26leZlLwsY
6vCCVY1ZWGy58xF4SG3HDSyj/Su5YghhtP70PgL4QQwd/0wCS8k0q4MC+S35Atvf+RKYvNRPcWTg
3NLrRJzVPgS0FCdgs34hvgPVpgRFtSkEtg6+Epdw0CObzYk6ezvPLulqUqaWegGW1k4i4RWUt6Cb
yDz47UJWHeVS6JoC3ylNearLyOLuexc/ne0kvEsMSKCZHSNcjCLdzbMuaPNSDR659aZrcJKMZEOQ
QT9uycmAjbQ898Ajn/JuEsH5LCwsYbPneBytOFtytawYZYQSvxDUYdpX2JqMTuOYNWzYRSdH9cXk
V8ZMPwJcl/5+BxEbBcEiJzVFsizvA4UBWh9AB6crjq5KZLX8XhIjY+uP0jV60NFcxVVjwP4ilDnz
jvAMp9jQsIr6K1NgUNaMB3xm4geTSyc1TbpI7B40ZVxkyXWBAM45kIzj9D70WltH7iPRaDe9ZNQ7
EKS+lkHwckKY1ZP4UOeUTu1kgqVGQWKFDqrapDFBk5wbBq9McvoFHKoWhNH2lAnkqHGXMqFL2IJN
n3EK8MDw2aAAQCL9Px+9NAG9im4guadddas8O6JWkcmTBBNezezaAE3bGitgfSuTlwjxOYDX6/Ep
DmvQJsSgni8yUJc+nak/fKIEbIYndEDy6E2U/8KHEtd7hvvbsFi8SBa6U21iXKaPbMXQFS0T9u/N
9AiIuJAcV7OfdnOLvLAXR28dOh8iqjtyucz2kK/TEYR7T2j0RhPamecFB+ASx4AlBia2dki89KUB
mf3JcVtl5SmVxz1unuwWyvWRuah3D0nvXvC5Zsj898Rasc2hkFEgX4vgii+TL/ohwvP03fiWUNgu
kxWD+iHQTOGVIUQ/7XnIJhqiaLBqFujl2CRuGtKF/v99uJyY9orhMuZCmx93XtJNmR6SWvEZVpW3
TqHwGlD6xyJL4oEkV3V039pIN1R4JnIjXt1hX5jlsay363DQYtswa5RK6jfSM6ArR2+7+JrQs4Gj
QZbQLfMHCL3Skhi+LQDjzZUpAYe4Nh0uj/USg6ty8GZxf8wG5H/5I9U0vxE6H/eYtT4cAfaCdrVT
agWPSXq3+Oj+yPOlkqWD0UsHfTd8UAp850vtcPLy7GPBvApdmaZ4zo+ph4+7fMx9FNOtoqf/qQnL
FtD+Bme77XsWkvItUb1CET1caQsO8Rpza4QGoh0pCI5RTBsR/FVDMR2D2rmA4Pp2mILJ96PIADSd
5X3pJXOEqlSwnaL/ZMdPCJ9722dlRn/+5NpFDtR8Dkh3N5aemUE0Kie3wdOX/+z53q7Y/klJBQVL
ZFhpJ6gVtRWf6VQcFDOn1IKonRKPQClb5laJyyZudKSoaa5A/Q9JtHrqBitI7pyDR7V3ZObBBeZM
2MVJBG3OogApLQxO2TSvyxibEETxUT96SMoK8yDikcvDjgVAO9nYpPyneZ4wEshQw1kRzjR0RN6F
x9MttPl2bX8xN0clKKuKlZQacqvMwpf0cZuOgP3kXBzE518mXJVWylIZt58i9bG6xZevhZ+6dhh8
r8sXGPl1wLNTn03AjyuVDgkot9qnr7HKVW5tA5vIDIRQLORsU5H0ot1any9pT7AsJSSTxT1D+mqi
uCT+3VuL4gVT0XafymcU5ac7sWVkdJ2SW+tpQj+Einule+kQ4W3RlkodhGhm0LTZmR5PCdKQcYRS
Eb8OeDFMozgF+fCZG5kLwZiJqskIJV/x7P4JU1nQD6dt7qcSv42lQbBH8VaM/Bd4F1ntrnyypXww
HO5NQ/d5Vg2B1u9/80gvBYPBtNPqH9thKGb+Ni8551ylKBNgWIPUgyaTWezq7cniRhFEmmSJSUET
kaBGrAaowlJf8wHbJ6C6+ccCJ0pK24qGQTcWs7N/UTR5iMYcwylSkmJKCosuiW+cFfaaYGmucSHy
JRl04f1Wr4DozbDCQIvtrBOPaunIITFsnDUUAZ/G5WFv9P4e5h10LB+5KTN/6cktcwarRpv1vKVz
nBeUM8LDhGAb7EXdx+wPrpfOFtxXj1AbwpyL0rpMXNCoRzBAlGhV7IvYNuE/a/xhWKIJQhliQrmW
S//YR1JbUX70tjepOFAe2u1ptTk7MHb74HfEV85KMQMUhHMvaRLZKrsSr5P8I78gB3QAbA05amEr
5CKRzQeM9fVno3dm0UD9cJ6gwoW5+AdpXjozkkOGGe15wA891wvZobsUDe11OD/2N5C6hryRG1mm
ZP3CRjmbduPJnwcnaVSlm5NGX1iiQ4PREtakeBSaAeK1PM8C0u3LiO9873r0eoVFcatvtUlH44fc
YrZgF0vfcCknDud0QmVPCo+B+h+bTB6fG5rQQB2DcN+PWavaRBvcngRp+RVx4M0h5+PJ32lyeQZW
mBS+ZTkxkxe8yyvaEEg21sYfdAtt7pCQX/3c4td00zdthGLpjHMtz7WqzulOlj2KVzWiiNjFSmhP
q+AXwLzG3a3vFmOzOLpNPwwrW4Taa//gZKSmNNaSTs69dMs9uqGf9cIlTxbvi04jalVzNkTebwMQ
91W8TTrKzuROQlWIgIW6MvNnXNES7ScYBeDLX1Vc6oCjoe2mB2dA3k+rW0QDnRAKxKzXmDH8SFhj
qdevpbP25e27AIFVWUXTeA+HB6JTeb3f7aleB8BjoP3sdb/sYP7LATq57W211qYu6Kze71zt0/jV
PL1zZbQvDI+5JmvvaYVw6as9h6QJ8/16yePP8IM0iSFBraOQSUCDE+DYAbwMv3jBZ/71j90M5K1v
sGJ8fCrEJdnEqPDrLoXXb8mMU6W/khgumuKjX0BvD6t1GfHoeuNxd91qE75Z1r/7zBWsIhZU/LtA
uYc/ds9oPPK+ZsYMvyQRHERPf6H1Ea2RRbOsiyYw03LL+jHqqYLCDVqLWlJWVBW1dmy5Yq8oh5Ql
b6TEvkIsj2CrCwwHPZYyAaS63uUSU0P5tzRQz55I+87FF+BTsaPikhtQ1U1dMsvqDRDGx2h/cui0
WM2LApRCnEwO9iRehzJwof9C++KBQm60z2qkE+gT9ti0gItfA54e9b8VvnjD/zRc2GHtVQ1CPiJc
JXza3VXhRUhE+CN9VuJH+yvdA9kc6Bm3mHtGEpVBZqT+EAG89dZXOO5sESk3GYfIBxa7GJsYUOZz
tdowohYU2U0tpFwZN8YBkEkwhRiWM61MkKIwz9WRskchyuc/hqeW5+nmPt3G2BKs9jpsOnaphwW5
aDLZcBlACRPV6SUGwrTGC8ZaWH1jePOO1JLQD1XsM7+6EnESSYLYnGetxjyzedmhTcD/SssC4n+A
TIEEryo1PY6SM2eFFs5D/Jye47Z9AxanbI6trbuK2FtGHUStbYnDYraP0X/DMF51xSEPAbVAfSLA
vrYw0u9itKkqwswQ+SnKWb4MwIdooLWyoUmHZmVft/IutMBDAMHCIBJ0bcLsGHjKzmjGkfMQ+jL0
uzbrQRFuUcM5djtvy+UNMMqoFNWG+KFJuML8OXpP1O1XlMTDdrwtrLbZNhdqFkD0/aUYuArK6ru9
xvZjeB1vZcIrPIcL3wPWj1xgfKGiFCPW51ff6LIX1ov5+87sd1mZjEPAmyonIFRb1GGsJLFIGge7
E97m0qv+AepThKqjYDtVC+3SvZff4NMIcr18kERoGXebzS1qm0hIyhE9K5h5ib+xlSeU9k/6kzNM
DWiSNtQRY6r9UvHw4kgir/xXM4Ar6UzQmlyKRWGM/wmSc9xdWozKhfqgSSkTNP7fuSwrlQbRHXVK
m3Ro6Nmmti2P5wKu+HIyELy8mr09udbRDAqHAHjl9iLeRbbBz6bEFV6Qfrg6yjoUoP2QKs4Xwch9
Y8LEnY5oia7l4+G2M8lf/TwIELHiEkfDzoLlF/MSuN/6y7z6ZexrT/IPhATD/DXAbMzPOiOeWwLY
vDnNfPG4CmS4WqjYZqjJm1QjKZo+0/vPGQ1YIHnpFRtQXB4NqzCBXmvzRpfWgdxwdxpdM9eRASJ3
rOICdNi4cyZ0aI53MijSZlR4sorSJ2pfi7AtNFYgN1QwfPGp8ivVsNWlMeYrD+znKX8gxw0NwoaL
y6OFaVv957EdQxKiGE/4QQAADllBmphN4Q/yZTACN//sg8UFk1fWN+v2TD2N0kbg3Txf2Gg9YiPx
F6V0oTTeO0pdtXR74MYekc6OM0gJEcKFwoM9Hhm4Rl8g1ugF/UkbZS3B+zVrwYgIZP2NkPzCpGaA
VwBZWy1oNIxI+vP/+CkdxkHEIybQTphsjjoRwiljwiHWJGVTYYnY1uQg5C+c9tvXW/O0oDvqFQQ3
xEe1rQSAPC8iJmscKcfiFnw/wzBJSCrnCMncRf9ziGSXZqRKPNn9YS5Kx73RuOPcWf+mm7cQ1Pc9
f5xR/CM+B3E6OsHdBbOXR8vhoavP58f/wsRyopaVL8vSutLe+Ozub0c15pv51uoKUNxhzEXDhbKO
tBsUpEgN8FhZvamBrbFyhS9z0ND51JKehbnuxu+siLC8+MkGZFmt9uFxThysUyOSdrk34ja1Pf2Y
UzCoqepkT0b0+6mBb2tphCOdHv1Wxkx7J3ylOGm6opooTWNiW9wmQa+QsFzC9UtmY6ghsUxG88qD
JwWDmSIi/JUE4us113Ms35UcdlXm3eYaE2E/Bf7lmoW56+q37Ewn8ZtH9/Y6w+UPMiHK/fx2/tML
lZmrqPLH5EbIJnlOSz4eFLdqw98Ey0H4TppfwqGXHj9346WdpR1MkirN7P8j7dMaVYDQKU0pydVc
7Q/v+UQwtbURn0xk5Zsp50LM1o4YaRjw0LI6VOVLTWYnqgGSldpeawIfPWo60TOxvXn3fZtRnhsN
fd4i2cZhVIpVODfDMnLxGWs6T2Uqz676vIeJlMpoQGh+t99ujHniLXl8Ck14TSKrRVHgjpKy3VJT
zX9sijnhyc46vvAprzcIG+cApnrZkt1xZk4UOrh9gPZNQ6VNlb2BI/3ghSsThX9RSLsxs8TUkASv
P+J+Z1DvC8te4cwDDMGDVVbcr+Jk0EP1jxLy8xrL6xyBlJ+CSa0e1i7wt494fRi9slhfBzcU49bO
y7c0ZykOEPRzvzXxe2gDxL4hT2iLlLzN9N2yGjj1jLVxwqi8BSN1q/i8IMOXqc0Y4SNlUg52fSfM
NHA4G7JCVbEjLASr3/ORdwoRfm76Sc+IWhJc+MihpvGBkv41ijdr1LCyT3SGgLHLdXgYZGLhdJMA
Zhpn6M3FGpOVTTDn39VY6YNaQxLyMv3eULLd9TnMidVfbk3GKamufAKGK1CMTYFrWBUeQpJGYvEN
D5zp82LkZ9Z9HUNxQD5FTNzXBCnx1zOETLpkaOatpG5qyRko9cLg4J05JJKRN3cAhMoG1Q858O7b
IFMjzumVhb/H5bu/8anXWHvwz4reVDg1tRe7bXfEkOMEbPTkUDnrMWQFdyiEnaFuRyPrGWxUWVum
0+pPPw7jjnljRNSZoU9YpadIJzFw/kK11jIFYzQUkOZOtpXe1Tfs3upVPERpKSwYAVuxCQxLX/Dg
VsM1RDnOZJr9cXxvikn27T9rZAe+iXyFTFkj9wyic/IwxjAwcsovDT4rKbq6eeattzFhbR/ca4yk
6rakScW2DwITIHyoCwxkz41UoLXZjvFlPwK7VX+DW3TaC+yxnejRqbZd012XlQBSt45mbBT+9Piz
HCluMC1POPN7zlmRxWN0a3oIHlHlkV+77gi+jIGmQtmLLiKsB6ZOZpllPuJkl6mOjvpqe+t3EPo2
Gsho0TdmosUmdv2l0JmZf5IVDFL67wHNj49LqqAeuPvOcP4TokB/YgJpclyXhUvLCXQjSPWVB+Nh
WyOQinyC33JQMqTLIvOw3UtyGWPtnC+rOy5+trwuya+QcKzmr/9nl07YluJJmpwOKATC+XT02JsU
lBPrs/In6BawTFBaJjZubVJbNqtghgE+9xY+JIspFi1dCkf7DxotIT23i9bL2YeWqC1fyKajgfkU
5qS9EyCVeNUExx79l6WvxeRObJ83Gwjoch5GfCrgKFI9KJfXVw6+PIkjhY+YjlwxU+jgApmVVPfV
2kRD5Pzmk01TrVUJI5RKTKuPGSzn3W6Fh6wHRN5vvZM8pParY4qBPCreI6gJjpa///Y+FkgHUyZq
qHGdq1Zdi5FefcuvVNaE7e4ZRYLHYFQILfhh52e2WqJYzC4iRSBLm3mtPTBzUR0+zavxWwAGbGG9
HZfulXWfXmgjmruOyEzLE3axI1+/XtLJgDzXtIQa2d5jWq39H2evVT3qKXPdjYFK4wTE7jpyKtG9
TFOOyT4MQnPRrbaZxyH1oN0zC88/RjRqfJWYQD2fbRqo8+BjSG/hOYrM2NYJHrpruEFVKkVaXXRh
e+Z9NcJpxRr60dy3y8DM+5MGKbp/SUKof3LUrYmKXn4oy0ZI5/CFPIdlEicXP1dQptoeLsapICDL
PXDTnHpi6exAB/dPgsbu9/15fQjOTJ/u98MkE1b0TeYf4ympNOnX6LmHxk4tbrpcVD83mDriSHIH
xCVEwfbH5cmSpdFJfJKFo3+CivB/vsHKLW9uRc+ymxrFcC0qxKTqux/1rl0dDCUTk2YDSzyk0a9y
BwASzNHmN3tIaVxzmIvtpYfKDjNO5AL8sWxPRWCerUY3W9+PmYjAArvQzAdVt3XIKplgaWlTl6IM
AvjWHhY2kxfEF/H1Ct09U4s/N1iBQtlIC3ZJbRKEEMVgOFaVH3x8xhzSB/AVXzVzsnX6cNZRvPo8
/cWxCWiTcbNzBw55LoDb2GFfu4eNbmac1e4ydM4nzbi51RVGizbNwb3iupFO7w5a/9mUeae3r7Eg
h3Gav8j0xTwq2wBDDGjaT1YEQjPFD0YOqbs48A/CTvVHaQxUV72hennzU4LTWd37tsxzydtMjnu4
mS4QHQNJyJ61PnrwXbzxCFzI6TpUZKoyPNUK4LxS/ryrkkFVQ2PU+tyXOlL/2/4nc44iNVhTbAAb
w6piOvUTqj6FpCoLdy+tSI0MdQzirIvC7d/awoa0YQrz3PRP73PwcCXreNlER7e6ocUh+QouOaik
wY99EZ6QPc1BpUt9X4+5hFziWQQKqpkpeCnFOHX2WTpQW4ehZx3j1mwqar7dqIoa+J3YERrh3bL7
cBdzIFiuqldrtFr+fmd8g9iT3lglr3ohtCy61ydMOxLCNgKxw4fGYrfll/BAhGAZD1LhuUdM82y9
2hKne7tu+Kpj8Rf3I1v5MtWOLbpASmq1PE0RTuy6SlvIhKF1cSfNpdk8NRlA5vboICOieYoAnqni
UEtxykFACsgbSBeb1dAxo5MVICCBmgIiXSCcTjCZ9gYm+VJQsskb3DowuT34GgzKZgMgGgHLXQBQ
WtnxYfdYnf+KUt93uZhSooKmh1K8Pv7VRwjWNafA6Ftb+QqTzeHoBGwru/NRYfK8dIA6Bm4heSyG
or9K7qj8MQChhsQknsVs0Aet+Mufxs/YnwNjLJ5kf/GP0nKzE9UDLrFdsu35/UBJr3QEoQ77xrtH
1T8HbaOamxrV/qiR5bH8IMzS6C8zgUK97KgTWrHOoCqV8yCqlE3mtMZUPWCtZQ0wEy1zpyPnSddj
I62eF8uz4wkF9dF4I6VzV2iiaWTKhPjl28/0mY/R3UDROVWZ03IxvWczBcBVP9DcJEOAKj20Ft/F
8E9LpiJ0lpeH7eMd67KsNiAAB59DUSiHXOdCYUPWHw6njUiPeVNGW90gRSSJNyNj7Fk4G1Q78TRD
ynGPy5Zkeuvuwrmlu3KizvLQdMwydPU6yM20E6Nq+4LM/lCrYK1J3ALKxNqoagfKOJcUoVZC7vlZ
0qRKdBD8gQwfW5wpC7amh7Eq0LEJyDNNWID9E0Vc1vRQRq3GsGwzou30u5yRX0NeJaAlIcIIhcuM
EhkBjBxKvtoOoTNpkLtotsobiYS5zdiK8VVnwI0jAQzFTzHS4A2G+TcGcyhNWvn7XrpqIthc9sQw
TNVnVDkWhVZGJgEHVLARIw4LNL2aevyWa480qpAjBfpZewWcnyiQ9WyHMAKbSWMol96Ob6wCRjdu
Nl9quR9bRA1/2EZ+YZCYZ/u2+ySoDN6YoFLhVErMN7c0ILLkxNiUc2jWtXHSxWJX7xvSueKHTHs7
mMhRFE7QTCjWGODPeyvGi7sClukjfCE6NTgQq2BNF5r+rH5zl+oGaiHT8wzXagJEP8NgHDaYh0Mg
H1aU8ahs/nD/fTwwEP9QNNTdQUczCzpli1Jpy9jsWtqNyj5IFqtsty61B7dL52rl8qUlbKzomtbz
RPZ7U9w12MzeC9r1Y0/AYIJNRlzHW0UaqfsuOPJrucVaUbralbbGf60BWjRR+StgAGkE7IWDWBlh
26XwvHPwlA/isEM+tYJ/KucI1hUTaFXVO/0SIpoER+6mi7GNbU4NgsEGVMVMKeBT4Q9I0gFb3TkP
IJdEDUg2KlGVgA3I35e5dHBqBbvnaM4e3wAEekWza2f7QEI4qh65jYcP6a/jCTHTOyL9bRO6c6r5
dokvTBhbm5CZrHpdcO5uoFj1aoSt7JD+vj4+O0ufccJ7PgSQPQiEewk88colK7+WP4crWdr49mpR
jYU++8KJB6lEx2uMvQ7dcPE57hnoQrBbL5HLYjX2kJxGhywcpWhX2/kalKwXB+oQ75g+MnwTGpbb
KV24GaXXL9YJuKvonuvK+popRZSsVs8BUvCru5w0XcCLCS/RDt40cJsIBAGJa/pFIk7CiuyhziDA
cKwC6DFSFYZxej5j4VarSmUOkh0Fj0zo/VtZd8bJ6EdmwaccGYTbDq8vXyIZ+inqrpeQGWMR20m4
yqG+UdEqiol5OWfMebt++TMIuXWC+hJxGjTIenkHgEJWA6BcDzOxk193jtvynhDG7iHR1PR/sPF9
IAxmVQi0C9kAaP2MhxUI4RHORf07Tnv7q+28ubj7K2MSLTn21UO+rMpOUUoiWYA48M0Cu1ePiNfk
iHMNt00+MoeAl/S6XBr6tHIbpD0m1YAyVhUIGRuwdUjVkHsDBGfDLLEYfRhdAAAOd0GauU3hD/Jl
MAI3/9W0MmebALZ1KerqTYGi3+w5RHqbEyU6HT828zInUYlmTu9TrPTTg+tkxNdx8IZut+XBIUfH
SeYAiLy0jGau6KHbDlDx3z7xUrEcwz0i/65MgkYq2ZdkZHrZnsn4Rl1e/uTZe5R1BXT0UAXTwcNc
MoRWYUan5BJSrDb3DSfpFjWizpEUQTFleWkt+PhWNFiphDSUx85gMLehNlNLke/5A82QuD3y0ERK
5vNT4/EiXUTH+Ggbp92hv4ypXVkJCqpHl0ykAurnaUa43i+Q3zE0x8OO3xLJ+8OHrfkKv4QUUjgX
ZJzO27AD214W6eVagCYv3g/akHH12u5iD4MRlFUctyHPf8VfwGNb/b5zhXzDDCDSFxFimfU6+l94
ReAuqwc/7efOB1Qgi+iAyeVRTtni1onMP/62OrtdCIC+itwrLtYUYwfwnilQywYa6dcK/gV+Cuje
oZdggGLEcTWjDsv7zfLF8QXjSYfMybm6P8nOh4RrmX4VcCLETWcwFoJdgRLePOtWdWBtlsEop3Sn
Ax0u83l50iV2CWEo38Qu6S6ubezEUjyX2aNoMShhUga/n/UvkAqVBqNU88tqHD2KpPdzOnILPD4N
LBr5jXQwPPJjq/lAv4Ama9o4KmtOZwmxMNstpIh4hKdb7lKxFIE87ilY2wor09unA5mhOm4Im07t
L704BEuwzkab2ymtuvsEiCBkKEIcabgGSzxrTpWtRGBR1keYOMOo1EJwnxCcpbwDj+SGIn2AEqh9
JzL0wkAUaWF7k5O8OvPTG4l2EF4c3OVwNFvyMLKDvKhuFcdv159goGC01jqUgZnDQoPAzueVJsvD
/kR4hIFfbm2BsYjhZqfNmKHwCFHskmXkk266+EDL/Q46hBNQIOepGNfQ03tR/hrHWalJTIV5xsVV
zUuEWwH/p2bAfv0zse/NMTR4okqOeHVv5Wad9qmBD1SPn7idbg7u9114BHA6KkkbkBQ7mQiBYVSb
tD4WqHJPl6F3jMpRsXrlXogMAaLD/DQK6/OfbD0kcdO34kv6a1RyRPxYlzXsYB8J9TNCEIus6XMR
0xzuGhDv3K/Xr1Wzxr/989d2Muce0bPDgzXIFi4owhKooP5MnvyiphsB5K3yD4bYvVyhWuATjy4+
8E6gJsyxUKT0ew2Hc1f40zh0DAEBCw7wzZvsDru7dKK2zuYUmrTGOtrpn7D7UcDzDZNXwGSiuLHT
hgKwc9TwxX8X5ccwiqfIXTUkaR31noR2tdRzZsFNKALyzEYaZih7PZi+zP44w40laW1HBpL7j1/b
DD57NSB/CSCgH0YGVQwkrjNoghG7u+Tkz0MOOxf5uEL/ohT8LThlqWJB+K0OX3IPQefM0sxg9QHk
0YXdquFXcjj9TrVdSB67O8+9BG8Wj/vrBIIoPBbDemd+tHEkxncJ05ZXNFSMUEnBC/5Ias3L7DF1
MWXdh4NeQRmxDvhTMM1C+dBo5qRHMmLdxcwHoxtsJZhjfp8A13ctChOYuW4AeCCbv/xoYQd9d5XL
zIsmq0IxC1AAktj91GWyx3ziYfnwYXNKr5V3n5z4O1XCvvSmWhKEmMxdszbk9HsWEGTsSU4YOEzI
jwCFtwTRkyBoSAuH6x2WE8VxG30YCcvd6kT20AWZKT22JwckW9FNM1Sc5MDgyXXo7NH1eLlpL8Pa
JRfhjvjJO0s9K05OMTLsffRCA/t9+6xDCgjLvuLfDm0Y8a6qN8akiUGK9R0saBG/YRKAcy3Isi+i
DCfe0qfluRSxUegpBjq+wtaFaM7fOS/Q37bsITHiRxq4TUoJBayLY8ckru3yFdz7AIn3K+E9qZG3
daNmDS90g3cKSCify4g36KlTXUXuls1dW9jZ2L5Uq1twrYiSOq5Gteai1dq9cDTwVoPvOADZpkbD
iCdnkQaqxD7A+3fVifvt0lncM+0qwExoe3fYzsjaGjANB+GA5g+YFSLnTRGgKzJjaHTgJs6q3Hp/
mLgccV2nBHZV26QxlHDQbYwNIXiGDr4Uv7PUi6Ir1bgJAvJnikmzRDbqb3G2ixBCiMi0iAANJOKa
VzhALDVqTnixoIplarpIuIViu530UFMAK//QuFc1MRdKnqeu13xIsoqwNaVDuPecEKhFJReLKYCt
TcfyCdWMNLi+AEaByf+GI8vbaWKIVVMOsLnpYXxpTuJZlwwYvbVKhAw/Vfjs/XIfXc7gWOaqxnKO
GJEE6DQYxuJwYamOKqk4qC74hjw+zQ6PK+Je+zu5fNkOau1L3EBr9cmdEmK7E5eGVcsa4UfBrvld
v8GpscTqpoKaVZrxRtAnXD7Wxbnjf2fnOxszOaUEdvkKeD8MTr5U5EkcbC/HPxO6pOjxNlMDC7c8
uxNWZXzBkTxnOZnPDlKsPpZxHTxOrTUXpyy7Pm+e8xzI8Fsydpi8To8BIIsLqryGwWdDRlWoq/Ko
u/bCt8sOW1FtTC4+WiYzGEQUBXaFfCpRcG+I+Dk2cTVIJHMkZM5pBOfdDkX57MXJvFl6zNWVIDqD
RaWSwNs7VVcUum/sPLesgao6OknovCpO52W3CBwePmOKtlKulDPDZOVV8C6v7a7UqLTyq4ZD0InB
RMHfhQXV3JUJUySyytrmPHMA3h2Y2BJ+h/196s2lzE2eMcHfaUILpQqdfTbkKvjZ1KusT6f1Nj5x
3KvfgSQ3stMe3rIjVdLaYUM4FJwt+5l45prdOFXXvE5KJ3QgRtGWmCNOcHeHWxw6trEOg/I9ZCOV
AhNwsSzTmSmo6RbMhqBZFcjnXagRe9psDIdm4RGVZ50vWlkWOQuus/3xFMQ9K4zKhBLhIEmstpfg
3sYhXvqOXtiHF8CLS73t2Xh3YH/vtJjJzwrZdbA8c9SUDIM1u+K9UMWEmEmFX0yQ5TkF1raf27D6
vDyeEkx3OvrEGEsiNCzwc8dJW1muy1bTsgkxS5GGO9GiLm7eARWRMkYUr1RWxJ471ZhB1ugRwtgu
v8V6Zl8Kt29ZniTMyqKqKK2F+jDWov2FKRHDrPOgZwRmhsPtdjjqVS0RWzYkdpwEWmRNdYwuUC9v
zUqWC6mAGPMPk1WQz+wpJiRVRto1QwV7BdHff5GzczIrqsq2+hU4vI8bX0CYpSpmgrvexhIuD8Pi
wSyBhKw2COUtjEPGzTXoEne7bdBSx8s5PRzIUqo1+VcBgOGHq/Qw/6li2CUicvwYtZkJYud7s+te
zjMWogYeNLDFJ0qpBQc7TKAIO1hfkJzbNLTrYygFtavhh9rcTBScrjmGkkmNzEwRopexquaV4zVu
I07CjnPny1eJzeqo6Ohrmkx5LmMWS1BoSFjr+yLPnPN0InKMLxhpaF1lRK+Jo+1WJc3DsAPgW8nZ
ubedSuTe9uwDSYMojv9gyyvbshtP81LvpTcxUuZOAFYBaHKbg9o8S9X5cjmfkJtyGYig7W4JHHoW
qqvE3QQQdtKnQaLl6b3RbpwTNu+aIIsk6KlKAICgB2uEVbPfwHXWxuT3baSX+VCTBZ+ABulARef5
1gRL5JKvXdnIa/GgPfTm9y4Yjiq6ng76D9t89v12Qsjva1SI/kbEttPbX9GAbe+1h3C3argqLBUP
uoYzGDqRDeZ7/qmSjdl6CngSL5381PQ2Rmo6NSL4XrZhuE7+/JzrLBi/+M7qwQTqxKUbXgSP3wv3
9pWpg2nWVi9LDp1Woqxm6fdNH1CTlNNPil4gwWoiO+56NJb57+fpEF4pAGGhSm9z6MXAWagTxLQ0
/SCs+pO08De/U1uEK27zNH7YYPItOlYh5bzhw6ihwAF6lwGKkmOVBq/wkRYAfNcYVL2YYeot4rum
ZMFkuwoUI+e8T+NU4+zQHO8CezzB7Bb9f/PtigopKoRXiqfrdaTXj5I4I/dxIO9FEH4DIUld9OMX
RJr0vqG15AdxmL1msDHOlU+AbOH4ZboV8yLp38OOQlsx18P2Fv9lY9Ta67cA7YwT6pS7siWRo3iP
AE4FJerllKOPcejopfXDFKBsnMvnRHeaVhin4O/Aa3kgklLWpTXvPOFtwQoOjihQX8shH+ZRm+hp
cbANiwThYmNlXvMECkziUwu6VNbNmbmjICbqJj9Y9VOfg+YsMtAAWW/ouMbxGH42BgtGCoi65zb1
M6CQNs9x/3/1J4vndpvqKPNMNBdTQNpztsPqAg65kvtQTqQ6T5EFJTFLxYUCc0sbmHHaDKDx5XYc
HnViqs8WKN3mXg5k/5Lp/+e/S/mID6MTGv7hNZLLDErDCXnQMz4s1ZmUG3N/4TLVvb3KZzUvILeB
kPTS3aGU8kMBg1XNpyyev9H4/kZykJhgWBTb1X9IBgEtMsPDP4szubSfj6Moh4/bULgv1ax/hNcB
+hVl5b0fCyKCqciaYq2qika1T9LiItOWKbDSBYMK5n24Ede7pT7AccZQu8cJ1rGBWZ6gseQT2TcI
ZwcC5LzfecSs/hf6QMdTmnrjl6c2q/L36UZU/rCM6OZnDJmHNvPUk9OhF+CdEzIer8dO//G+iLhp
4nivCw7AWtLyL/XsL28oI2MhqtrzOfu3Z0+o/NQy20uXnanYbj54t4iJ/y5qHNdaeTcsqY7eO0lZ
684aBrFh72fG4hB3mZ5gEQbURzJmDY6flnnpofQkNDt4Ih3ca6mJkpXy3AjkYmRz8Wea/HaRmxlj
u+VyJ/6mwvSciuq+K0xaoGRT56xgwyHo2NVJKreRbV7S4RkQ2B21Imy7ZAyU0pfDcRJ/HoCTyVI1
NmR4rbqPIiDLkdALvdi/TVw+reqT/DgqVlNjKNZnPOkg3Obe242T3GwgbhUlfKbuSlK7Mf5WjJXf
y3GMWVAy3vWY1k/ivEmiNTr4n6+hX8J6UDAHmml6xmnBvLgLXZKRFut0QFhPp51jI/n687qsL21H
tXRCdA6moABoHuAwmnk0kxmp+D2/6QKgnjPdJ01qkdYnSrgIR/lm/3tboRziI6AAABPeQZraTeEP
8mUwAjf/7h4KkILKelL8wAzLbaUkSLnymVu6jBXH49rVrbVrSdI5Ply23LjifCoo/rRPJn3CwEo2
XYAnH+vTK+/sXet1CODIt9+9Ed/Iiw/KgmR49m3sKiUxoqnLIe/c8NO0GpwjWqVnf2X8YiUOJjUw
8J/ulFyM5jEwl4Xul936M9OOL4xv9UkzKxk7RQPGtZOu/Rsdmx6G8X2o4s62x7AzpgF9le0EkDci
Bfvne1HXEB0nhtmCUvDPFIrv5G2AJzop5L/JUZEs7o87QnbHlaD/9ODtQKixHtYXUcBnkvbI3bGj
xE01Osc8gYs0Yp2YzxfmexjxYmjKe6Mh4rcoNqZ/wgsflpAnYbNbWMYdvzmcKAU9y4ff53btgQdd
lvc9AohWSiifLatO0g3+DCl0Rvi7gCddcIGCKZPx3yBG4keuziCsBytJY8ExKs83f6Z6Gn1uZGHN
2Rudnf7z7OSYRXGPpw3VV9X8y7CXfoTycVJ3BRCuq3SyrbDzwX4OlrHq2TkSiECOv3ZyViO7ZsJB
07ka/sawJ2udPg66O4XmckuuSlRB8NPu0mJ0ZjpCqYmAniRhegkNyLIoSiAYSQRnf1otAAdtuyYf
vuxk7qpZu05768m3zuIsXqvKy3XpdPsaINbhaokU9xb2YBzDogoUvjkoZgyyObIxkudOVaN6hDN4
Ylp8HVoE3gxLkl6KcoKJL2EEoOnybEJGRaZm6Kt/ucHlVMaXaQ9vyd7Uw5NNJEs+gZfjtHbcgLRH
oUTOteK99voNI1Xg0JaGFWtv1qtcpmoSiqS0KZkKsOMRr4LUY1klHitKCFb0NOaNRbVS4r66Sq38
5+OQ9f82rLZjQ1VVLFTA3jr2g9A0+UmX0W1q2fe0eIpgtcYqmAHbA1PZmd0i1GhyDRV30zGIsSM0
FcT0pul+YYfLRcgWmdKafpdqT/w8Fkwhl44dBCQfwMAUFpxyIm5jmCO6j/oBR7SGeOzVu88vVN/z
X+9IsJElSra0usxzz25Ez7a0brX2JM2/ANtCvyuLqPJqakNul9s1ZNk6q0LovBDiCIIE/+PCfnvd
OUKvffGIu5TY20SSS7TULzbXsW8VOnY2gz7k4nmoef1P7TerfLWBFoZ+e4W321pAe9iy1+cCCQ2a
ikDQUHBMShbJy2gRXiIJLUE/C0kYOXFtA7h2PIvulpiNZkzD2BGK+EDwWYztbdhJUDYQ/FyykPdb
nkXX4P6M7GBgeKvjTNVu1qZIwaVj9amUeZqTogBeMdIKfR67MWpbRcoi2AAjKMGt9kshNxh07sEU
7k2xcGMu0EbdidU/p7dAi3e0BEptZR52zFfmTrJZcuoKWFMXfVrsl0E1hjlm7bbilQPA0FDvXwT0
tkFKYzDOAnwcxhq48dDc1FIpiHEcsz85m95WfcjleldFDdEEnty1EqSBZH8nTgM2ijUUgnPdGtd0
DW2624wRFV11A+FUxl4GNDNS3ZBK6hafyWEzIoRfyy821Py5PPpn5b2EgrPtm6FlXfBVmjztpy9x
h/7tiUi80uDI+jsrruNOxUz5mV07vYLDLgJ8TFQ+2B/7iEbfoxp9ToLN8HWgt24bR8XEi5RDFX4C
iagTHT5hHQpCemiY1Kd5oFLEtyKGOho7cARqGFV6gCTXsJ6tXqKAppUoybj13erN7XNLQUnTMyuR
KdxHiY16pZQ+vryB7KIYZZkG/WTH5EB7IHhsPiU0YwOnLZNrzQrBjpPdU7INNAwXPII7FwN910ao
z/LOOW46k2YBMNDzUAmI47niz2oIZl2OBFiOfjwPNqcpaLy4lbRyovMunxRCB2bxFxH4z+KNr7bz
fKU7O5JTAELxt1DiHKmwzc9tM255pCRcVUfz5PZdR6YPA8O3Of0z5e3QCFYgbyjNWSqTLUUv7abe
dHrarFlB6YOGXivFLlR7tBJ8TPT9nPBh7Ahdwis6+ckVAPGo+blvBI63EkzJSOdGg7QqSUaP6lBa
6fK/VCX9MkgQMzdncuRfMTB/30BtrKqEO05deLPW+Z6sOdEoJXhcmOBarrkzxPzd0M3qfU7SJUs/
duuvt1kY5MvR2T8gzXiDPokxS/+K1L+yPjnR2kDSmQvsWyQyTdk6MPfgmwh++iZ2DVIRQMHVXJEy
6TnOUcjUHUxoTJchClG0Qh5DosLT2CEaRnF+uFLeBDF6f8Jm54JljIJ3PDDuH0u8cxZOnwFJ8ENh
Foq2USQ3zaI72K8heiUthvZhNJu5vwCeKSaNXY1ccc87gkyh4UprTFyMFowMi20y30GuEnE7Vaa9
SKQmTdWaEy16vZrRa5AWw8SWGlKYi2zuuOY10whg26/KbB2EPlg506rYQCnNHnpG7WUzmZv0hx1u
4olBlhPwc1IQJmA1Cc+55ZCWbZBzqug21yz3SNoBn95Obm6imnAGW4Annv2Zrd/kkXvNHl7XiNnF
CFTyEyDODaM2qhIvTOZpJwovT7jGMLYQnIxJ4gYhhFgyGe+igrnkFol4d1kkBVtYg+PPEOSWQXGm
D3fb1yt6CthUOu1ot9fzpIGTz7PCHU9mOCz5VhBInEQ2vUwlIwSX419N5yXVOXYuNJuM1AQMxFG8
3wGBsEjwY1hrJcA0UvLEDPiGaoG5tv8KSS0o0xG8maWXY+nmIc6biYt0j1RetGHIbxzHxC9v0PH5
0yFSSl0TTRlRSh7/hhE0aweasSZrMIK23QEU9/BO4dznjbsGJJ25uWYYJupXXrd8uPayIwt5B/Ig
kwk8VIK5PXdk2Aa6d2iLk3KmkTh6jqpKOxrmf22CC+HIPjgxaQt43Z+DZYwmjUTqk+EP+1qLykGb
XqLir3vKfShxOypnfLAT89gEy+l5rNmrQinjqmyElEucuBbITqTx+gMwY/c+E9ViTKTJYIKaxSzq
atuxgAiLnNw87Ens+RotNVbTqqchhpySPC1RNoYhZtFsuCB+sHxreysVpm/ptBwvJvMVv9lgx2Ia
7x/euDbjb6ATmic0/IO/wxNQ/Q3pTgmyj3OwoTxddXkZfL/e9TD1qH2VKkUwTisRhpT+rAE/HBnp
85HX65AXNX1BL2K+ZYO+vv51j8XEo2p/7eO7FV4LsInZwmxxeN+CDfbpwYBVQYJyLtvFnK+nJFSk
HMupkQTccp+WSv75QIQRK/3jSs/0eF50/l03fxAeOEV5/vWCXOzJorQC2RUzqJjbGU35m73p6iUs
4k5izymkjfwFEyvR1JqRHH5PF4hebNf3wQCm0eXejSQ6O9hHg4euu9TkvPdVO8Gb+fgI6YuQ/LsR
9yUMYFCLyA+4cGu65uC2TxVDOx50/M4mQRnEZiU06EjAOlFtWmELQZ+Q2VTvAghXqiVPQozInZ6G
qBPvmMKh0VAOkgEh/LMy5rInmMzXTz7yLnPNfmT1j6vWda6T6ea/J28GkvaUWgpdHXCTV5MTUluB
QcFTVFyvEQq0dS7D23isY2w1QXH8zYOQ12fCkoCKL7fmpqcjxLzSkIUozAuITcDutlGI6XkqQoEe
ZkHLgM0nd8fxJReD85jcfD6AzcoMAJOZ248pndDNIA5ptCDZQqnFB63BASWDdXDpryodXbYiN/1X
Vrk/rSjUSA6eu2nIw3chLwdM4XgvYUl/kDBpuUY/xkF9bCsbpCYAAGES/kVDWgn3bHAf2oSh0K51
24jnGLPxK8ry27pEVY6d9VFXJXt/KJR2l4sEZ0wQNLZZJhG7uireFB2vdu/Ql1EO9ii2eIKXjIZs
mTUfPG+aeLnK0fWM+qESKH168KxoIzQL1qUz1lqfJN26w20jNk9dXWSKEECJZJyKQ/Q2U2QTRBDf
dHCy1527iUP/vDtLaUypdvmeWMB2ZVBC30giZWHu2o8tzz3mIqsFLXuZWehGXYKP+PrBgFmktVTV
3xXlbNgrWkH7Fd4omg6XEh0yNy6ANoi31ea2QyXEw5DbOikw7UnWyKHIdEc0fA3Ggo0JAS8n30/j
lt2YeGhm9M16OnPcXzH9nXNgSDBNVevbUzI0uXREYfeo4miS9pijnimCHsHSv4EHo9oF8rTuD2An
/Z7XotSqiB5BUU2eI4+ndxP+lbgAltImXIIfvFiqOINV+rNn5waKbSO0YLbAwnME+PFaYj43xMBl
50dqp97YJ0lezIGkXW9GQk1MLAEKj8TE3aC6Lzm5nbhYoXNevRU6XFB2VgsGu8JzKjpgnHVvdxYl
gWDlKoHTZ+d8Q1i+SemRq9dZmHtLVvVLEQjXxdY9gIreOxclW1mIsl+ciB/0NNAExMWYTgnDsugT
0wNxJpVIxomqODv+SADUoRahCmHTX+YGd6k7OctDgNfCjJ0+9IYgAXmoOZOO5Z0oI1cO/B0Mhvia
ytgmpLrwpOpJ/uuS8+KNKBCLQVexaaxdqhb8mv3QjJAIPfE/3xApeezH7VYx9vemnq19U4Hpg4Tz
BoTBv3X1UiH0fLKdIY1r5G+oPDqXl1THsGq1thL3p6wXr0MCDXkyrie1nkY2+rJHZSKNKpl6iO0J
yONAdCAGBp4hSwCr/ZspRMhI2vjXFTU65dh7wWJqAcYEiD80OuhQLpr4avKfYmGPT/4U/Oas1TZG
2AX+k8qFjCbRxP0iwP16j6P2AlquH8zmKCVKUXmBH4xLlkIQsQw7Uiju9u2s8/xEjjT4cSRvQ6Ow
0L7mHXiYiLu0naqFGpoPou0edwj/PoYPoln70iNiBGSSYkFijmGJRh0YE9LeLxh5KSXKOj31wR/U
UstIu1T8p0AAeU4gxdGoiaxAQe9/NzDUhpJZBwv5/C2f4tP+QfWn0MgB6bjEP6rfWM5iAEPSTeMf
neRRSL9AFOIrBmiSk+c2DHMKY0ckKBEhkrFx+GC/33+R2jxi5RChHY4w1BUKVUDFvyi/tKxfnRMo
pXoDemagokbbJfklawGVW3XHWITP8KwPuWhwTk5GfOWEKp8w9C7Qwy058kgG4VJvgxifg/jvW58n
zpTEjSlvlBdVP3HXZFOYihagZWrlY3us3E4i/hO1jnSQYqYgmylImu5G6jZHe+8YDYp0UFsgJGTZ
QNtjjuYFqjB0XOmBGYNFth31SOmnmkiSKZX2Xil3rOUXZLrNi2VFMqk5pyMhlqlKkRAJu2kSGN2M
7PTiEMMV9BKrdTWXiq5swvDurxQYmNJqbXZyzoaCTO1CG9Ndd/fFDqEF5cL/VtG2cv8s3SltIs8H
JApOwHM3lOnApNzTIfo7GCGRcqinrIo06OIoYKgeJXJBfgA7A+6P0uQ2bj/U9F8hsXfWpRN6Uism
HK5Ep778jhjWyMK1tSfCktd6ApP+YKaAQKMJA+DzFkLjiyK3Zc+pRouLCf3zmYNUumBWYByRYk8N
x4R+O+RG+mmTvc+kJyH2bBmz2TW9ut/g5ppE8T86GnDLk508B8cqmV5pgRnjtYab2VhMiyWhxTBy
BfcwUIWo0iomcWlUyVfC4Y/mYf//1ETVyN5mY+bAp9aVOO2Iu/NkmBVWcubLfEptcrSQFs+y5DXr
uIlbFAcbi047y0E7Qr5ArLgSjJI0qbiwUsMWmhinUuTfJme+FDckd87B60hq+XjivFPFfeZb2Xmk
S08ZtAg7BN2hdEF+mjIRstCFXJCgkO/GPJM08etx5TsaUuQLzfFtrgmANohz3e639VGtE3NPd8bp
1XmeY2rBHctIj76lNfLUthYUbpuFduvgX0sPDHek4QysbneZG5aBA2MVC8x7rcnyPihw1z9kIX8q
0feFEndyBn0xwpaZDlw7EhNBjYNaLNX4ZkDO9s33VzdU00dDzWqNXnpId1uk05Lbv4Q1w6OAkk12
S0bMz7yBgmDrCQ8kZj6PZs7Rx2NpbmZyP1a/3h6k4Gv5nBkm/dmm0L+eY4kJrJZGmteQHs2MZJEh
77NuYsJDMMlwahTt46dvB3x0EUFVHX80kxLGQEI1EWqjRQ3MNAVPUSkAcloxJACApJ8f5vTqkmV9
Ahg+G2krEGh2A3lqLyQ8v0cLTA44jwx39kB8t/c/wPLkxBmmCprMmQwBNF9zqXdPQWlbzPxTsqvq
jyvm5Q6+FU5jmomkfJT4bD4WiX/UebANKcfg36X8j9c8qpgI5B5BpBYoSDzkVokaAcEfROVrOCCT
HgxPai9LvB3tzTTLlGDUXNdkbuiox+ajL9Y5Od/w7ka3aRMUQc1uGIw5pSIyIu1mUp1AoZmANTLQ
SZ3x7cXfI4Xs/BsblIVK4XmZL7pd04eOQQZa4SJESisb5cPyCowYXwDKFWwTV6LUG251A32I7NYx
80uFbwiWLiJTePZU3TY1XFMIrPSttL8k1pb1oqnB/xDYQQ4xtEU/HpgYuiZgN9RClNMiGi2q31Id
UTDL9fSlyiNPsZgbPXM+3PdcNTKqUda2ok3AyHN90LBmw2lexyn9Px1pbggRONOZzUR6cCUmoUS2
ZeE/sKnWe9OmPQeiZol1cX2I5/eCtCagth6L058vU1spicRVEX/ALRUQsLiDWgfG8joVedjiducF
t5uFxQtjAHIldmQgqhaIWV7fgMUML0mdHR93VvO7gJ0V/Nt9LiSK/J2kxLOC1tY/slZ7OAqhI1IK
5VNTteHOwYmc5ahpd8eUQHPcEFI2bwD+8K0d8txPv6z394HdB37xJbBzKzE3NP6FDYhdAym7n9yi
Wzim1oBABxf9wtwqpu7TOJxzBYwABIqDaVZnFJvPiXeFhINYAe+ruOgRsCKmMb2a2r0bqJJNqCmb
jjSjQXvqmXjPNNbPrz5lMwhneyfTvawQwQfTr8XRtwT6/7QmjUISlzuU4pgsNP0STACKmL/zaVMo
Boen6rMKtQAAFdRBmvtN4Q/yZTACN//MJzoDI15bFQ8rvX/4LBd2vzPxr/+JatVu/lpRY5sGQ9yz
/9AeOHJ+reENQd+V/mAG/V3vnq+kQesWgoIf7yUSyp0kH4TR9stSmUdtTGwnT5T+X9dL/HXVNi1+
EF9HLabIwhvcrMxBdEknHCvi0x/NJxPG9fu2oZI10fWDVV6XvfzRyqJe+CncMmxFWlqXboV3Xjcm
3rVhjWRXCopxg387bHW+OXwvrDJ1P5Fhol8pWWfc4XusrvpiqEyc5pew2PRVjOK55o4/NoUuVRm+
1sOso1biFY8voNxOnhnmS0vcnuVri9BC470r/pxS9W+r+v1nmu4X4pggNYv9oRrtIPJXOXxvRDia
5a8FhNT1Ta0CxKmGyh/e1Tzr4o8r0XduIZcWWr6hkFGNLfVNqjq6r4b/AxFWkLj14B+hou7YyUsW
NuNudboGNfss28xmLJFeZ6laKYFNJDspA/0DlM2guJH0eC6h/FK947AqK9/5B9I+hLXMwvbtcg2Z
LZ+sxtI6jv5VJNB6i1xdfvK35L56y1D+O6jrHSGHb+GTw5hQ9IeKKz3gxq7N6qnMAI6kznjwYTFj
lhn0v9+f6W9Vsb7gRrQlkrYzNq0DhiTW0FiFngQu6tlN2Pp4ogeF2bPRXxgV33EVya9dWeADkrPb
wJ7CIdCRouVHeQVcjhVEUjSVxK5J3QUvr+iV6B2khgGaSKMFhX6I9DborGAPYWp/h7A1+v79VdTX
fKsORZrF6+Fv7MstwA+SoSueszwEoHs/zupi2of5BlaeV0TUvh6tT6wCHJOl2TruqpDOWmdUkUnS
tH+GUB6ay3n2CzZbotyJKvBSdRST/YJGLbK2lMQ+uCTntRbVHvfEsG3IZ+tnFtrz+IJuN+OOXuou
SCEDTjf40HU647MUs5/Kyg2LynbYGBNqSDaEMcuRokR79OFpWAB0xGPqgPGXPszcqbhkopbWitNy
1Ri447UJAZfHgnifponoDI12hAT2zPC0BWZgedcIwPxGbJQVyXL0+b3gFfHqZJLe7Wp3sPpyqRB6
35qa9vRB0MC1I/bYnjozt3Bka2Xf7KYmYD89eyEU2hT7PEJVQBAmgeV9CmhNPOdCqp7FlZrbjC5Q
lv1RvEHWpHaH4yWORweAgEQJj51U3cS4kR1guDySTNA0Drl6lQvONxOgvp/k8xRbDaoMHB4+55G6
NdGRzmh8MEsog4n6LdahwClDeAsJ0W/QtiS/ahASeH2kojsHvUGdVuk95T57FaqVnMOihPb3mmLH
dt3b8vDWqx699ps1RKu4CJJ3cRYrTVArViDCa9gpzCioOOOJSVK+lpuo7gi0ImEyoSzNyse2F42s
1wpz1ckxFRtIQl4M8FqyArb2d70fCtvSjaoyIP90ddVREfTacsHr8P17JX/Spg3TpRM8K4Y7R5ZP
/xTfstuWDRZK/gILreWGEoarZIdnW+H2hKon4RXnU2iHLm518HEGhvuhhjBtOhtcBSf57IbRTBFs
g0Dd3p9Y4w2ICq6dgBCmtFdJMTcaI3E+1MaZEfIFU9INjYCxJtCgosW3nA/0AQrnHS13b6CZbLE+
4/xrDv272CPlxBI20RLVaoXikgqa2MwSaUx8NS+5rbcxE9pHs0eUiN7Uk0fyIzxaJ4G/NnHIjm4y
Kq4gvMKkHWuC9fnkxZdVlJXpZ1TXpuNppiQISalGs+ls/2yjYsd7+fiD1Q7iMoyoGTwub4Do1qgi
Kuqdj3VhozvQ/Zb78zgST/hOZxj/oH8Wo/VtJcnE7dvwWYn63+w2gTL8HMlqu7MGk50AAfBSpKTC
GbhA0aaHPo14wFrXYe5wFq6H+0x3cv7ygE67fMZfrOiKnfm1fcpPAJtGJorpvzqFKxEGNErQ2O6v
NBG5VdijhtD/aqdjeDlozmCBYMVos/UrbnJEQG4bNRIgrfN2sX6+z0dbCVEI2gaC5BlUz8mviPTa
lNm5usgYnA4CENDS/j9BpmWsjfYnpXcopBhGW0xAZhOQNku5VzoiiKWXXO4FmpsdBaRMdmTGNnPZ
/kAmhld9qcP7kvfkRnUpdZgd0fx46ciSKmOl8OBorYBgNte2lAwROs65KG0n9bLhW0/wQslK/Kr6
d07efvLT2FgdWKGiVcqc3wWHHXzamkc/NhcCid2Idl5pPL+sRNDuOxf9+PIeDIcK6Ufm8nsIG8FI
9GgPYVZ+Bww4s/Y0bHzcs/SYVSimCuVCz3g7IPWHcR85UAhbE/VE8H6wH3bfFf/yXsuuJ6MB4EQe
VTMknQB+yjCMxTpbKmzhdFr4f7Buf+zkSbiWDlgy/OublzftWfAjRbUtSd0u22XH4wYbnbTxTUEw
kTIPOjYoWpMlmySXIaXHFWkSFZjGuSzpqekzbH3Y4QmbO4V1sMoebtVByw2tSfqb9eIF+sX3er2T
IDq9OakNgj7D9+GZKg7xwfQHRcFHVfPfFvGQxHg0L7si75jtdt9OHfWxcWu/B+XxbEYcqu8G6Q9o
so3u8G5GyaQ+9qJELcLN9pBmgsl2XJVOgo87thwSytoBGHNy58O3sef4vYlWBknDshZsJQmdzixq
frNl0T2zeV/ldXslciZs6q5nNiTLMXc4G/NWKEpT0ZtefjfdUJSqwfzlz42sdTx7aiES8AIY4rbg
lvlXdEHmZuIQCKPbnvt1dbwQ1TolTspINzmpuZXN5n03nn8pyhSzyHfKYu4CSdZ0B0rV2bcwrHaF
pNBBsS6dTHi33Hn3fjsJ/bon2nSivxOSwSvIVOKIHAlMbHeJv0UNwpR/ssKp6lhKETPJi6vA04/J
eQWLXZsKdFOkNwoCBEa2CiCOcGWITVv/L2MnZnKmEWTCGQ9WhcDhonzqb7uXkN66xLFtdYVnUl0I
+tViKQeiSb0FIdKqT1ABcLqj2s8vpxCgEkq3auPEG+RU1figkTE5rRXFRhbfPzFLjCWDMtzJvF/9
x+ualEWWjeNX3XNXpJktu7Odj13SaqpVMZtXUajOYcoRaZYFkGRYwn0HrYVuZwqYDRj9jIUXNbYF
ll5C3Qt0SzcS0VfdYGo3pbWFlLPP6cNptvFXvD9uhngwAqxpC19JuFQYY6mhe72ehrEhcrLEX17a
bHRFimLEeApvcWoBmSv026RMwaRQJyzM+osJKPzuT0XrIoR0DTYHcrviRm3ENtX3Mhr4JJt1xgsk
8fjyfR0WWgRbJKlhkMNtckzf+4JHCc+GtA/o/l2suPTk3YTkq52bchBQwfgnmswspmV30mUc8LkN
KJaFRBQR77T905n9Llc3jSnnxEPEPZ5jj0UNVy/ew28iekWlMyU0gYJtD7EmAVaur2rm0HYRi0Sg
d6/oWf7LJxhc8n5o6j7cSPiAOzHO2hO1qUPtiVr/NZvKHxY3b/Kn3Tu+IQOwmc9z9HetdxO8IjRE
jrU3rrXL9aLXNCGo5xVNjX73t3yLGpTrVUyUwNCFJ5GQFUCLwmY9E8adpTesJgCEEWcQ91+cJTUI
FOk/WO5WgWLqeBORZsaBnfiSdMuOdnhWqphap/0IoryNASpFsO4iaGrsMgaVRY+z380NOI/bJiqF
OFJ/2DqhTqYuydGX/8Ic9IQ28GzJzoxY0H2cPjDWZM8Qqe36OVV7Kwihy29OCmi/vHXJzLkXo4KE
e0ZTE0psKW9XFC3kJYCMPAQeGu7wT1bVFE42tZVUAwN+bzp3TUDXDjqoHU7kWL703VRYOq0gvN5r
49gzpJz2EQbYpM5/GYIi3cylmJTCP2W58ix88EWx1QEiCcjX2A9Laji9oZYYBCnShXVQjh5ZVbSx
r3bCQYzmzv/Hn/mbcDc6IwyIsvdf5+M14DcUoAukJlTQEzxsbRbN9V7curq26h/upJFp0SqzQtO3
aa41T+xJRN++W6eD3ZKWR8RO6NWjqsk1v4RJ2U1wLVitoJvDl0a6eNra9RMXDFfiwnNalO/nJKYU
FvkcvZuemX5X5j8uT6u91slKq2SKtW3XuxmgnAwZu3FKxjlgoglyK8B7fmvpkOyJaUAWykwZHLU8
I7BCzrtJKDgnjOL+2HdRh6sMpk8Dp31xfzNLpHbCDG90PYpzwim7cV6gMZ/7XNQsTjwCWjm6iNYp
hdguD24c4xlvbWILO7SJMll2lxxdBA/WvenjyfUP0BIEqGoz/cRs8agYYv8iQU11E6O/4M97RM+x
OrjsvrwRX5tt7sm4d29e3EiA4ypC2FZqTpawgHgsRYHjEn94tdWyPp59AcRn/rGtYC+qImuNpsUs
2pKmat5FBX00Q0LfyL/FvTbUnAUgPs80EYWj+898eZAqq4aRGJZaE+GIEU9GePuxXSGU4AgzGht/
ziXL/9rkIIrZThUvI7yCziDHjKPTfD1eQFH5N1UbZk7lCkw6rsXEBYoPffmHp8lod9OUxYi4JF0U
pHCBSHXOrU0mm+++K+duYzfvLOeFV1ePED2NnPnnWTnQOjHGawxRYasTbwDc1mYY1TfZtBttj81f
1+BOd3E6pAf/brK2ziNOa44QSwBmvyPQ+17CyfnfWO41ci0j/0BWX5PnZN1E38apH42/l2VPwi6l
qJELCewer77y7bHbCRIIw4smZ2FU65kD6MvnPTiDzyB1CzWEbnbB4TZ05VBE16iTE+xYxRwcfGOP
47CUGXUV7BWpBBLLvJEuNX6+as0Fwx+YbxGMxG+ZCPf2NhivCsCNHRpNcTAsn8jq9UXHjCx+Zagx
HJzQKCFxVboWXktigwqDXIrY9GcfrRDMMI2GymuwBPOcAnADcnqGmjxfxinPuvy7akNHkht8IQBS
4a+V/yyIW9SXFSEfHe38ShMR2jLkVPKBZ4omT4a+JsXGBXuW/9CU9bXH/4Y3WWsKAaMZiY8ncaMl
vjXeBiMXT/JOUIJIvJkLVTFOgQf8F1loyGIvmARW5pX32uaY4FAp/vSd4cOIreZqjYog4W5wBwVL
Ruzk34DRoMlvOTl35oskUAEMcsuSC7OpVvFSDTu7DrnXiybCieSNG1sgMrPmo6oZpxwBRH8Iqw6S
nqFsw2N+Bdv3prOJ13cihZgmyehsdn3KJvmCbBc8tmCUiFCZz882IccsQAB5nZD4vOnF1qkNqap+
xuN/FoI98bniqP4fwnR9Qecb95i9jO8cSUj7zTWrflhMrQVp/lFZzsOOXJ4QvTSCM25K1Fg7vCPx
JWAfMHffAMMiw8jbQsIO9/j3V9+7PuC1VaSqQ7cCHZ6S/WD7b6MDiSSm/KFgRZ2Nc+l+2QlfU4fI
En/aXDQ5OBNe0q5EDPHZ3XU6QWO0uDQ4Yw/BWNWqH7Tb3y1eIcy3ItWrjv/9VPaXQxbwNwaBSGU5
or0GzYWI0RZWAA0ocZeUyQ6dVEgXMb+KBBy+xgGmzQ1+7OCCsciwyEoqfQrqm69NYot1xP80fAgs
+SK/qZDBXU04bcZoV637AuMxf+GV8iuCTA2c01tCNjkFTKDjgq44NMsh7dsEi4wnc4TlU1jgTXuu
oumzjgnjXuU6RLCv52QquJ0QtXaU6NBUJEl0+SiVCtPn7NXTB9B7xn1pYkeYezKG6tYGgM+IkyBH
kk69avDgAtGDrbBtN150T9ecwbq678LnmovsVHBKyWMdOenh7Wv0CacBHqmW84X+Do/4l9X9SxXr
a1AB15G/Tea+7emtKOIxxj4zMJDVvWbjbOurpWWChVpi5JNYG9WngGg9LK3+9deqtZxdmaCj/ygS
sdai+DYT4L7Rl27YH8LOUuz2Q+cpOQvIuw8CfzVzSAbQRGWzXZH2x9EDgLwEa8GKbgPYdvjXSiPH
k+JBcYzCuj/UD7wvnhmkuVAZnrcy4uEFKfxlUvZ6UhvfkaDfssrWwttMZnvz9Amdq4x8sJcaBtb0
45MP54zQiC62mwx/TzDQZISEhBxTGup5csLpTb/8ud3ZGaFKuIPn2afkwNktUlGmRfzjSAWr0MNQ
NgCwWI3QyqB0gsGRyYNOYSxdYZ77OgIz3Z44kPcUMgZL/lQqebT9aSzz4WOllf7PQsRGYJmioqeK
UTbGInqzjzIV30iX+KXUCuj0MgcTwZoXs/u+LsC+ow563VpFMlZ+LZ0GwvSalhOsicukQXMh/hhW
maK8U1k7WMttuMmIVPpEKG1Q9Jtq44WxPdWXn+fbvI+VJKhq10lJDhWVnuQqTpTQv9Y4YsHbapnv
UPhdbEFwgZBakSPO8BT1z9EHVbma+Zc5oElequw+X9VV9u5vDZ2OY/KL24ADUSe2n0l8OtFDq1Gd
gpdusf60yb3NbtZzjlGiTotqqpAO0fMfYCOtMisrhUhcWiuTUytzXA9I3e6u/tW2pyVCQlF9iBO4
S2fAsanZvhYHgWtXgsqAQSXEGQVCBh0jy42cwtdMd6EuWCF0UAQkOrwZg5o+XnjnZUIll4RQAmL8
RkNJ2XEgfdm5l8cRXTbFYrUAh6kvdYfjJvQo3qvSyGef5zbfDcifcMY5jcN2dpGO1Jfi4jPDHJlJ
2JUOLOquVC20b4Hqje97R4QjmZ0gfK7c5mhMa/uipynvLrGoE+Q5+SAxox0gPDtqwslUskxmQIhD
U2h8VmXgFx1YlHv/SdiwYvv/9+psAzLoEr6t33FD2eJ/A5ALDBn91UdmcnnLKmr7/ZZbUaY8Qmat
a5LKTYLSsM69p4hSr46Enr/07f8/XoWvqngzD72qabQBuTCxG1Iq5Vr7hECPDUsLDicYD9HX7lAd
EcjRGqYcEz8ZomSoVlMl2rBSVF69IWSMZPqXiZ4or0ncQXVzem5Vt8MxbRXfC2DEX8M8LBVun8RP
PW0AYu1/vou+Iq6zP0LrIlmheq7cdf8JjvHwnuXJxpRaSQw9AXU6t7MYUs0iTVv0t8yL8na75Ngd
3vkMWZ+kPzWUbOuyVBViHgliiMslLBYO5v/jT5t6rVkFaXfVl81qPUdlD7Z8DtL+P+Zot2ZrmKiv
GiJieQp+IX85XX0cKkzqkxaMHd1Lqkc02r/3althdcFZH1OmwyGaLtnVQ8G53cBA0LZVnAhqzx53
xw54hz/6CfVR5om2M5blA8C6hM5xbG/9OZdKfHuYecsQbdAARnMo0nrgmGvkvLHtpae8NiOew2mx
UEiMuJuMYV7LvV1bIkRAiQ5C3gz7XuMLVhz3DLyGyI9HUqAnEK1VpIZF14Q2QZI2IYVVq0CfRfFz
MdGLyi5z51IILr5X5MRrsAYQGCfhjzS6ThEnmnc7w/wRaom7odrUQqFjuu4ROf94TGUkgmzclRuv
7KbgxZGc3Pt8oQO0GjspgUFPZyqmHz1kjjHwZM5Yi4kLqZkSZhstYYJDNLeAlD6J5ZU9qHxnwn15
PpZznXvaL+UA1ObfmMSsqB3JHc+EvIQ6FANmad8QF7noykienr0UkAiI2RsEC9sScHcenUywTQsR
dezjL6Mk3mjsANIYaS67EWlIE3NsBvWmVJ6em15WkLX4bfWc/SCbD77NiCv4s+vJifdQa4RNIuUg
JQmEUNOtF2Pses71gAAAA11BmxxN4Q/yZTAD/5L8oNOMztB7G6acpkg9zpCqTfM05Q/YGwI622pN
zCDG38DDp+l1r3+PBkfhsi4YurcZLylqAf1Xy00f3hNoD74SBtstWpBh928fGIYIRQ1a7ScWxok+
1WS5FWbtd4dzhHPQpT/1ATVkGq4GUdO0AVrRA9o+LJivdUy8Pj+RqBCWOmQhD27Fq2G3tjYQIisL
E1wFnrLpYkCza3WfgQri4cHwoKf8RjGCYq/3DD0fAnrASnAUeoqmS6dYp+QwXcbry6e01zk7Gbnw
IsJurJEwmszQR6L2uQlfKhxYHv5upY4uaxA6gg0gEtsTpGOUARvL4TIKkwJDn+uK8XnvJjCb2no3
8cHDPPBg6+dCVD2Zxr6jc9uLhTJ8LEAmVu/PnK72jUxBkXNId4nmXJS4NWUKZKY9fvHBRplBaDFZ
mshUeT2OqqUBH9WiYEbLgknopEETauuT9Q/qNt5IC9W15FQs/iOTcjpJQkeVGmqWZ/IHEJYTkgeJ
nHeULZKbiFR93LQk1yFaHLUNCY/cjQxOrLEoWCCTBzqEJf7rp7SJXfxPnmeGZaU6QvjHcL3hgyve
xmuKGMLP1zu8Ond634eWsPlf5m97hm6DcYRt5tU11jLBi5u1br7bP2g5W8jz/DBs4fUC6i2jrjPX
kx8AS0TCLUsD/1G/3k4btL+1GF8iGf1yo6uHcyfotvuL1wInMefo3KgLvW2qursNY6o8z+wHgyYp
7b6V0q/iVcn7iQTYVeFjtDUDLeuS4LRffyHwUYxHMtme5yiE9gIQ0PuNf0Y1iUGsLUULYn467HoM
PdU/SSedjccnvxw0yQ9rxSFUOaTsRnKsSElsTroGty/OeyFITGn3xAOfBhF5pwtdmDUIVgv6l3tl
3xRF7/gctkY72ExPpM4McZdr5PK9weSXaV9vX8sLYVFqTKhqYcSyEmeWWmgUZawk9Y8/8cgpkN4S
6KQECqfdaUYT3E2iLre8QeowpCtDQ1h7EEBuNfnaot2kLum0aG84EQcFIXT8lmM0kYA8Oo/lDBHI
sGXG7VFvEtzWclz2x6c2F0zqiASrNuFcG+Bb516r65lT5Bm3vwOGN3Q8JuTnkQnPZdU86wBVpSyS
KBcqbBfKPhOJm/TtdFOnbZ03T/lCOQ8AAA4KQZs9TeEP8mUwAk9/+7vsRZZSOjuWVAlX55zBZl1a
kHKZP8VIW4tgioAge2hL5lF2EaDewElsWg8n61XE7QAn+LYP0WGAgmt++6p4Dxawv4CkL1jQVK0F
+GDXxO7REv5L9wkEo/3sGkza+EWk8Ldehzf+zO16+ku/K8Wa2ZWMrVQZWE45/dUQ2dy32AUnasFy
fNbsF+xkGMAlBYQNTs/8cybmrcEezTH8lt4obUW4Cuwj4iGuvjwXncOxGFIiMdTQka4qErZQOSA7
DJvBUkh64BTLAcjWoKpl4M6eUBj4pCav+z2MekhaVvNrDXW6sVykRSNDLZiDtfuXqiPE29WQpbfd
6nAetTEqzFOgTNkcM34IrvCgFGAMFUZ8has66GuL+IV0Rw8q4WS1WczqCCTBGmPyYm2JcXekQvV3
kZYpVl9em7oa4kkiEUtV5J04DrirZm8O+l+CGhSdoH9uNGpdh/U0AyS6j6+7m0GZ8X12TV7/S+eJ
kPT/3Lhkh6C1HfB8UAR687hC+1BJpGoBDovEh1Q8VO+n1S7jLobQGsK3DzpYniFi8OXfq8diYhBA
PNGJ69fr5GwnEpEFMr383EeuXB38qieuNse1p3sqeRMz0WQMWrIywOkGuxMFYMq+6bIrRShEp0a1
wU610eZ+uxvx3DF1SuPsfsCblmCdJuuv7e8Vk/wJfjBJwSvpNhZ9VN6dbNkjK0ltO3uC8+8lFzdq
xQn1/1cYSeSFeCQBGTY+IVghCjLxpTJa0GRkaSw4bB+MArmAIsVnnVMFXFbnH/OVTDUiI5aYHPhQ
fY2JNB6s+ugJ8zdaUUCcp6c2boM63fcJCGNh3w9ptDM6Hti7MAc3pvaBR1t3ePy6dftvRM1pKyL6
JaVTLg/FKVh3aRjwuZn/7R2su81Aq5vJjwTUPNqLhkBDKCEC2EXtjGnVSMpPInNJgsRFT5yOvWcO
KUH0Bfe899Tq0qenExpaHv3Kh5QDCJwYrLSOmEA4wO1syGh/IrPe1kfQQACO5jUGUFPQ3vyij+u7
sC204vi1p6Ajy40SM8ppuCBx7fAsku9QKByqh75CHUcc9+/21Rxs6+31YdYL6M7Isbdcjul+pP1k
5tdtNyfnzIFJ7W2SsCvwzMmMXs9lZT91iYgd2t81N955b7o9xALvu/f+rWddFZnfJXWcAiiuuMNB
Kr2dGUBw1kLc5UpzVKC5H7uJlGDj5r/VbV7MrX4maAAb6rTFa/lOvH488w+/nyjEgZX55bVNzxuA
aw2qfcshRy5HcdR2pQLuo55HaFPF7gMGX10yygHXa6zBqxHXUr1un2PbWYGC0gJy5BKR06HlcC4E
ZsbbW8SJaZewjgShZVsbHnH+PvVCU/jxHTOVHOzMYNmGwOb5g0nPqJYKbtEDmOXn2uZMr49pLwDT
45Hn6ObAxvnr6yt0ln3zD8FFmOGi4090sfZqWrcYo6KpqCJPFsUZzJo713Qnkj744MeUITAvDc/X
ohQWIxi6c682VYLBYkyn2jiVHVuh6S9/7Fb5ekO/x4pBNyXhM56H4G9ZDqVsT96SF5o1xgsBdUp3
peziF0N80p1Y/t4TzgA6Q7Lwr8jrEAkEwTINzQvUZZmQjkCYmxGG5K9V5/QIT7lu0OsuUWtrMqD0
wqyQEDMCEDIy3LO8i+c5QZLxW9S0iOYR472q/1AvrIt1yn9877x0GQ4ygxdbQ6J2OHxqsiCsGFTR
c9a9MfpKL7KC5fYUpZgtfZucy4whP6LyDYpR4NiNj3+Mc1L0P8iAd0fvDhzfkWA3K6WLen4F4YKb
iT/OYmTvFfBL5+i6Z/JLveO7iiIN/l76YLNmjBSS4AmZ9Imwza85L3BrmE9HzYctYX0tOkPeBtLT
litP/ja2hGbK09YbRZ+hzr/a6XbUcyuBDCXYMv7/Ri3Ph4NNl82iJ/KYIOf+mtZLQnmwuAApM06x
1mizxTCXkzWtwuVkiGBTnuzrV4hhn0sIXHztPGCQAQ95xSVOPHhfhv9l4eQe2hRVtjOXAcFnF8LR
Rj1pdvUwL+0cjxic2XXRmoUAUFR7+oCI8M3aaqE+nAPoLuOuRUt/Tgqp/C6m8g9nlLphk8ue7Gr5
W9JP6SCSRtrwHDT3hjr8HjezX4TNmdb9ft8Fj3pZNpkdOorizmXzW+qcmKCUyq2dmDPhBCZiLGUz
zKUR28QpeRyzwls8I0IKeDad/dfZF+quA38QBLqa2ri/Zu8I4AXIGe5TDwUcoMxUZ1ZEyBRtsmWu
fLlbJHa8JVX2mjoRGc2uxULK68vzikOSdBXfKEWDczz9mu3xNguWoWNNwHt6RMUohoHOHi0qAeQO
XcnQZ1UBll0vk8DP2MECLkUs+Yx7gk69lEtlFEW1gLKQn6BGSiUzBJ64rno4NpzcTm4YLqVkxilz
MZ5EFZ+K1ZfW9qYyBQHLRbYRNRjQSp7neyQb7bVv3gkr54etRwBjlbkfD37WS3CEN87x7mjnRz8N
RHV8rwNFEjVkghqCWtY0uW9KtJrLIPGV2mF17BTi+nPyVntVyGssievd8/wKTjNCNjXzhpPe3ewM
ejm/0q21Wt/izj6YL5d3RmuZO5ySJ2qeV8x14J+Ua1yaaltt+A+rk/SDnJEI0EGYO3ryv2Jo2wHM
+xb4kORxJWTezPNIiXm7IdYKjnjnHJ5C65elZxrqja1g2y/acF1TvOoHtmJrP60nmyWZ8tGMxIA5
yTP+P/qUtIvLXJ0g0mYg91ZNL3RXs+RWL9v7CgfC2rJnS6u9/GlY5kDzazihczCBuYhQWBv+YlUs
aCZlzrOgOwO6gxqJpK9YSsh/auV1Vb3uoPZcZ58kHMOA9F8q2r6B+llGydU6M284z15pM8Cruw0V
/RSdZxmzZvV9p5VVKfgDmuYMmvBaS6fnmMrWEvc+bsF0HsTK0ZviPPAgVLTMef6jR/O5DFVx5VXx
xSyxvol1vY39alynwiAuuzhVlW63XBOpM+mwPEn01JgKJJcta7gqrLqolB+i6yXhwVJ6b4LWhDi0
HIZEKd1IvHY6pgsjJ0cCc1wi+LdSzHlGmcav4KADQIqSv+92UuN2BxY1/85fWjWuvl8GMRHqsIEL
Cyd6Lye8V2v7B2bgckSDNntfxMkQgsKQ78kLLiy6knyDNGUwYwKuuPWCUQK/Cu0MphmeRHcvny9n
AWLt+c4He8T+MZQLQHWPnaBPE/e2pSx6vfhvHo4WhKUFuv+K+Lsx4HpfGymnCXotTk5Zi0TuZTYI
BiN4RLyyETgvA2RC5ttGKuzOIyAKffVH8IGRhbiIyfzLMyOoS3p3dhVV/ri5sujGdaJm1/a5RuTC
unDeKEA2AhXVpSetCflGNLJ4HBCYzcycsGm3WVnHBW+P70D/IaiiuiY+b9el1oGYpVhWYDtmo0AT
n0jC3smaVpDOgSDtN2W08uIVTaN3KwCDdkJ/vpbEo/I+QJ95ga6DpqqANfLP2bKdLypWcpFmhIdR
QBj3nmlLuumqrTBicPf5ruea9cfeoNEgU0vf7JIjRyeU78sbiB6Wk4eZeYVrknaJqjs0AVkASPwZ
qC+xazf0g0mqImDcBVibY4xpnq1dJuKH6k11tm7il7/rXUWhm9CgirVAhEbSqRVIn19cGlpfIjpn
x6GfDGS64+fL5Mwn7I9DNwiGJrjO2ebw/Gc92HE2Mpl0XNhmkQHYjvz7TFMwTHT4PhjGg0z1LoRY
2tLCATEQ0uCqWk7AZP6CmvQ7QzeKThC0wWPCU8mnFQbQsJ+oV8Xi4lUba3vX2g3WD09vJChHjKS0
EULPw9Y2PMAuF8BHrSuHd/Mphe12SpbVWVua1Lb2r5IT2DSHiJYXSfsNKy1dgTG3UlSLJo6IZq4u
7HS13cJBPfF8XHwbNq8H7EC3948Yf5vdY2Dj3oH2x7H5+AyU4sqN5a9tSA0E2IvgYxCHdSlXd80w
og02qpApBVo7Wpy/0qh3zMchCW/te2nF57Mt9N03Jsvu/kIu4t6PfxftyuQ9yPoDD7Fmk5Fp6JGh
Pp1HK+xNJsio9cB0HcMXf/JsLExu4wA7qGxWcEAdfoEqoR4nx6RTLtVCM08vVc+HCRdWyysd46ry
Wd9mMRyyQBr+x3BeVwAIpq9yYDI4zEWXud6NFvCEed+FslJLuiLsjyRAD0vVTlfbiNfaCK1ux2M4
90SMbF3gNF8nHN+4vpo1yMcVcvmouYJWccrxHUB/Z25rpVLBwk8VXD8YrLlW7HZAC/6D+Z4iT6Nw
elLuYILQJUl9eWdQOzFRLrr6J2vXFh7f9Lssw02AXFMjIewxJ+9eMOuZrcahyVle81PAF8vQeC9K
/sE7RKCuqd6IcN9NWAbL11QDCAZifi7w3+DuRW3CjWjl5iMdNm6aVz4RBp8h2/QoNt4Zc/Bftme+
XzQQdIngNAb184+ywf1RWBooGqsI3k71PBbFUB4Yo99ONfadD+KIrMY8BMozXT8MuOOxpRh9lnL3
fa9fJsC7AteUVTumgzcHdVYArZ9G9QNa4qzuFDjwg00rSgoSpE5phkT8Vj50NRNEFJAaHj/LTWuc
MDCRC+0P+Bmb/9t/sENxVypfiGvzh5bMbYBLT6KSLi2QJ+gD0sWVOVcFCV0bkx129L69f3+B7JTU
eVTiCLop2TgKECCzFfHGM2nwgV631Ka9gYoLQL0LJ59jMbPIqipOy9gE/5WUUqHOA5m5fJVE/dg2
FA203ni+vQpacAMPJNCwL3a92EQ1j5i5bME3LpSc+QKGFX3eqHPxIYAP3kZDOgOMblzoikuLKSh5
na5U6VfsQpuD1CedMIjLA8ZREoVRdlZdZPWbJx2BIRqUrbHLYXHYpLYgIpAIAToQAIpJf4BP5iAI
BHCcmIcawlmPyC8jXy1QpJiERrxKDlB/NPq/Qw08P+vIeQchAPQtt5AH/sfdf3gf3f2gB4XwvhfC
2iD/9P/0f2/3AP7XIA5DmLbKCLmIOveF8LxwFEgDYnXwezez+IHyP04AAfIfTHsvZgA/Lj8tey/L
v8/2fxDQf9tB/7cdFMqSMtPfuQxadoFt1CIglM/gn4E9z4DhQT3+hw3iPEJ7Cer8AAQBBy9bz5V4
8EpcwPIAAAECeclsktiALhALhALiAijAQhAQA/0aFMAfL9/wA6j8oE1xxcow6lGQTTY2xrbANO5D
yHkGY/deQZh5DyDMe2cgDkOY+Q6doGnAHs35f8T/n/Ef7P+cfloPpvp3yAbbyH0D3X/ptv+PIdtD
kP/T3UAzAPugAfcfbPtDds38kDc8m3YAAhQE2QHn5HEAB4AAIBwhGpSNtAcisLisTksUhAjkAgEE
WqwgetfHt0HoWBlJWOIEdR1CiKFE2CCNgTwACAIFoSCGIobE6+SAjAmZj/6/5vqWNC2AANADQNOt
rQQHxB80+a+a909CDkHIQH/5/+f2P7X95mP0AA2z/D0PkGxfC2kDY2x9jeF69/c/tH9j+wP7gD+4
H///b/+f2v7X9r+wf3gW3ben6cGghp2g6DoAaA9g8SF2lMwOFA1vQNIBI/0Z6D0J/k+gPQvOgAuB
Et+/lbd+5s3OWbuQ9oPW/g9oAH/v/7/dACeAcFtElsThAMjAyiALhAiD/cIOagXjr64FLRiIuDqn
BSrAXHV+h8hzDmDMHu3EeJYy/Yy//UP0dBtu27aDQLY0DQNP0/QA+RPp30wfIA+lfT/IvpjbNtzC
H/XbNt905AAcg/x9C2z3b+wH9g+m+mAfTPpnxIA/L30n0oAAABXm8nh4PPxHn4+If+n/p9wAOCEa
j/Ven/ffQ3CS2Nx2JwgQQ0FQgVjRP9DVql4JVBhx9wfUJvCXjpo7a+vBvP01rFK/P+B2zbNRi7/4
6OeJ57u61koO0v+/Xendccl379CxwW2AW3fw073r2YPZeyPiD4gPyH6B/C/Y/3T9SPedl/j++7J1
L7zsv3XMG2Zh/6Zg92939BDbMxhyHkIAH9x/aAf3A/s/s/sf3H9z+0f3gQWDbEg00xxNZqGGYZh+
Ogg00mmxaKD6dh+xpwATic+Tzfe+Z988wAAq1aSmrRphm9xilN5U2bEeZ4AHn5TYDtbjszkAThAj
jkIEA/zhHDkAVr8QBFY8/wA1RijoTj9kdw+gchDkPoHoW2e7gHXtiafp+gAHtv7+YNP0/T9A0DQM
w8g2zkIAAAzncHKdviNCsBAGYe9KAZmLMOTyeh8nde6+AEgA2J4UP7D+z+1/YD+z+9/cH9v9oB/Y
/v/u/t///7P/9/Yf2B/eAAkAkwHtvW/i/g9d7R7Xt+17QPufbfaD7f3Qfu/4IAMHIRqP9O978eE9
bnFYaPYqG4QIpAICfc04V44+uTKKvEjXPApZV+pkIgaiUQPLx5BoEt1p+p7mdn0fCCokfNO4OSf1
9f42MgxnU/ZcYU40RRz4lBnhG+vOB5Iarf34ELxmseqZf1qq5YPvcoF0YduvpZp6t6HYt3nNNQcc
3IRJYtozuse83L9Rx+cDMZmfUCdrTckENaOQZg5DyCa7byGagABjE69IkC/9UzkL7v2nd1Eo8JJy
CxnQ1lrHf6LmJUe3O2PdbXuGya+82Z75x+Br/TOdyor71Lk+v/N6b0Pr/uAABW97EnOeJNIL1rQB
oArHr4Yk7OeIE/bhFSHFQWEoQIpAIBxxbi9La5bHCt7OOOeGshagVf4IGadz23NUi9323oJSaafc
+xXW4/y+Cin4a7BAa7VGhhjhj5rxB6d+FpI/8VyOJenkYVq7y4CGMgXDRBat/Q83928HwkhTKWzF
0fT0qans046wOKrMkkAgdRysk0q5Pwdvvdzmh/qP9QP4/mfwepf+35v/yiEj9ZxVHA1jLE0s8jau
dZyhCoySWRIFOySkaAB+lqdveAABUjZxhPGO3nJ0a1mAAA6d+mMQWxocIRqP6+zr8cE5bIQIYFQo
KBFEwgIAHXA4od6Re2lcQO9M/zsUizIkIkgkl9QAJl4AQ3eJl1dg1KC5n1R1dFrAucFmcu5+Fp7g
cscwRnfe5Fq26G3YtH0omIG/hc7Bgw4b2C/ev/i5wwFhbTtI885tuFttp0PKh47R+I2Zx5jfLSZi
cybxOQU9dBzquCw0848wuXBNjVGRmRLG40NQzPr4oKvvKy0NokRMiIRARQ45M6ElTeO3Dx0StqOK
GK4oxRMM1y0oElpABfM4cuHIPk+PLk19QNOzGi2Sm4cKA6hGrj23gFt/UFDSmEomHYoJQoKBBEgY
CBA0ODoeasbON5NO3mwgCZrqoF4/F/CqLU5wUasegckXMNhP855X/AcOAOcpeDtpvtqtmOcTHOJs
mCc9V+1ZggkFs8rMDGl4Kp1Teqn2mmXmn2GXQNvPwtGK/X6fMKKVLYS7fn2Im3G1vUlI8hLlp5ZE
/HtT3TJsMPFekE1MyRpKmbpzcWhYubfenx6Fha1dFUMihuaVNDbpW2oE0lPkyGMmbJU66r3oAAkT
3xZ9M6s3w8B7IkP1hffd2PHxvXp8DnQwTXchGpT1zocHYJoAQiMaOi3RUTFBVpWBj2CiBtcgaHqS
BFVWxQEPAlG7E3qh5Uh2SP20th4RSTG7loMC25tqxlejgo8IhYDhm+RFwXPfVUPzScIaM2ZjYmh8
Q99wRdz31msVT6LqLbNUtN7MGAWYztzu8ddCVEAdoLMPC4dJu8WBgK6hllHJowvw0WWGXm1qRfco
J21LnNXDTdzCg/DANRWmKnVGtibKJOpNswX5rM1JtBCeWmi0+zzxu1Wud8xARgAfwK5H9QiQuuvQ
HEiBAKgAVuAniuAuABNSOz01hQIhigCAEWcXVW3LbcZtajCAfAg10wSESDhjedMIeGaGdV/COgM2
6poAaxfBrhXIYk4nXAbZwemb5xX4JhYDY6QNPPrG3tGNhMFVa2DEYWhzFBleKmayznguPb2J0YTs
iWrKY+XdONbY421ACLAXhQtuSgQPbQCVC1qLyV01l5pIDvkDQidKenz6Xq9NZTzTrjvM8LkEAJBF
EAAAVncgTADFgTscIRqP+IP/+8E/bqO44CwYDIYCZwMC2lnVYEpd8bSbpQWytyA/BH78nqVlUBbF
kt2l8DiE+LV6AwXFNfZkieNmGoBTKeanFfYXdfM34TUuKTBPfNnim40nw+y9IYzMMs4Or1+t5xWH
UJk38sdo9G+21bL6CBUbA1bjuTBwEG7lETqQ397MMGe5UGc9VWFzb//ElG+NksRCiEQxipJ9sEqZ
BwZLmwVFtkfeOj1+3X33YZZxKfF/9pwm7hXcLBqmtbD2veXHf9Yd0AACYAVgWFBRPW2jsJR0JBCE
CCMCgA+6pUUQ1bFUoHDQRzAqRHPZMot8jo4VGgpS7JKdpWZQF8PT2J6vstPE75TLb5HnERjoGqVZ
EF3CIg3+vsGX8zbGU9IrxImDV5PHLLVasKCTMU/5rQW0Loag2hFcaRzvMkERD3xpBwBfOR765Z4/
DpcQ1u3eAL/p3XwzBMr99omjxODi1/oVCrKJywqDIFQ4IRqP7tr//8E/aqNYqI44E4hEAxEBnij8
ATpKGkKqi1DijMSLSncZ+A2i0iiRd6f0Xr6Vd7b+1VsTrdII4+NyYiUXaeU1W7efAK44/zAFFmzs
dnM0PZdJNSewHQoFVZ/553I1Glx84n978efkwcXVMTif5bzneUIBYLRYg77f/p7AAAXBlK8QESwM
02VKpIwVfOKY1p8FGevJT+/8v3v3wAeTzAeUAB4e8ZecPZ5tm9Z5agUSjs9HsbloQBcIiAYiAwPo
LS1BK8+PNZy6UB5iG+e4cdtp221UwFFTm+OQC73re962qreo2me0Q2Pv56ebku7dbroEyTOXUV9J
gPBIZ1915ADWYwxk9z2DYyQ3zRW4rKfX/H+/Hl+98nnhlP3PtfdAOgvE93K8YKGTsWZYgs8UUoob
dlT01pZB2oqDPDngc3TzgAA+RpRUOqHm8F3OJZwhGo/rr/vgASd3kVjAThBYADiqLoXMIKmqccLa
cAnYASxGYJIATRgCcjiBD2B7AJeSOMUXgOOAtOQSRY5S07/EmUoByHMHIds919D925B1z/sFs6AB
nJJIAOvhsf0HMABmHkABmL0L/DbMxkWQyTKP+YgxnCMrYpBjP8mTy5h5B/iHuoByH3cOQchAAzDt
mY9s2zbNt20AAA/CAD/YAAAAAAAP8OQ/9Q5DmDbQAA9AzDwpeQ8gzGAByDbds5BtnIOQnT4AeAAl
rTJLS5QDYQagL2XONgQ1QAALTASkI8IFogIYDMEpCPCbFtEFEgnrT8nF4VnxI/sB8T8R7MfT6CH5
vJH+UOQ5NLsUA8KG2gHISJS5hzDmCty4CXbOQ8g23kP/brj89391zbeg6CGg9/2xOMNx3NevzSa7
G+88p5wAeUAOgB/Z/+f2v7D+4/////+9/ee6bbmPbOQ7ZtoAAAAcIRqP++//8YE/bXJZnCAZDQ1E
AxEBgf4OfITNqL0DGoIaqd5u39bSfLNrCzplrTTQVHjpcwUCXh/D7UFJ5Mx/9f8+TSkSszHyHkPu
vu3oXoOYMxf/obP7vL/7fdfa+39wgvhYLOJxOZPFYpvafPSTRUBFzDZfn/SUEg8ECc2B7V9SwyDB
B8Pg+Occd/Wx+e0HQAAH3T7r7r/2APpD5t37eZj9S7nW1vUbz+Dw7mxad7lL9C8Y1K5M3wO4bzvf
hb3fb76P4e8Tk5FFEDy8AAPEAARBMCeu0iALhsThALhBYB+C196WCBAAGqvWp81/gCwjYaZAPF9h
wScwbDoJNJzh00gsE69OJrf574jwwL89/mwfDg8LBZqAT1xAOG8NnwGxqLBsQCaKFpg9770CaxB7
3MH+YPdsx/5rcF73srsn3wB7z/eAA9n7P4g/LwD+8KWZvqPDKRzm6fRj/gJcW0VYTFGelsduyjsz
a/Uc1OnQ39j+8/u/tADwQAMHIRqP/vf/8CEtbXLZXHY3CBxCBAC70KVunkQJB+b9htCgTRQJVLJN
EYnFlk37Ulr++kUilYHCgyYPu8AwUHCmzFmK5rl/y38PQQ2zkIbZtoD7n/sP/b7g+0PtZiCxxfwS
JhdU/a+AtT29aeHoYB/n9B9BzDyHbcxZjD3X/DkIAG2AAfb+6H9oP7wA/v/sHIP8v+Pu4bbmH/AA
D/rsW0Qde8KAAAbG6+AAHXti9fDr+x+v9ftEAAAA+390AJAUACoYjscitLjANiBwH+4orEKOKD2I
BF58FlJ2yAgACsx1gMlDFwoz/ffkR8htuYdsDMW28gDMf+4Bp2ggGnaeAB/tyAPQfda2L/0/6kil
/zf47byCtS+gh/1DAS6d/sAdchp2g/d+6PtfcB90APtgAdle8D33vffh773nZfoHIPdQAAAADkP+
QOAhGpUd2kNFsLiAYkAij+QsaAU6a7TOpYtlTgSRwOUkUg/SalBMWs+/SGKrzLL784QV+lYGOpxO
YJxIJr4WazicQSahNYJOQC2w0/QdP0/QQANA0/QNPALZAAqMXu//XMfIP8/ofofofumYcx5h5DmL
MG2Zj9CgkGnMHnE4APV/mjvA6IT7XKho/k7mEg4BiOOOP0eiAcIg7OjFqXhlHEHHfyh+dfQ5yTRz
5WJ7jjNOkPZB4hCo2Cpo4zwnaG/5Kd8lU9DnyVH5oCA9qEzIPJ23nz++7XCM85AKBoj07QAARBPO
ajOajOEg0JgmICCEDAPwBslNOC8mPgC+5DsaBEl1fT11d+i7zfXd1PxX90PI848A6R9zoHk+/Pvp
U1vKwzZpN5Pnmky/8OK+u97nb6f367vorvE/y4uLRxYvTVSoj29znVwPgr1Xt2hBMq4D8JTjoryg
BpZLm9FBZrbAEgbJ2gcQPufqru8+cd6PYQEQKIXEvDf9D28aK6M/aA4hGpTVwkVmANjkYEMYEcnj
+Soto2C1nJ9waCHyxJiJeCHHvB+r9k2x3/xLh01snwnX9s5DyDkIcg5DtuYdt2zbdsCSdB35Tc8b
q97si2g2T0GfIgfN/UZ6+okwSyRgT4DBQEjAlUHHQSsDG/UJ7nq/8dBwoNA0/QNBAADkIbbyDMeY
Pd8wbbyDkOYts20AAADMAchDkIZg2zkHoAe6ZgzFmP0LMH+f/P7vgZcx+7+7+7+hhyHkGYQ5Dtvu
n+TkPe9+793j7gD1YA7478G0bwAyw0qx7LuAGAWkuogJcKHYwG4gGZAI/wBWsvMoPLjl5AUV4ehZ
hzH/64lmHMXIaCL6B6HmDMX+GYsw5i2KABt3QY8pqDtj/du20EI9d5BmPbAC29A/30/QJ4nvhliA
scwWgHD9iWgGCzTw7+6nZze53eL6KK+nbu7inYr++n77MPINs23MOYw20A5DyDkAcg2wA5BtnIMw
5g2zkOYuQ7bmPkPofoA8nm8x5Xk87z+bzucdIAVTWo1ssNKsey7gBgFpLuAhGpStskVncVmcIFEQ
FADQHYLXtp++x7pW8omWiSKwmyj7rwjK1o4Gzbdt/w677+DQQD9EOQZj5AH+G2baH0oPkf7vmLbA
23MGY8x7aAZg2yCAATjpGTBZ3gkhKzoqgzfUqALwpeQf5sxbZmLkPIAzB/h/d/Z/af3AP7/7W2B/
iHIQDbAAADbeQ7byEMx5i2zkH+T3TbNsD/J7tmPkHu4ad1xoH/f89oH/f/uTQKZBddar0VP45WHo
u/9mX7GapnieyYxz36AAe6YAXMHu+YPQMwegAH/UAH/4AIwyAxEmBKI5bGAbUAqCBhEBABxy5FrO
fb2Cf37e5ydvt6u/IPJ5/P5gDkG2ZhzHjvr2GgAW312HIQzHyDbeQZg9C44zbMw/5vdeQe6gAByH
MGYts07/t36Gn6Dp+gaAAafp9sW3oAeE2N4QOvdf6+AbEDYmxfC7E8KAbG/wD3TMAf9eQZg5D6H7
p/nnM1AOvwcJxOcMAIoop6+nLq7vp6+3i7upyIH8Zv4c/J4f4QMHAAAJ2UGbXk3hD/JlMAJf9/Jz
APClIEA6aAGC7sW1wLCdmcIIIUx0SXCCNReKuMVV/k78LrCJS8UAvb1suknn7yETV/ERJId9KOEJ
9h4t2gyMvOEg8T8ZrtBMXUdZsh8l0hf+USyekzhtOYiEe6TIGtQAACUxjLjwgv/CsLv9ePco2psq
2D7zEDt3wpqS1jP1RmqxeAtsYb7rn9vkgWz6PVipoXWSBQT2XEKaXSW1r8+/e2kaqS0bG4LXmHcu
LW1OBf/eCJB6mBX4dh3jc8ihuELFgz5zBOT62VNpy2hzT3AjsRMYiTIzyxeHoiS1LzTM7YgUD3jd
Oi4cjAkfDFsnzvcUW9OvUgJmYTNfsS13ntBLyYhF0x0DvrbC6ysD9kRwm3KyCAzfh+FDPGDOODcU
9ASl7jzBfY9/H4a/Vpy5jZXgnU+pGCFJS/XLb18CAoS2BINZvrIpGtGrBn2AefdM4V/IAAuXIoaD
1q/DCt93fCzRiYVsGFB8rs2oW3+KViy4VE2zedg/iuKjUnLL4FU4evFggN/1SSVuIx8Ka4HV1Dnq
RFJRaQcZn54wHjASccPD1+8pLKklfZzcYeTT8STq07hGOvJcMeq3UyWu91nMD42ZXDWm1cS66wRv
W+obgRe23/L1pg/G47Pn++rNziYeRE9PFxaI1UQMYvP9JGuh05bct40J9VFWZs1n5cE5fJSGgMKg
dZCbvVRLsNDQP7YEdGdkUkGTjp0SYSyKGE6dQxaW59EneZ/9AYqavysyrXMKun+2JATNoBbJT9te
xL1ZZpMQoHvP+xD4yGHUueUD7Z1XwKsPfeVVbbqqdge9qDqDKcrv7sGkBO/XBrUiefZpsAEVhBYX
vIei4O9rVegqqXOOnRXlNT/T8u/xSkHAKMhlDFz0eqpjkjCtWr85xtmb97jOdYqNOgycHiGGpX3q
hBsHRi5y0RYhqZQJ7eBc9nZqZYt0D/iWhkSLJz57ijJZSRTXI9S45BWqhtyJDzANXL9Tjyi5nZBU
lAqaTP3f1AXhtjE4xsSjFDKhsVFWvlDo8/xG49O8nRnsAqPNsPzRStjvLWDUygsHdtPV1onMO7jB
CforYh8O3E94UZXEkoBMumTtGCFHMQOzWumfJ7zI33jweW5VqFeyEdAeBLJFs1XLNIRBbM3hMQx9
awqIVAJnp1nnsnZEYfwh9OGIXS+7yBIYfFV/O4gBl79SIfl4AXqZ+qV+kMZ2uFwHTB+oOCv3t/a3
8Uk3Kuio+84GxkD+CyhODDJkieMNZf3A3TQsckEzDrJD3sLi7kpSR3vUrhG5kLxdYj2O1OHpZAbK
Q5zj8cd2fcf5mKWGDqZDxVvBOw9hd/KiYcvbq8fNaQRk5hz0M4WOTpBcPnLkoR/o+gVZkWPdFXPJ
cdxFjj0ylkXtH/kzRUBHWfqWXjvT/UXrw7UX6HYZrzvrwgrZ/a+S3iszn2o0SzUpIbwr/tOlpmY6
xMCQonPIBynOS0dXsgXXC1ZBUpStcTbCEaZtlU/1bKaCCgWUM2x1vPdFlhgoaANJfdKdSqWS76If
2S8Tcz7j4exLEQJtDeR1VwWeVxvzTfIhBsWXNEnE60KW/H+zYkn1BMCQpfKx+ecN+IaBAks8iywN
MwfZiUbIzitPvASQtb2djZe/6KoEVaUWdV0zPQkTHFH+1pumCvpvPDsBTIx+yUElua34AvlHWey4
w1pNJczgZhLKG0xsEJ9ZE5vO77SiDPc5MCU20UMelDYGoDTVsgUyzM600vsn0zUs5dO28/otwR2o
42erC+erPwJ53BrVqwNaMq1ey+JnncjIFmz6fJlsifXybzUnT2k7c/Hqf7qXPA93+nuTu9PtQj3n
/pfce1WjRW+5FPfMZekQ5TDs7rUXNFjfV3mS77oIP5KYIs8/M3dtYYCWDzGm6Yr1dcoEQq3+06pP
AQDb4KRZicFP32z6TESiv2a6WLqhpLLVoaGesCahJ08wQUa7A6/yUT6aA1QFGrAUYoDIf99kOLwu
/jqoO80i9NUE1pqmpi2Mo9inbsVV4Yte3LZngMXoE9was5aCeu5XqumBlnWdaIp+wjjAVXjp2M93
qfkCFGgCqisqXKATAlsud3R2H2l/jadVR1o8R911beOP5O3CcrwigkYNaX4vGNu+muesTgb4SNam
aqmgsuwwxP96oTrkavfOZvbtGLhfn+OQNVf3YiCxejbloUyUrtmQ0Vzx1ItPfkJr2SqnQ/2bIjzq
/Srev8E2fj4CFymcoLNrzuBNkmCF12ICAiWFvCfIUILoKxlWniicyaeiTbSA0Keq39BAi4ecfbYH
T1Rjkw4WTjBMo43Wt9AIoN7zv2Go5gsszkUgJeJqzsx1fwocd6YfZl9aS/GEGmALqs6w6wTSpxXt
9Gu9JFlAX0AsrTQwc1SwhUp+0OjXg7B8b1JZHMOWRMYe0v2Ldh75F4L52LqRsCIqFHFAfbh/cUR+
pYT61Xw0t43Rzx4+fA+GCRoeTJYSWdUHwhyGjd2k2WO1cZs3t+bJLP+1X1plX8OZEcT2Y5Al39Vg
m+QIDfCerN/dYt3tK45aWO/iWEug5vmlnhCStwkl9QjgWCvg1+5prU8kQzk68pgGj7bUHiAaO8pb
1EpWepR1WxYWVLmmMQESK7wZEvNUem7YNjHMimMaEySGn/ZAZPwMFmO6pdaIPDZW5/3XhjRgdask
/Bxh2oo05A+PT4KWuYg78MFqQJ0INvBaTOGqR/a2erDeR0qX90YJKu/f7WRtVg5XH1GolmKrbQvu
wqxfK1UioPKZx+SOH73a9vVTWhexgzlFFwta01iOx7BzdlBnQbuVan+4uMvO2tMFqSGCH6ErUqc+
zvDym0+xp03yoc6u3kBnGf8NcPEbchJpMUaDcMSU60OQv+1jMATMPYZzgfabNx62AxdL67O6039f
MWX+XwCdT/tTHIDYJecLsykIRsYgLaLoBCknRT0Dnmre6A9yoS3CZabSAGWF7Sw45qg9lfVUyay8
0DSV7qmJYEBaddgPDFu/2/TVzvoC34NZMvF6jGHfghLzvsOLHFod83PtqE0suRDJ7S8pwSoPaL5l
PqYJoNtqOLDfVq/GzZaGiZmczR+d2qfi1THdINrSbKGLlXb7Hjj0o5xSPTRPnLf2WG960ADIgrki
FNaA6pDI0Gk+JiEMHM+2UfCDX8xFm5kttlCm9USRH0wCAcvlepog45N5tenVRNl2djYbx9YbWa5O
kwnCiRvFTkkRgmjnHxUUsN8K1yPetodBFWrk4sclOOYWKhtKEDWNO2w2nCztrt2/ZAr8AUrwv3Kv
xhtCR2UwlblU7MEGP8hvOF3gZUsxQGCNaEnpOl3K23ChbCwSAFMppjgPWBia8xwxL2yLtMtzcoAA
ABCEQZt/TeEP8mUwA/9z6mCKXXQeLl5zvgCOoPlWB2aKOVTgWFSYgJ7mFeVqtoHTe1wqYkIKjg/a
qQ25SrU2Dx3wsQAIoQF6gF6xVjZmSCvLY4Hq4PmBg17y718M3D8UUUmBgftP3xbkIsAUeN0bqu22
773IyXyiXyATc8vQyIYywoQjd5W5nR4buqgSW+3mXUl9wLFI/SuSImHPdOJmoQs37dxh3Z/QF7/x
aRqIoTnj2dB0YFj5Xui3pzM3cgEGg42Df8PaCLzAxYTTxqEwpOdVRnhhHhP0cAfyuK+0Ml5Reg1+
4oz2m6EA5BpErExOW7TZFRSUgL13Lvsi57qhC2OgIEKoCpDXeWPmkZzYc0Zwzux+FF7oGpAPWZ4j
Jx7nUKoH+7lVBvHw8P4H86QtQYZJ5D+WUGG4tjsp81HAdph1g2dABuKdY8M0NgRz4PJoq14Aftst
xIMlgXgz/0mCxVTCdQ5MdpHxtKbP1JCF50DM5wBXk4AQU/oyN9N/DvAJYkrzvPqGHS25Fjz4Ts2P
ENR6JQgxICbqZ3ntvkIu7t74pVou6CmfxEb+opW2AaJh2A6FQhXf3soq4dCLAKtGM6RLhWfRgX2A
7szWnWiT9tkIaoDxgXbWbXeT+p1ScjfkvTAQHvG78DWoL6VQVwIh0YXM+7Dxk/5qTv4Rmxo8ETqh
TrxM1dzEgZhbMQ9fmCjaAEKnwuWuRegrLHcZJ6JzH5ZbysAXqlePvvJSE/VU3CLf5Myk8oHvTkpy
hTu1NCF0mqAUyF+tuBmpdjZddro/t65QtKRyKVFCHC2RFwY9lktgFSTWA4iF3Letk0Bvq6gPB4Pf
D6zYTGwX88cPenavQZmNhXN17hDuRqUdPSJKjXW4rv4psDa6XJHeoPuHyZtYfHCHF5449x26rI3T
N7lMmpt/UEnNpUjSo085bNBXdNryDCZkIvmYb0Ax68s5abnJcMVnrfGXDcphtpuFcvu8GQZ/N7sK
rgXM2RIwFNkDaAQWKI0PiFtlXQ7LWluDC0vtfGsCnfrLCQ1uSZsRzn15q0+Zl7iCSNwX2OGs/FVS
xjiZoLQqRl0G9IeQO1vHlg7PkPNutahvgQCf/BAOighXjLqV0J1ncRyVVutNTsQa1tggbOFa7ZXB
y52iFDRL3zURxrlBctOFvJipA44dtkfqy05FYZ6QdjOptOHoY7DW9A/d/JHZ8VYyx89qPpwmw1zt
9hbidiBkNW5779EyzOfRIhYE9EUfCiX9iQ+MH1n7OE+DuEaxOmiPJn9I70UjfTG36qVrJ7Ztg8Db
w6yH1d25fLrXQ5dWe/aoRHa1Errp6Wfmxx+H4mCknXelEAeqlk31bYdhdtIXxOw+Di1pFf5kKOhb
RT5aIWijVbEiueX8EQzuM/zvyT+KSa0f459zdvkgwML+uBj8X01b7pDHp1BE9f8PZdAkO7hEsAoW
icjc5j2qEDulmwjrcc/kfhGihU77vrlkdKnJTXXbY3YCubRlEGfOJW2mlGj2Q3avu9/a6250Le2I
8JARxRjvnvteug2zJtQqzMplrWM4zrJvP2XqdjGytNQmmNVMJQGaqQFHY75NuojjKX7EArNpTHpx
LoN67NUgNjfA78oynx9wPlfrSfX2dc+f2yagep6znZuSySTd+Nn2m+OA7dsY84cUPrYS5o5vuFmc
+Lj8llvyoYm/UIuq1724Z/SFWC2Ug5EJkrCrM8XcahTjfSlcdrSHjJkxwXFLSzTnEQAPWpPmLQWQ
s+GV5ajMs+bH3wgSX6wqzfPUe+z+g/RKaGg2VfvogPn4NzCGgrF8fMjmK31qfwDFPfTOp+ARULax
gcbpdYA7gCFcwcsVgAfK10TKJE1oujCaV1LGDx97weAvPNFOShIT6Fr382ohk6xZq7WX31dOvXJF
WeXs6PjF8XUHXyWsHgwPGb19BXPaJhbzQg6oXYtUUA07WcrQe+byhxf9er+xA55qTjyQXIIycnIt
sFPJdzBGia90TRcsFv/G2rkFzi3cBoe2KVtX8Ji9MtWdTUMprb5NUb3EVqcyzc9CqwHybW7+lLfr
wh+zG2rUmX2p8yG+2CfJEa8b1mpbjTAPR4BqZsdVvTXD/IU71UedMZYIHVAxLFQxVq0XDZ2F81dN
ub1xgWYO7YXf4m9VJnNBShWE53Ab+3Cm3dKojHvG2aYI/CG3Fdb71VkJ2kXm3bhhWRS9ZqMmSMdU
SfrC9OXO9fp8rlPXsCq5UxrUvCQ6sekyna0KEEnq5GSpDmckUx36LXJ5caclN/TNXo9UD740ECpk
xFmmRK13RHdGpuWwcRqxcdy9ebHG+shwz2ebrpnYVNJYs1C5N/3btekEYcIt6vhOZ86OlqfGLtD4
Z+afQUa9N3ff7k5SQTAwJrfh3dL6tNRnrlyGpag64i4Kzn5/IWukpguXqHryn9vZUSEinIEyxdHT
QeXdUhPTy/hytxi745ui4s8STMCfzifMJb32+hYUe0n1JwpPGgd79cwFTgVu7yoH129VcdxgOSVg
V6PTOqlFto4Voq30TqZ9yx1G7Tp/pVQVKc4h7sC9mx6fbwoqh6mvjUiulmDOro0yZEaTwQyZ1NIZ
p5Vclbf8xtO08dogqdbrKCHp5X/krNQ4hfAVr6x7Ftsg79ujeII82cbMfTRrkzwpAltQ/D6F3AQe
8gg4T9s0ZSvDZf7wgzdlcF5sRro4YhzIARgEHEgLUq7V9nFfhwLKrqs4QycHre1BcjCUB756MJHB
ZFp+RRtcUNenzcgvKQAapfBgjg0gEFSViCLA0EOAw5AXIICNWYluVFcLuDq9CKKzmI+o+Jq5yizD
CMDg6gwu8Y1UEH+iL5Ta2TFfL3nn0v6UF4ViNjUAYdMF7vDHGFqxezZOQSa3aSAsEs/mkhiOOVCE
flR3xiqbLkWGD9SGqLtgzKH5BBkQGULHLpQhJUkbip/bu56YKe68E+5nOsvDnoRX/bt9R8Uj1R/E
LNZY/razPrDc8D1HHHal+KcLWnL61k5NQzvHsTPzKkcH42aDsFbeUf4XKriNOqu09d4TsCm2E9JG
usKDKO60lvyNnlCz+vuCzXSEs5sfREZbmJ3MRuEYD5JA/W2CyLu53YPIGqzZtunlcgHMWd5RbbKc
/+nw9Szje7xtMT8Kjl33Rqd2r6AJPaSDYX/Yy9N5Q1qlffyLsgtvxjejxEnYXxuG33bCe5gQ5ByK
qcAKVA7h6tfIfHjOVdpgvRfQ2rzuEmDye5glOokULHZ05kR7FBu5SBS6KbcX1h/7ltOSbs+vTmks
h+sin7DoBIUGqhPl93iyMPHTivgA03JmtgHwjvyJ4W99upjl+vcR+VGerf49MfqaVAZGiBI9cj6b
vVz7Pfem8M3F5ZYyMn93o5Tr9gZee0Uou5YFzsn3Tz2tMyRIBT2uhhmqS7ykH3l2oNUXbmlScjGp
X9XsmT+m1BF6J6OZNu5KmkrNx4dgyVeqBo9ewlQXtIa1jXPcG8Su6wenFZtEKxJvobOfzSCHEGke
T411S2x/mrsVMr86Jh5VvnV9c3uIBuPiYw4+XQ2jCoee8iBGUbb18NLQgdu2oLSTxcWUgvoGXJC7
wD5xtiBJole4j++ehqPCzXMBnGFQBV+wkruM9hqWYbpuRqIKFU31Na0Hssy3evdhdKIve2/MFQ0C
g4mJzjeulTWj4E5AiGjizlEuXPElvVG+TALkeJLjIqABkXJ4lvfhKm4gHTABrIdRmBxMDwr+MF+3
Yie4fiEuoeaD7nk0qeINDNMY6N4UICCtepVZjzKzSByJKz8OywCGwQQdH87ASss6bEkS/LWqgsgq
XT3f+XxJSEXcE2y33dA/m/3Al2R8Yjx2PJuKLGfkfqhF4n4vPifM+dj70Kgtks20uv5VgSUXutNw
HvH97VeLERr2NLfLrD3eTnRPyyokurrmNm/VoVhIln8l6wJu8KRTJLN2sXF3msKxvbLzJhqbD3bI
mhrO0aHzR5YkcywOU1kCIH4FztyruVnvEvOgqKWjf9r9VbW4mrnejdGJ4q6tULIKN4WMPQTgypEE
x1JFxg0IOnhjxvnKJFbcTlhJHh1M7SfFDXpnXiWWcf7jd99Wg5oezoS9XUnHFHdBn7KFUfJyCyyp
E5bVqIEFiDrmkjflSTmlgtMPjnXRr4Q+xC5ZfnwaxgmjxbC5DxqrQka8h/mydkF3SlJPKJcxG/UQ
7uK0y7x5Md/9Q1G1TAmcF+Wm2aH6HtcfHi7FsdN7ilj7tqVHckYeIkDywNOjvHXOtcGREm3GVRym
xpSEaQiMSq17CkyAIhZsBz69DMcnsGXZJ6eUFU1MuSNZ27y+RC4n726UnK5ASywWPfMhvYh1BKzB
oVT7tfcrrPm8+ZhPJblMvm4Nqmo9RGXrgEBWTJgAz7UCdheXkdgY+iOdqNylGQJzrVCqOztxQ6D4
aW4yqe/1jKsxgCAvhTFRgfkGDd7i+mBwTgeUp6mgoPh0tmSSw3JWqmaEv5YeBxb8GSgjBg4w8qon
esmEmYrfHgXJ8Jc4oGJS7VCd2/U3dqxKLN4pAzdQc5gmLXjfEEvqgX9YLledk249phDi4EU6Owi2
qTGeqYXTHJBDDBIH9DHkoaGXq9lLgY4AJYeoaQjFHkU4SUPmia/Jt5CUXLwXTg2IQ/M8+7YtWHPd
KV0ODhYIiG8afLtq+09sikbi3LoAMH2In0+8tAYTlwO5v8wKYTg9lPZrCyn4ci04YI0wLSKk3EAw
LdC3euoscf+Cg43VdfB6FNa5MGGn1HZ7dJ9WtklC6QLjnE13I75goQdWU8rVEaUIchcnE8JdFqSt
mUhP0hKqzii0VjCTxwYdOlVfswsMxpKIEuftJi52OrFVcJRb37cMBXMnCtNGpaLYeZz569P2L5zr
sNwP84b8i+DZ5Ph9qYor1qsWu5fK/xjAntCzIuhchWBpFpYp6EXI0qG3ecc5Od+AjlUBgf9s46mu
Nqx15v3b6yl/wmFIhdzgHmKtgarfnIZkXVMQ1gxVE2MwJkzg8bMbfPh4JmHSHh03gyN3Yl3aUP3m
khK/57wV0jmvVh+4yGK6FQuR86wOi/XLhoONPuY+0BiKPKy8ZWftR1glALeamQK73kt7JZXGfqUO
15baL203TqtHCjKjYMB7DdYN7I8YEYqOh51PjVRlUHfwymGiNBeas/vkxizuCiNdhdr/+LqBa9bd
kKauDY82NKF+NM51G2lLZHrcvZkUAxnILXO5sJz5Vk5iQPKsRfuD6Ud8URuxymWRBPOIvcLx4i20
vvdXwwWVbDWR08RU1orXlBUJjqBrKLDQyF8ZOaXWnE7KtHaJdPKvAhB/IXGTQd5u18Jyqgonv0Pu
qcqxN9l3nODqIuH86QhA3D3W/dw2enp+7laUiT0qTprnhrJC7hDDusryTPEA8awBOlDRsDxquF5J
Uqjdp4zkCw8fX8Z2nkno4cQdJQhL7A/yGQR1vLa5cgqfTmqmH/xCARfsJ1gfFENX3BV/ZdYWF+95
c7r4aRMH/ooc88qgX8sZ9NTIeeUd3yMKFnhToMpvKz/G4Nge7FurMY2JP9T3Yd0jNWuGHFCGIiXf
b0+IJVT91kVjnXsEvmCSchiTowOV1blqNrlkTLjrGKydH3FDCH0hFCveCnrO9U8B5uBM4bTD1/Wa
KyqGKYQ1N1jEMibVEAAAFKBBm4BN4Q/yZTACv/Zek0SlUViQw/7qYLzR+0rvyKn+bZ8SutuRhUoe
KNHQtU/2EeYMKb66SMkX7j90Yr2OvFodgBIcubVu79ByPN7eOP7T3Nla6U5YwtbAXdPd7j2OfGIk
VdJMxDT8s/CSB7QpRiaapXOisHY7ZTFQK/uzQybT/aohgwsIrJJ0tGyPDve7eb4PY22lFlFrT20c
2KkQq7IxbUIcG1bjnKbe21JKQLpG1nqS+fC6fKIFKns3JP5+wg8lPOf8ihfbM4dxOEseCSq0BNKm
FXj4JsOfTBArtduUT5b45cGURHWMRD0mxTeIk+Pjl3ZHPA3Cs9BkGtxGl7tsRxMHyvv2T8f+CeAs
Dd1aZnqbm9ONnIPcUozmNCNaQ39Q+BUDqChMqNMFgckM1FgibHt+3KaKE92P7Xy3NhAcAoksd+TL
h1lZmYf4ZW56zik6cboTqA7/qLgX7nqFAYIQiwpVDiDCPcDJQZ/pHIc9h5aGlaFuGOo/5GhNrqfK
90us5pgxrfuT7PBzX/rrqy3IuL5UHzZH75tQQAJmuTsX6l1d2BFf7u302vw+rbQ1av6Tr7mwAL1W
rnpiuALYXb5v4taCaO60rqIjZ/iNH8sBYCh/sSPDunMdCuvyLcu/FrbQLsuwV1A6lvxPMEUB6DpX
W+e4SDfIN94CUnbWH8SMl5dQwWPNfbPROGP8TjF1NVctYQE88gN3TKQPBMg5PoJGCnFuFOwgswyV
LiCT4UWlzSlljHqA0baWXZhgiK52Rk/mUUKfPbHkb3LpKCukyGNdZYZmsm8M3wEvEH2pGiV2lpuJ
GnEM+9y8hYu++dXzYJVxuyD+7Pge/Lu7OyVb039jA8ana5jAW/tAyQ+AbSj9sgx2rVCOeuhA0TJX
YwRTaetwDOeNVwy6gXBS8MHNeI6NaFgQRLqXFxQNjbpyce8NFQguij0Oqax6GMK364zJBZXTShuP
C4QdPRslvIcHl8H0XsU+IM/rHCW9OX4KuBQflwQ+t45nXaAOapvK2IxyRr2XrVrdA6NVWU7X6Qia
A6CrSsSHQBUmH0iblHsgXkZ2Fisq4miuFsRgIx9Yuwu2li78M9KHhTSnGRjlOKi913P1Qg3gOyb/
nWXrIl4j7pNazPuvzqWx3yRW3cUo1S8hRGBUoIONYzUfG9MHyuMPhrXBiYRaZoKdkN82kw55PKKU
uXhHJG3MWDa/3jK8NaHake9I6Wd4m4iPRZsTLpoXfxioUsa29tYIT5pUYwaZ9qHZEYjFEsdwnfJj
QsaJdvYsfp2cRBZnRi82PnjEydCf9MKcFxZaryUZSFU/OUaEkmh1BPAiIprHdDjxvQPvJPR4940F
Ztc3Krym10KxQ6WFVl8OX6oyIQaNflFN7s0yhYry9qqhXwbPk59PILbzMILDhW9ffgvTt+lGxTB3
15KH2qaqif3ubvxuaP1EdBAz7k87GK017v1Dv74ea7yNH2vPnXyBz8LwxDJmtnQMoBZi3yObmSYU
qbllR4pyi7xGlvsyiWiCdFfxi6/gSwMpy7kbVnHXEcx0JhMEuAA8pJ8pe6J6owJJEqdpuwMrUEqZ
YvbL53fovysM7UjAvkFf8U4JVF8+3uAHNOl/cCdvJwk6zf0tcQaHKRkfUknA9zeAdRMzDGmCBZIp
UIy40yoDWdP98hXHb+mQ7DgRdOF9eIRaAOV4wcKDyHYTIEck2yGtxQlliNzLDD+tUL7sm26dfJes
fEhd8uIGcilfnln+R5zFr7QaWc/DDNVKbwHYVgEs/NxaudA2p6P4ldj750mJx/qkwm9Vg632WVN5
3+vS9qR6M3BhDCcunL9Bp4yuXbqh9BBfguoIRTU87OxzsAf1OfBqBGMIeDdHmEduf+WNHM31usCn
j7gLpkcwF1LGIHUJ0l3om427GQEponpdj6Ib9FCLU8mE5/Vlk4nzF45Frt1fvnHVG4QqajKfsy26
3HWm2Mu0M8YubTd4AS9keREfLHcZR4ADZfwfEZEwwCzjFGNFgiTu4Ts5dOMjgCeusLiZc+QjWLo7
etAO5fTgdTVEfAgnPcCxRG+S8Ui4nc0Rff6QcV15SD/sM/xSvtfnxMD0gux3C4F/DL9CDgQo1y54
Buhqm6MVWbUhtEXuU/B0L8tiMDBNLxJDYZnater4haG6bC8oawBwFrdjVTlDYEeOVy+taTzodD/E
K7aT7YFeEd2Sg5qkz6bP6mt0ACtj1y4dojjazcScnaVaZ1uc69vyp1JRCNC9tUMnZ1biPp3p6cR6
0Qi/GF9FGlA7gM2rpz3lMRIMHzRrUE+z/IFFrie8gxzZcT4YAEu6i1lfh4f+UMPlibvlC6v6OaK6
9qTjI5+DE+fAJiy6sStYybVjKjrRuXRyshUv8CiC2hjLeLcEPVNXeUmtGIqVfjxWLASmcPgnA8Pd
qgkUbUQrmEBfzbyk+euSrpA8TPK2EQv++MZe2NUavnyL6eoXGmvx3RqVefXBnjOQUBc1NN1e/E76
fAmcaedQhU5xq6OaQRa0NmI1PEEz27jDhETwTTqjW1tLLeXB1qw6cnUsQq9Yjc8lNbKtNvxrRxQC
vpDlk9/mEEfPqyfIp3nhDOWO4w7Sfo8cI4JDodyuKvl7THfUzA8l5J70nQZgTA+zb7OI7+Z/S8ND
27hIoqdxkHiIWIXO7fqwkPJ2y9bukHAw2ooo7XLmBc4trSujaOxOHdyKJyoFlACg6aZC+ZsKVGwE
jtyA06/ck+7l6hEQcMJFbjFJd1/N6VdQHAIzuGDTeibhd8dE9jwbkUqvdg+Hig/iL1wTYrHEtnLn
JxFsw5yFnwkOmdJkKWts7qYk7YpbRpnuJFLju8w0ECLwyvusZutKjk3f10XX2Z71f1iMI/wXLOB8
ipydYx2HBy4B8zEpG9B0Xsin7745SCXeLgmMEmruoF538GQti2fXbO7/qxbehCkvkWQQSTDlH6vW
vVaxAYQG26hQQzTMHj9eEEtAM+d6dqhYfQz3e5p77FUMPUkTHsEwuzQMalvxZhJFnSP911EeNt57
W0FxLBcoWDBnUNwLCyCbiWtaUuwe3Gsv8x0o9GVrOW3PfR5cqH8pnYVMfu6HRgjoJegdk6iEDcPh
UGrqN/xJi71/ZBE7YTy9LnBIoEZ3LMjnRG8TTlTnbT4hThRATKCbM4iunOqvzZBipGKf3Ae+1ZVX
f6LqDqpIS7849rysONmTZm2ZBNTWpaGmZBpoy/Faxu4RUIkfY5HL38tAo5TM8uIEPdhXwgY+hBX/
Nj7oujbT1O+/c9UDn9qYrMmMNm4PpBzstjR+RY3Pkse7tBPBB4AwmF6VuwkbTo+YSuv2Y4R/7rmE
55ZWHU+Ck7t8YBCbAwT9T4mS5Y/TJuRiTeZWK6qVnfZF3OTzuJE9yaCFr4QtOk7piEjrFnUoHZon
/zfgPPhYafKGXNpy4iqsLgaFGZObKatfyMvpUdABcTamieE5YV+eWeyXSHKahWdEYmfc8vvR9XPb
tfyN9raKpULhcDgt8rlZimXu4tMLTJWlmAQ+IaQHWLvA47AbXDirP8PsmAttZVDd1FfS9uaUW0yO
OYTpil6DzVMORt5I5tLcf/933ozl6+Hk/lJ0baNQyj3oHbZEpR/fpS6OvwN3OWsSdrtz0TYe603E
1jd2zTOIn5dyVotsXIz4RxggwH3Ye5Br52XJGYCRN/8aI6I+aChZAHdW/JkzfLw+qwrWn6ihijlP
VNfgAcmYTIs+aUBjW6PefqNNZvMRdO8xDUEdtvbYGHV86pp3MXhpuPTGVPwLMyvRD5tls7c63Tzx
ou20qzDX5tZugvqj3FPCLU38UdQitm9Z5z9WqxNqZyb5jg9ggzUHsViB7JLjm8onQHpK2ssn0wy+
nnPqB20fxBKLNCFKof+35vJgvrY3A4tqwfOSZ0dzGqCJRbGAezj2TQC2vtzf+sklp0nPI41EgH7k
1BoJrIfgOP9PZm8lK8JEfTIB635JZJdobOH0IVXxGCqe4PgPW0Yb1rCRNYrCTItCL1opAp8YU997
/m+roz3aZKt2kh64YAM920wppHsWblh2tfcQprlnSL+2vggJAtVI+bA5uHKgkiBNW1U7yTx1xSW9
ebJQH7xrQ/SxjXId+5j+k8HQ3BCx3+DCdQ/w9VuhFcfQxEpQ20vYI+gGLQy4/O1u71WipnGX2YGt
eQRr/gjduPnEDxrIOj8YGpF5sAITHZ1g8MbKQapd0cDBu4mlqvedZm5uRUnGatk610loAxM8k1DX
N6dYWyyw9gCJImJ9gCFRCK8GltXFIhUuZgBbTkC4f8v8HzC5tnAh+x7PWo41A68/Fx556FDjII6F
hd2jZbkTMPEikdJeXkMel1UFXUbtxW54x63DBCowmPpCWUzjd0eut/3JCa0uGf280BHkG1kozwkA
WGkJHq/qvc8QoSPNtBudkm3iz94VG6L5H/ZJo1gkrrOpWihLX6lZ5nt97rfx2cIoGWJh5aVOlEsH
mn1lWieYsI/oK6Da2dVqW3pdMgKRQKpiJol3fMNrJm8dbZyXJDc6IxHPjPSOP0LmZTgG7dFgWciB
k5oYBCiyUb0jU3rKVMys2znXrLwXVoicMaT7qwOIu15PT7V4ir7xN+mYoQ82klzXxF3KqbyQXjQq
R7cyqOvBzzpI+e+T8i/cl6uzk2Sa11rexWaMnGGpHhhqDCXnVV+0ZbFGG+6ql52qP1TIsAMDuUaK
YtchUsX4CHYG6X+ZbR6Hrgy9W1ekeMpszs+MyX+0jTKn0Jj+Pe7Ncj51Oqn1yPx+gjzYn5YhZQ39
YTdlqKY8t8kKKRTTWxObwbB4i9lAUSsEnl5G88WAvrFScm0N2KjDu7pa0FMc27JtfcGKcaQPNhoI
DEeeCVK/zQwcMDchl6BAsTkHi28ACruGnA0Y/C94tYq42LU34Pgj3k/sO1Mbkn1xPw+a5SvEVSzI
d69Xf/p2MEhdspsTAAd90x/U17ExxinN+fZ1wC4sUQIc++bvkDlCPzqV/raiVt6agiXYCJQmLuKx
OTfy9X3L7c9RaiQaVeW7/jU1RDxissFemvsTAch68RZI9DmO2m1l01qJaU6lPCQo0kAU4WtP2QUB
9URZmBXGeUyH9L7c0IWXwM/1vQcxRHKxig1mqomfVhYb942fTZEsftGhWHsXzXJLAwsiFpFJdULF
DfmXTsD0oq/WpVS++Y7idf1xWFAo+qgtgrnD1aZaC/yfZ9Xclg581DhMi7QZOIWDnGThViYPdgDd
c6NcofHVZ0qU4cGOEF83rDRlZBRlKW8/hdKztcGJIl1Tx1UsOKHDrnxY5th+2ZSEpgOOn+Po8kdg
munsR65khPVMa7y3F2865yii123DrxmZ3ng86FbcvdhIHmbVFYeYsqXUgwr0MB3eWtSxIGHLNQFg
YjrBvF3fAf6eWCN1RWa9ZZVq7SEOEU2CC/A0vIXtEeCdVLDIgpFYzoWFEe5qrealuMjxZu/StnFB
ZNP7vuWH0SxkDkYpfgdzZ6ovyV7K3IYSCIF8gs+JYskc6IRPF9lSyFoxNSii4jvx4X5cIUAfawsc
lpm0XnS0mq8wBgEPj1i2vDQ4A/JVPgCyv091JBPyQ74dX8JMJRIhU0a1PjyXnuK75m7z/IGMdqa0
8w6us+jehZDEA1mcNlqT/sLIIgjWmHk/E0FfvQ1vLUcNO34jx0wpGTDggm+tmDwF7QnauyNv3NRy
B4VwlvUt/pCMC4G8MKRbn4uNMd+LQqoZzAJzGfC6YG9qnnpuKrr6uOLwwZESXW8TQCEgWQVqg7c4
anhtQ/Uny8V7Th16+o9BdCeP87VptvkkuXfRFjsyOSRAEcIXe2LjLeDpBfVfAnJBx9Se9gKFy7yB
xsTGN1KcxBhtHRm7N1Z/O2p84Itd11iFX+5gDyU6AQJkGD4sHN+Fr71nljYFrCAIfF2LW2POEMxz
lmuBOOhN0Ulv5MnPEukiwsrXVkwN/KgkQX001vX5sDsHSYCsSu1Jpa6/lQQQL3uUl5IZrY3xROnp
YMUnOMQxFnwnpyRch5JlF2XivKnwqUSEiiH/nwGdcQaFPJtoXIowAJ/hUt7EEVfN41tau7pHqOvT
eTAGjeU2IAkNWATsHqp7DzCHLmhm8Z+dVvHqx7yeQJA/iRYp1gKCN6btRU1po/6HqQTsrhHhwsYY
4XhyOaJ/AKh0FPAY9NfyKQQujBfO5HkUbQ4RAi53mEiVxS8xd+fGcBokYyrO0HSjlXGkDJ/DR4Ry
MxMnuVvRTvJvl0Qt7new6rQAiP0WtgojxEf2xdPqkNnXxK/8kx4I6UcNedEwFbEFWObJ7tTA7JFb
jL8wzMK9WwiFKji2E4aspjiqDyoe0m9NZQNt1bckgo2bNWc5Yd+Awr6mv/catSEsQrksX2GKkwq4
x3xTt6Nm/cizuqSrDmBDIpt+e0pCLkuiwU4uVdB6q5tJobBjjpTbdkH/85L6ZTDSg1RjQtVkp+5D
uwsRyw2RXfgZU7Hj+/4XrI6XPUDAw30D786QiczH2W08X9LOaudLGs9NO2VLLI+Ga8u1g6KRLRj8
5w2qGefdQpPcVVxsVRjl4Gia3SkKf3+SYwoD6/vMwPEQgnhyy8p6Kmofvjt2zXAc91ArfFj0Q7Zw
pCvhGwxnAj2EBDEGpq42oAA/V5hL4a/Y2Nqg53OxqGL4zmL0OxoI6D24h3ibC5tSRWFFi/lPfUKB
5FAJMdosQeQiHMjjZ5pyVoisJdzwMXpEaGkn/6sg1hK/7JvLSPmfzdxaRuhvbpto2wIjd0f2gQrA
PFYO5FxzBNW4GXbDtE7F8g+AU3Cn1Zw3gzvwqacttZJCoAUrYGKiu9ent5zARf64Pcz1M5XOQ1t6
FkzJlMsUrIvI+4+w7Mwb0gQSDqnD5ZQ6b71BgG5m4EmSAlctVHouP+FAWOBIKQSVgST/CvvzOW9l
VrClhnK52WkPTKvMlq/aL18vJLDJQI80o/3SwIJcFuI0CLGjwC61/ZfKzNYS+y7uVSQsgDklzhch
Sa4lYjAuDpIpKrWw6YYdHj9+TTW35ZpLtG4Hz6LATnJb1hKG51e6t2PGrctktooTptWeQmEAABOx
QZuhTeEP8mUwAi//L8lX7T4Ylj639v0Za/BypKxevdmLTPzI0dYFn6VZlGjKYAJASY8gQtQJRlI2
0ms41er0rlIHexFJISRd15T7yN3rIiT/zRkO/WmVhYPigl7h7jTNdYASFv7zbk6Ktpo3xVNjWQT4
gTjIj56mkke+I9gYlXGQB8G9Ac55jOn77Q77S3eyUhPIHKDZYKxsU1TNOWn/gszMNtJLRu5u1mdC
SJvDLSjyPd7ZASzCWhQ7Je0nyGsVJAzc39ktRh6a1Y68xcHPlQZZyKO7V6ijYaSDT1EJy+juS5Dj
q2pz5VTH6pCTTnW1HLrjbin5+g8RKHP0ve62tMSgTN4b+ANHDrUTPmH0yR+rvr2MB5bkte/dONCu
VjVb5TBGGyoX4Q5dmAeW4jShmldaPTmjmEHxCUb+DES1Ja/zcJV0UoQ5XQOL/7zPiYbVabn5CHaj
27tRwDh0ihuhEonqe35LhMeL6NgpSSC3mWHJYnOizAjR9gX9919ADumwCTD1wSRlqvP6qqQcMnoE
E1q4EGVGgICwVUsEe/xImIyhZ248NFoqMCRpsAgn1sV4scB0Lv6/eAf4ky2l3YEP5Ll1CsiGYtCZ
0RJLCGFx9BgjirrbH0oms1br4tDbiXrv6vMo9gEuo1alDY6p7Jk3ocsMqX0m/MYF3ikKWfXpD/LQ
1kZ/cnbsDQPOrueO/kF4kMA13pqICutcuXyhQbVtIit1EOcoT1/P6pdZuZER1m+MoXoQulE1ywYr
BhPCcpuuob3pcuzDLelcgUOT/WrXbbxqsZjczZufk0trGK/DhGxvnbYpyIikNwcZvF2pcr6eCnQU
g8vXNYdRmiqMj9edJ50RFtH0Gpn8QRRmprOTD7+wx3C2BIdls1OppY7l8UWDAtpAK4I2Lp3/qUsY
GyC/HVcynpcbMQgRgeH/Jcw/rvGUCQ7Suc6o+8CTry3CpRnOuteDxVxvixfn92Hh2HhjK6l5lul8
sfEA7WQMxRNiHE1G73SRR+4tt5VNWyjQnTT0P4UaJZRQM5xAl6nB+WEUGxSWh79r/hUPBI+S++P6
dmUUrHzvUycTPvRbI/zbpcB4efWPYLPIT0fUvBI/mbHYayHuys53GXC63f4rzUX5TyQ1JEdV3gfT
Q1krPGa2bhrq6yuXwKfsQaP6GbOXf02swQEriXpJ7CZlFbi1DKlcNgkbjC2SJmE0bJPl/52sQ8Fc
zMKfWhOhvE/XZE+8Hb8J78WB/foO7bfECFrvygcHfnxxHKrQhGnc9KO1KMAKmDHU3tJTJkE08h25
bho3asCKgmC4lCVqhtd75qggILC8y4LfMsCptqeglpWSUGiAo6XH/Rpy88XMhzuz0kNPgk/KwYMA
SkOdOfhDsROcjxoCxntgGXMZX5/AE3IYlJujAhB2d5/Ry78p11b0Q17iITbq2AGzSr8eZByl9T9Y
VDI9w/82S314QbHkA9Z/q1Q7HfhUAIVn1esqA8uQmxvg9RXO46FwM9/W+ltONgZKsMnQKoqfuxNR
9fq6WdAJVAg89skZ26dHnE2GbSuQPrLmjbedAh2glrfYzqQfWvJ0PEOn9IgQ7GtNLGSKIzfO0Ai5
d4H6m396hYdgjk+rrU2tQYunhuRkig4NRCi4RBWDutyJdqPFpEepThSIVfiLM3vInuPI41TU5QuU
urolZFiKrBBeAhef8NNCzHHYTy5pnez3jyCqnAMCp14XtkQNpW7O2lCju5FRtzu/aSNX5uRHdU8a
lAp5eJkWsjEt8boxbOwnYSM5G6PbeOnb79dW3wUWMLLRULKNbLBVUitaAC+YhdgANIqYRGuddbUX
fuqQVeEQwbIzbMco4gv7sqYb42/PJ7NJXR6gggmghlDhU6QjPGm9DdiwyW/6hfOZMrmyifTLm7aS
pIl2jJ+SAiYcs9+CRDmpth1xrky+qspLc0Zpl6EyT5ZpQjDiHhPYBDzHnkSfVtY1BPWK63MapJGu
DtO4TD/6/hjaQr9gNRXInazcYcTVayI5udPN9DB+hNtwZlsZ9mpyrNQbOjazizEtcaCEGQdK1aUa
YeY1/il2HYEWW6AJDoW/EI71yYIalsaHFQ1wWxzSjYisnBj8tZFcgXkb3jeSTAqZ+eWUlbTYzjdb
N+zq/PiUUewi/hAIdJDEEFgq8yk/y2L3NaV1BuSFsIxit1LepA9p8dL/rlMQsItWHFCShzPzgP8n
M2ZrtxKG3w6yK5dhA/b7qbqmDwygl/FBbvVKokGjNvGfdZ7dAA71qG/S3DPkbCcYP+vIw7bPJ1SF
WcPxqb00pc9C6YB8nYjQiLhkU9WlYyXGBti11KrINEHECgxFSbvsdHL1UTb6OwTN1dwf27LN7S6B
aZUu1x5eYogB/fm/b32cucun28u1lwIAD8mXPfI5FQRaCJsiEV5rW23U4unJy7b3OV+t8iFScZso
zxNEZr5QM/m/n1FCO/uG8Oxb+nVLg5N/yh9DCIqeURP8BvmeaEqz7B8W4cVAqWUl8xfJtyngKePc
+N8LP6NkW7sR5I52+m8TdLv5r8O9dh399pENF8n4CW5vCLCNAhb9Lb1KTBu5cpSi5iRbpuEAL9cQ
hK0F2ZliPKTz3EoYnG7xWyQdrsA9qN+mPD2asNBQKq4BG3LBHJQs+Pd95cXmG1yOVb9+hTMWT7uL
opScOZGTYWZ58PlgYn0VW8RH0wb/ZUwQDz9XkK9R/itsYG4oITUTSDXKm42NJ/3jIrqurXbR9cM5
C7Xd/xDOgQ7yH6SYSnlKWhQi/Z4YFgWRzGmpBdk0OCsN/Pzru1WDUC9zXPwh/gqiAKBrTyXxf5Hs
/lZ/HGyb8Yd779hAEqkTFDa0VWaP0CUA5XnagY9ZjEw193/6FzqJ1ECcfEGJvg42DOS+eHpzMytM
QsReIKvZknSozexADL1iqoBkcVRpis6VQsn+0/J52TAQQ4BnhntpJQmXP1p/jfg2PP58mP4cMeWW
l0kQ0yTi0bP60/1SPk0bMfNzXLsRmWKxlX7PS6P1TTzSq1vHljoUUusFa7ksVayhARUVndXIjTsK
lHZLsCEwOK+1OclURvepEMUg6nF0YLrv77Oh9UNrf4Hx5XZIXsZ5jWyGZLlSwx9h1HooCefZ5N4g
1bm564HxL99U5/W+I7RFI4MQS03Au6np5Clv/YlpALX/xecA1xYt3f5EHbHlvwH4kXOGO/ybSFU0
sKPrrkYZhkZQ+vs1FHryY/2jMQIyHzuuBaw86HRj4f7T54F4XF5eFWp+dgbTatf2dyv+3jZHLs2P
snsREZrY0SMdszb9wR/I/2DavWIpeb/1VsUvycxmV36WhrNm8dd8B0LGjbAkUkkZteSboTmzB6MI
bsvZaQFjz9MxfM1KInvNxiVwQEmsHHqvbJFbQFIMYPgkV40c9Ie+yhMYSBIizcTkZj2Q0FrcFGe8
SE80wyPHwyMcCnPlYc/Dvjk9k2JIA7jU6kzIKEIGD110JzbEG/MOcwOBUnOhWMBdjkLpzOAg3Kws
oXoX5QttwuNyQG6FP/LA9yqG8WXzwCUISs3sCtBGqsUKgmLaco7sxmeWzDI6+SXd75vjmTAgVNVd
XnepHV6ivF/YfWDdF5bnCkUKai3Q/6SUtg7fyZi2pmyrGSDylYaSS+A77gMOFBp0X0AUipdlYGfi
eSS3fS2J++3JGg/p+EmVRUzi1cqbPclOUTuC5LEdGbhToZNPMZdhiQ1lNlWUqAK/9+7dIJrKbYqa
J3CAkAaWcJNl/Fe6TL8Ih2jszhwTJn5cSF3ksOyfV5EpnKwM+nhqFnkhObIZGxrC4CNiTpKxXhQ+
eqjagcDDUWQ8N6dF8+mnIjdWj7mZ/aiD27X9vJI+dkTfvQqb/VvYEVy0DZbeGVrNQUAE0n9xMNJp
bMbLJx/9JNNdmAZQrbJuQpil68+hPm8LnRMKh2m5CQNEqC5risvZBumclhL1HP4iyf+ypOzsn5Gw
vtRBSOfbcXgtyl+NcaOyl+CkmcSY19daSuxtHbI75inEmxbfgN2/0EKc2/DtoF534jkoAkVXtwjh
Xs3eZfXPTRjEKfazFafK7dx2pEoYNRz499zjgin5LAHX8go2f2U9gK5PjulAO1+yOa4nS4dw2LvH
nVcFkX18nQio3IeKzg85BNMYajznmfAsYtXzwQzIxKyO2JuTFC0z3vbSo7X8rCSyFH+RwrWis/JH
qUGbGOzeCwESXuglFgUL0brfPlebUcDp58SU0wmkrap+uEC5HBjKako5kgMERiIHgRkBerXOIRcX
QqVIaJ4iAZdr7MmieuULkxQVU+Stg0uumqkBBtDtayspDmWpBXsr9V1LwbhgVu+NhyVi8HS1ercX
vw4TrmXAloZ1/Ci4lCkYvTjHJ96de69snyxRkAJ8eApe3JX+m0i/JHxiTtlib07nPrrKPITBCfOq
ZDgcPSU6fLX+1fgo9oegbWQ/w7D0nZ5UGKpFEO4K/Kdp0xENOj4wG8llQm2bJaKZ8uhYmUMwK9ut
spB/Xi+uV/dzOtTuo+Chk2okeFXDwjvhYEmdV4E9BaW2+amqcOh90uw/ansRedsQnYIl0Yd3TTbE
wRtyiTP335lXk8ODFowC6ZwldvdiM2RKMwHQwABeNVEFfNhSDW0aejFwthkvkqfu6gjfPf8pEbJN
/lhi4EGk8+zkZm1ZvTHSSJo4lURX5ITUL1mk8xd4NZ7rN1XciQ05TMrmfMjbNyd++O14bIa/mGuM
4llamZQA2cEppmRbkAYerSPSPm7z4OSvP2G5tYsyZvibDRDGTAXegp/86kRTUGkpUhm6QuOvdt3W
/B6BSjvpY3MxnoN4TZ6EvMpTWtGcQutuKdP59xn96ndvV4SQNhrxDz/RxLSgBLJ0kxvgYRChlDZY
rN6XEDVxUfv84Ia8sgtkdjSCZr9SUkBYq8Fkls84XCi+lVNa8t6yuSEFHG2NksKud2KdEDK21oQI
MMZ2GfgQ9YmCKJjx7udlSvCC10UjyRma6D9jmy3ujgLUsYlCSSgOmYsS6cyJQElehuoEt/b0+7F6
GjyjsWaBO7Tr4bIWop2ybplskWX3NUetx11fvR+TOeeY8tYP3ZtFAzzDPuUYn+MtEN0XZL2EJNcx
eUEDUhJkKLqPMBOUPyqOu1B1g57WkMwrud0hRAOT/mG/0unNpke5L47tBJoBN0KDsSG6IgQs/aYO
Tg4OTg8H6D2bQwuQ9CpGhzxuksVa9cIj2zHwkNoFQmZy+rMWJsZVlRHMfb8spbWb+1rYhWFpdmG3
47oGBjf8D5/LQLZ+wJUhuUNQ96B2oLF9rjwvd2XoT2KckdBZOmynaIK12HOwPPRyREO+Z9r2AibX
AHx/v0mt4r8Z2HuE/Lm8QAW+N1vO2LBNxQ2cApGyIlFI8bU9NGe199G70RqMgNSG0xFQjnGn2lpQ
85SgFTGtjEH0W2mIzOyuVxv4YmwrlNUWFdMQDi6b04MW4SZ+l4WmtKSdQtcO3z8XzMs5UqNM107e
0NFoLpxYtW9+/uzvKaJxDr5fw1f/pvH4dFOE0TL4WMgEJ6iGCOZJzu2VCUrvfwIzDwlMXPD39l1k
ryfilp5JaLfzgKTLRfxzAniCTpIeZ2fffOF1530DBVrB8YZcV9NGgpx3RpbswE2CutDee2PVuX48
xKgjegqE7ZKhSYiHD2b27MOvMIch/X7j7X8AuUs6IAuLTENuq0rxSOzmkzGaAQgAglFRDAuxUpu0
zBGhH0lmnrjToX6m3ByGEbyjV1Awnga7JmMB7ZlHhW0RhwGpP1UEN9L720bw052sBuYYlxOC3Rva
TpcZhfS2pDvqBjL46kyFQ1ksvRTNYw6tuKwPM7ifLCEpRx3ujdhdSNgXbnBwlPw7cQ/wxTwwzzxa
doINiOURtidhGj8ENTS4CBb2A6aH9GxxfA/jbg7OfG22jgtIzX3NuzsC7TDxmZn15mH1tIIqTznS
v09ngC18wUAQLj2dzmkJHVYMaTZemg07asbLuak6taHqNI9CwLowDiAr76zAGO2aMHw8+9SrnwNx
dsCBCTVAEF5/kr8sJQr23N1ojtl+Dn5MBssl1TpeSG9H7Rg/1gnyRCb8NlGXX8lL3/zVGXJOjO70
nRD/EwASN02i+iSJ0hi1LDI2xtxj/wzMzcY6naFc3Dr6CzAEGY9CZxCwtydRVqVRh6LYqUDDKKtu
B/W+LDOajA4pGApeJpT2Bs5Gz/wXJROzmB0wNorGYkUPkMx4C93DM4jktSz2BpP4Yt3jQbbpJpgM
GG1E2XKw/F+daGeb5Z28jIPidrvzX2vrJELdkHAht6be9+o8Y8MGN4UdHnKGiJtLh67jvogMGoGk
y4DA2IKSgERSXW9wH37LsIPaxFA2CTTYNVQTROcEk02dITh8ujSo4dLIC1YrHZdGRUCft2mMXh3p
lEnXT5YzpsNxhvTjtMjXUbPgd31Vzp0nELjIMmr0K2tdOIEj/1kqq+epgc7YOojTfCJU/2aPYtxJ
4EX8/yhFtXb7R5vDkDdVnDyiDX/AHWepr6Vw5RjilcB5KhWRrsBdTmwbqOlsyz24AAGc9ILPklzz
aHD+xrDO4kJs44ucSmEf0RsWZrTDhxh7L7a9mSNv8Ce25fWMZ8/bQ4B8X5McI1UTA+49y4f4oLMV
nP7vaIaqoh+phReL3cVPXncw9I/r7j2/1UlY6u7MHXGKeiYUyZmCyYkCrTd5KhCVFP7wY/fSbNaP
EahtyiRU4SLpbeD8fdhFdFOenVO8Ry2JQAAAAstBm8JN4Q/yZTAD//VVQC0N9q5smil7C0Z5u9AH
I9FZVwzHfE4rfdFCg62RFWxxOEhUDmfLSfq4LX5KVHqKrnwHN5GilomzdISFSH0kK59fodBzqo4L
I0E/iqkDkbBojt7/czK3rEqOsTKBRNkonlG7u3uV8073z+kqFNnYk6D80xgLZZJ9p+41ir60Kixk
1EWz0ZAxReyxYwmJb/lLVRouBr5/+Mpl7PD448U1vZq1S5gjPUEszzfVjgHseL1RdbgG0WuoZWIp
v2d87BmgyCtcibLqFn72s17kvU7+ol1/Kr7qWNVTUAUrZC8u7QnzLabzj9lUiqrdVQeDMsG2l3Po
5JZ6exShKSiBirPdom7vo4jSCYRu2Z5popLWOLrrgg9I1Xqhn51yvOnIe6gk5DBB221sGFO5abQ3
OnVOH1TtsWFIhDYflw6EJ4xoE+Sir7YxIat1LAvQZfi42F9CE1CBoNMVD2SmXoEzPt+CHwP5+l2+
f/HZyR1oiDnhSFAKfxI01ufN4vTICSMv303LnZQ3h6WcPhlg4m/bMkKZI3rAB6okb9a42mSZEMTK
j3pYXORSWqYFppjSUiPoo6vmeFcNQkV6xHfLssQ0jzGZxlI+R2Fj6txrxoaDzeVwJIlB68ECAp/9
kmxnyO8057pxrra+ZR7NjtA/6GSeIkgUuw4qCqu9t+O6mNtol8nyVCtFmSitRPkA/KmgIm+GVO0p
Wl6TA7UvRmCNt6ffX4+pfrW0ESoryYyuxGxTRkifgWPwDWpTXrWgGq5uhZDCgnFwYlUBQZji+zNL
9xp5F/TnkmmJ03Tmw750FvAQHZ3CL2aZ9ezTmk5cg+esfsvoKnoCSz2SLQRs/iq4u+Bdz9oZGdMP
RgCJFu0znPpgGiJ+CoVpaCtNzcTt5CafmUdpDiZCxIBaWaoPZYyO5w5XmljpJtwW527tgxIpEERA
4unhAAAWbkGb403hD/JlMAK/RqKqDM5hwHCxNr9+VwZuFRrWts61E63Q6JidqltdZprXt9pKkcvZ
42/JjWnASBtrLLzb4aeDLqWX3qgALGYimWnIr8y54DT+B17vqSoJdwp7hgY/i9Qp8MEQSY8tjYl/
KkwPh8bi5dfnPti9hOmAIA1htdM4noIGIobsAy8KvEEuxDJ5ddELy2wBFYNc7h5nue8e5CMBnO2g
Om9LKzfJrvxmumDMmR1x0jIOABj/TI072Ebvq5BwNXYMXVo5cmSglfvELvQGJtN1jZYUZNLkkPo1
MraTENYBixzYwlzmgVR19v6xu8mYhCClvBzt251m8t9lgILJ3JP7fsq/2fTMqT0v28Ff0ovLRvyV
UibXJ/XIV4ItuXJ9Icg378C/EqKdGed9uVAsP/g9lmbvviFHxWLxEx2W6R8sGWqIw9l8zA4EVVeT
LOUTC3jSeLlhwigAavwxnkp4jNpn7yqsdtmqPo3yJjxQ1TUYmDuz/Y+2TgRPLB64XaC7OEZOyuBx
AJvOsPvVC/8vncXvcAFPyXHiIQvM8giuU0/TkA9L+hcxySpJKuxHo4axsVnPbe0Dq6K+nfcC65IJ
KEZIuSHXf/yAo0M/aTn2NMI6PmnfzW3T7B8m3FtsO+3OD6uy0vzbKX/RBWTzA/y9OOkhumCJnXS8
CnIbYj+Itkhioxix50qYU5saBTm5nkDEzDdcdoFRSWMAmsCwCGZW0WxR7eK/J5Ysw3nIlAaTyC2b
VRsSL8P+1r5Xyx65mmgs8Lh90Bmmh+rp9EZ/qzrDBHvng0mvnsrhVr82A7pDsPyfJtFigZk5agSf
RSAORx4ajF1OgvyQE9Aqa/3GuBlw8PFur9HKXFCz0kcSLusvdwox+7XEZ94MjyTzweiRAqi2Ld2A
m0QKywR1lQVNTv9A3m7AF3m4P0rrkJdM4Tkma+Z2/0YYfL15LxJbRkjJs6xmwvetgKE97IMqKxju
sGuRRhl4h9WydqjnvSsJblXLnBpqCnrtVpLhZyVlboqFBrYxRDsBUzNLwL4av6gBvDmZ2ASVaDqe
9V7PiOxl+7iVDVy/D7iJU8IjWK5GD/QMefk0W87uUv7497LmrIuJ8Rz67gMtbRybfx0TZ+0luJzJ
BMJozbJ0/MguL0xCR3oOO5jkwYxTJCSje7eq8EOKAwgQwG+S/PsHi9E+GnuebQ2AtSVjl89Dj1kd
mJbTpdZAIPJs+OE5nVxyDKQhzytkzuYjBMHQbhty9vQ+4UOc91ji2w9IiH9eSlbnPKooLLeLuz4C
jtle/ffR4lYlrWbmEEDBcKc0dGtTYxN4GQBq2l/0+QStZsJWX8OuiVP85QnzHz/ar2Ly/OI21LPS
a1XLke7ff4f/ucpmdCACSOU28nZaZ4r0fJ8/N4Dv7SiOhHb8URs5xGGAilUZW5hv9pIL6OeO+fvd
PdV5dh4CVftuOz/hXPzn5l6btq5FZheREA47AJnfqFXNU6e5zxm6EUN968qw1x6O9WFm465oU+RX
FzYJPpNsqX6EY6R/B5NkL9Om3GfMrW8Ek5Ut0WAh32YTAzJh2gQXexyCuZQfZ9yHIi0++cebWFNl
v4fop7tjoPZ2kUmpQp8AWzYKdmu5MO4dUWRWf0If8QUu8sbZi6m1L380jstBsEpa9aAewwcL+1yA
+6oW/FA3Ld84a1/YuU3hoaCUrhVP4XemrdSNMa1WgOgjXPNzi6XB+5cRy5WHDJy2QIjSFxWZkPsc
ZCJsNN6UmkBhNOqdJE7nv1DDhKMFpdrm2UvYCooNNZGldefEoHrFDjLwMWfbiLczkYZh/AC023Vy
h6IAwe4y3D7H3l0sCkwXXJeMGivF7h5uRu7ikpwzQoJpdgkAi1NFuUyEwXWFWPA97DPAe1YgDTip
3Vjcy0xJtzhCnKCMAAatkyBy/+zPlCgL5GoAk+BACiHbmMLHzlcJsW13Wcz/m5EvaMTj0lnXm+sS
rGQW+pUf/CLbqkMZvB14G9/NHtEtoQLwa7MtNJ1gr8QxEr1DRy6PxJu+saN8TmlALG76FzFSuvKd
wbHnDQRQ+E0R2UgbKajRtxCPKXCEGclG0Ia/HtP7h081VBoSpyX1N5F6iuFHd1s7H3JdrmnXbLo5
P5wfIvJc8DNaCLW21heow3YaIiegVj6iclQT/RmRpD6Qh0jGW7UfzOOdvkAGXBbyMiQoIJ5iYi62
VgviWRbOUTrRW0MPc2pEzzu7OV7eJRbC9t4s0J5ms6UQrBrRaOoSJ7yqkByp7As575R55cSUJzf0
ys7WUAidr88np/+UC8q+ZsUqgp+szgD1ddKVdd7GEaT8xnO0YUTFsbnv7dq7z1bVHzWQbPPqhudf
NJc1i26PL5KAjUxdlFbhcGCUTwMekGA1anrm49vKOVB7Y3tf5sievDV8WPm5adkMVlVVgYLN7QZ6
SeItxiRM3FBY4G6gxA+/G1hQvY8WLNipGdDRVtmTteLPMEFYmRkzQFJ3s2QaxBjBREUylPx5XWAZ
+r7aMBsAE90G/FSCbMChpEkaqzI02tvThX62030oywHMtaJpZ23zlXMr50baCVzatRs9n6oOw8Uq
RezYCm7ocOm0DbgUo4CEwQE1mCZjuHkUs+9cTMcg3XJNt/L+JpY5jPmpoq6A/mz3ns2BgLzfxm7g
DWD2GN5aXTWpxAuCFcA8eLFKW+qevbzYY4CH7qtPCwutwhnqS6QTycPneL2Sd1zVjL1gY4g7P81J
wvTnhokJjBxUOEf26daiVAFbBxe6RvvOjc/urELySy3kxioSs6iuq97OsMVI1NcmcyUTHN+aScl+
zmObON3KlqO02suQEhLDmaZdWsS0lo+BcIJ9j/RhP8JRQ9s+DetteS19iSpozAO5kDqCOXRKSk6r
ntnF69QxsjJUDduYAyqYXB9rEzxxliBAB+m+PWscaXRE+VH/jVu46fv77vukhTG4qyNBl0SW5RxA
9cEsPghkS9k+Z2l+P0Q9pefEn7vTSlAXFDWMRQqGeHdrD35iEOy7eUq0ehjozZlVukbcpASUm7NL
dT0qRoQ4/84gCXpvGQpOx6oBpteMPeOlu40KFbXxHCxkwX4xrCBn1biKYyFoXagBfOynzKBaedE7
dFexeaDRnO5r/IfCUnjgvp9hy2DnqKkWf7s0PZ7+VsyncU57zgD9Q2GAbieYpX0NuFTEgx3+Jrf6
xXxQ4wkxMWU+EXwCC56Eyre2ImTFELv1IfUcRFo7Dp0LT2/9zAo4Dd6sJ7llDZyM8lVuqlxaFIDv
IrcxmZDLXxVAH33AYY0ZsoKG3ASb9a4szM+6q5pKfFvtk9Qz3QHxA99rVx4p5JhP8wQOKqQuj00H
4S+7BBOosoVdU8jEVk+xVMALV3DsXNmojfMKYHOhMIOQHB9jvNGAJpNaBwa0OOe0f5Pjp+Ioy6Ua
Y5KBV9lUQ26yM/gfm4rOyQh7I45FGb38s/AEGIZSReoHBBGnftD+7MNZbDbOrLxxcDCv+XyXS/rf
AOlnLYwwRz2FFYfdS+6R/wE4NwHQqvvnb61jJIoyplakt5e7tP77VIrtYIRRXZaFpKd24NgJdHhD
dikImJZLRuSY35iHv0MxMmoknQFx6DVvgRwhlx+uCnBLA9+EnrjUtZxgK9yTGyL6smqV6/6phsgj
conYxteOWleeGSKAAqsDpbv6ue6nn5izU3WOLjZPfRNQgwSubliqG5ZizD0F3u5N9G9KxPBHpztB
67drBIFNbPZmcgbP9Gk54VSdrls1HPC2ezWeI3HRBaw4J2PCpHfKmCkGc8t3rCjwSxm+dxVGmYRO
reEs6Yd5CCECAHqGtPHKY8TRs3CnLmZnrU7cBmbXFUgojSq9wQAmLQWIpDEbgpIVUavS4XuzC16v
uxjQTbNPyztYygX2aAugQsrKyDZrBrpO0z7aK/tmqqdWzqXi52BV3YOjjhRCFthCXdTdZ5zmiT+k
K+m3WuTcNLZl4a2TO7wxYkp/eaoPT/5i1jZYCVpuNqgUEMZLnV6+OIOW0zzkipLRaR+E7WuEKmRG
+ugggHVYQGsdIuRHqZNPzWThL4mmBlotIw500v58bh6ZcmJS7QBkoqHP5k3kKqJFOsDLztiQ5Zt7
oKZMoLVnxA4kOA9/f5dhSN0tIR7rx+Gu6+sJl7OOHUqccTNk43oSL6LMHl0foAti/B32syKs+H33
MjvQHvLVeZnQk7lVegjLTaTWxm1mkWL7OBpcdKOD5nHQvdyDdQ+jIbUHfg/iPi2DYsXw/qeUs+OL
pN/ZymCw65WmlrN+bpTLfECw8r9+EtNroB9KsbR7yh4UfbxnNuDHuUirGfucn6D8KXk26615FmAJ
LDcXUx6JMMFv+Cfws5x5qjdFfoBu8ToIZEvEFK1AyhtWB4d7PQJfs6F7S8ikxapgcLfxN5ivJmZ3
mcfxdXYyVhQKUedRy1Rivg/BbLkZ5CEG7Ubo/Kyiux1uSQeVGnl63cuLVoY4mtwrN8FmjbupolER
nuykeQ30I78ew0m92yRIZMSGe1V1l7YoQofve0cKiDpKZGpBdRFAFzpjwNgB3B2r+MkTqCvr056a
OTdFLLrMtH11hXe7aZ99oSrFMLxZ/4Z1WdzdC7/m3rzQmjvNCprwjt7H0FVhQqeTgVZ2wMi4cCtA
P0JCRs+5hyvIExeJciQOyxzG1iPLxeo6oiEUQtBAmAw0P2H03YScfPCm8XvKbDcDoz72AXfwTaZx
ssScc9yb1rXhXb3StfpCIUvebNqJNWO1r1AyIQPl26ZEWPcA4lwJjz6291p12Io7SbxQci+Zf5NP
HKfqBtSdl1h+LpANvfn3JxW4MMFgXaznqYMSBARTI8VRxqydITPLUeWXg+KwGBg7kFmzVTZXh9jc
UthGlCOT5QwBDu06YiRLSJOkpNYkLGHB9+/u65lkK+4n76V6yfhUjjCScMK1lZF1M3RhD/zFsu7Z
F3wzBNKBle1a3yPsFB0gBrdcj7UFdHJGuzDZZTZCXCLacEDNZf7ysb4khwj69I/BJYxN2Gnbr6y1
Srnar9vu1srb8FXQVOBqzLI7lNHPvFfBFI2UT4QBeydDMaXu3AVB/HfAF0PRzbxpWHDm3WQHLZEV
V5MorMbcaw/XddU1pkzo8BG6qUhggEjpJ7ZTePGawWrVGj4CnhSIHKeDxJ2J4TsPDmlhyr/maaeC
rxfEKe5BNRVUjVBKOgBF0DBuUIq59f0VIOZqMNqDSwAngTjN8Fmq/cDnTc+Btwy6ECWv/LvCgeet
B4JSnFIgu8IzA9YLIrMutroXOO4POrHyBqS2EUcdHCBT1tamPFgJWByj8+1c6Jh6rOJ2Yuimwk9J
13S17FQf5YmEpepDuke5NM4wd4g+qkUR+i5dOw92Lrigoer0QUNUuJuSpW/o+FZaqmahFg+eijnR
0dRL5YRU3tOhuC3t6zYQ2gNfN3Qw288U1OjJmJzImSyCGZ7xc3/djQ07imPj2AMqnvf4lN0q11Xi
mNGFhEvela+61SYtkV/zBflHlbAdZOpstrILsPu0mf+bwvTRitAY954yANw+qiuDXdQ5I+TThRpF
wLXExyYbjrZnnnfTjgyV9jA9YdIM1MPv/Mpohk+FpXZxv02yZ6oM7vAObhMmmnfDvuFFdjIWnumD
2/xWYOW2FepNBxK632vAn7F6AYI2Pm7lthw8vdzzlF0gIiGLeVysoPzkwdEfrkJkGf5uMGljDRcS
id+gAbh5MoPIRp4nYPKKwNucceJHEblQjM/dlK66mHhzMV5MpbxX7h/kKRwEI4NefAcyv448bDrD
9Pt1zOFR0f1OsyL/w62a2M6vahhtfWmJr11VCosPeMR6CdT1mkogWyC0JLbVNumn5jjYgx0yMbYK
Za9S+u7PCShuJq4pOlyQCAowBKUnZNYN7sWn42OLMC4Twad4WTJEIeMCCCub6LkmZfGih8S3P7di
8Gk6ONgjaOznhDRV2nBEUyW8OQ35VN0PLdOXNsZ+5n7qLCia+ndHLy1DoVBqlBMVzaYW81CyNise
x6CGa7xVJ9qQ5emUn+SVHIG6p05HGs1ccKW+rUySotjoottjLdZkdmnBen4otU9YJ0un5yJsOj1r
WhaLyRi1gKAmjcv2+IlbsIEZEyVxV+JPiywIIZtAwFxYBxoc5VnvojgkD7Sy8WchnF8msWneYmfn
QOcmIybdsBZQhRWQpUx7uu3mPeoSzuJcbbeMEjVfP35iPt+PWW6OVnEs2pOUE/WUx2L/Y/PGu9Ur
5zdliJuIIILzqlWz+B6b9F8gBGVDXQ++2EyUQL8OHVQ9snsIWmkknLfkgVpC6ja5cQR54jmU+KpU
eNJrMTrOTSkHUZIwT/sTeKlxTB5SLhGhwHughrpatlZO5LRH15HZWpXF41i+mUMtyH9QyBtXnj08
b03lcnzLjfkpOCddL03lqc7JJmAAOkicasgcMki/9YE9qmgjVMPH4QQH7Ehp2pumqhJAlEKWKzwY
gG3o2ETPzQHR9qSxwfoTut0Yq0MonYoxEufwvwTtuhrGse+6x2Jtyds/r4EE0jEa1QffJBq4aquD
t+vZos50CulGR5LtVtwKA9r4sGTX5lA/wUsYFyGXn0WedCQuNcEUK5UcIrw5xt5OE1ZPQWq89S9A
vGmPsqF4iNUKUxMa7Kk/9sWw7lBkh8fUy0eIIB3gEVJqTLdnmRnWEuqfF3vjCir1bdWb+oaI42Bw
7jyreTFbXBJgKm0iikCP1+3wObfntBSOcKIwYIlxdsJ3DuZcPSdrz3FJRNSGSVMJ7YDKbaQCN4G1
TlXm4GcuUS2rsoPCUM72VYFflGaKKHYcBr7m+uCb/s4/sSwHh5qCaAYa4O2tBPxu3yEi8erm2jps
hk8DoFiUG/GZsBp6cXpcwfm1cthVswMz2GlRgZ5mEL6GIExng8lFLBOy6SzkaKU+tN9itUiEl5y4
A1VCkqPyfC8P7MMDTrc16UM90twSFVCqwYfLLqP1bRTQ/nKR9pEUMTVKaQYrR3sedMIJR78ht4HL
Cj9BsUuUrr3Cdi1H2RPU+x4lN/syd3cJ+ADmz5JSQn982uLG378DLQmhht5iwKYKxc5B+Z+U+gKv
LlDKqZILWZ4OaLsqpD+LpQYz6VmROLOPpuiYLACm/NkXPsGnXrTEABfQfWEr6H7xsxIBxaAAxkir
r4Jf2gEQTpbjj5BiMgP0Z5kQwu/7XHHEQ1rRCqZ5k8oxUuBuQouQkNker3kL9S/IG+EW+B0l+UDo
r9/56vnfL5Cd21I4hGBxAH6cKz31w9KbT9QevmXzBAaKqOSxKer69I+L7jOJpJxCIbOo8YPm1xqh
CUnthMhNvN7mHdVaIVxOtPiAYkO0XU1rRvzxL6aJ2CKZYmZnYkw9LoDk1pTh7pkCaOv2lrxShNQ5
X8zoLpstQwH++WCRiO6kp/T33jhVeMdrBKiWAKXJ1HF1W7uK3x7ElCs5QH7Pl7KdDyI1/woPbLil
5Ymno3DTAoquybWoM7GLk5HzsAwcMJqur8/el7BDiGWlxk10YyldXYo/yWACF0oze3LSP55K/py1
w3YLBwozsjpoksM5Tb2VbdlwVTzHLRZ7Vv31s+0bt8Id05gWfP1802hXRhmBFeT8B5m/I/+Cdkbi
t2igAtFzUir99DXKwgxv0ZM54BMrpJbKeFgrfSe1iIxDcTO2r9GTPhZoKC+eMh/9ZgAAEtxBmgVN
4Q/yZTAFFRMnx7R8maJZ2umVqZcmrk8fQDxgg+qV+X5J4HFcolkOHhgRP0vtfYvDRJLg84wXyp+Z
zZImZSTqh/ovGQZdShKQWQuz7TOXgPYeOIbTrEWInM0AdyAjIJ2XWk7QN+0gzQAipNoMNlw/m3qA
Ce0gtUGfoHwJf8dlp5Zu63/VGY7FFw769jeiht6k4q1wr50PaFSCzvVjZNi3eP0tKemlHIm7SQ8i
XLS+q8kTtVuRKZwGlpzYcMAF463IgBI+Ebn+mjaDZv6R+GanQUe2M/0RBZRhmctbhC2WD+z11BR1
AHhVwN76X1xa3Gapdd0SaP3vDRPE9K0uHOMQi06s0EJ8iQmnUxzpQjnKAS4c5Mbnw8+S2uIUUEyy
OcK9jjeGMI+3J7EF1lkPGm9NA8wQAW52wQCD+0eCttBC5Lrr+Fx8BlLVr+ehl5UXgAcayCK3bSwg
RSYOEYbR0e43RFXlfm16EF0fIkyX0qwdkVejlW/z4OoPQXgRH00G/ahRC3Ciy8xnmFxHM1SM9+1A
jsoBin+2S+p/3VsUScTx00aFGDao9x17mci2oXOpjPjrivsu6GCODWQOpyfHw0vqy49OoiJgJ1rS
OtLEYBUvw+1xqmSj4VIElgpvA+Guj7b2KghJ347dovsau+DcAcrB2+2y0QdEYpoh2ZkImGl9vA9i
t4jgcJu7tGWSQPoFL0tVZtzJ/rIfY2LxZsMQS+bWGcaWTGW2oyhNNx2I8Fyj4sVyDNs4mG4oOqao
H5WJ02NNUpOq4lkHWkfJzmeTEb4+Jd/WyYf1yZr+jz7DsgwkA+OYJMl4Q17269+3U04QvGCcDJy1
7WwzOyJc6YLwWqhpWcob62Ihphpc2cYtotp3uOMAWYVQTXKLurLiCIj0kGT/8Fmo4vDK7Eklk03i
nOksA3Ug2SYwIRAPk1MVlVjT52FY8DnmTcqQR2g0TBZUw5eKkg4Tb/gIGFI+rhXnLx7D8TxuD38r
+TcqPsCzGIy8WFscdNeEvTXhzACs2ajs6qBXCeUSGtp8+VFy/rV4JZVaTCntO/l5+3/SyHpREGhB
uMfimGWf1Njfr72oPK2QfQNGbz5Xet3Pwk9AzBp4VdIo1vn99PoSwEP5qZnqML9HPe3IdFhpFU/2
H5hjyG+Cf9b6Xy7jfV3MF9kJnZ+HD17gA+/7vYC6uW2OZWQQuwhLr6y8LAw4VvhYa/2wAWnGHbw2
xBy6LpMLA4MUk/WlLIceJ01pWYsHZ8R+3zM619qZQJ+izCuxHiYGRO0ByAkc2xqGJ9S7Tj4Lj7Wy
orCxzt7tBqSx3giEGufnEQGPoqS7wmz0tbnCurTtZ79xkGX61MQ5IZO7LL1bz3TQILI3h+r/9cPv
b07Uyl6FXnyjfu2UHj06mi0vbelcpfE386zv5jUCY1Rg3fuuMtQ/bJZR8Ehu+QDEaI1vqLAhOuOh
HIZmFdrvqkEJ5VQGfGtTmZ8qrj9VRXojD5ieiMgPjExu7wIi6v4bIvtmQ/W2/DIvzkiYNbcd7Eb3
UXCsWZdHDCi25jycDKxv9Ij63m3BxT+0VpB0WhyMqb+OPs2+XEbVw4oza3VvDGX8ALSyWeXwtWk6
DPvMAoGI6qpDRtCnEzTs994jbg3dgzc/iNcyLpVm89lFWNNTTLKjM7nvbnp8bg0v3LK0Z1TY1gqZ
jEFGZENc9oLEIQHaHnw1yjqjEOC0YB/2tSt0rSkZ8DumWcmFpisGJfw8nDu9CINv35aTZqiGLrqu
YPtirgl1OTNrqBEUnMSRVtb/gRxRLUeApFvlt6j0QGRuoAw0fHfXpBToKPny2IT+MaOm98GByhf4
G2cm6lQ2pEzQNZKWAx616SiFxsk/9YVaSqm++8sTiR3RqdbL0Bj+KhuTc4ioo4PdpLfPo/KkkQ8E
WB2EWxfdxseIcU2++EVJ18yHWEa9DH5fJbDbBZU4mNGKZnTOwOAtXsP2lSqUNOY+OkeLwLPTaTXw
0xhIRvtpnsJDjR5+jAHZuHVaNLZ3xKzKP8CNhmPil/AO/O7QbwCDsABTvNq11/RdWhiMbZ9a8ciT
fSVGTSP5IlHmcFv/eVbH0u54uegRlIHL7JwiTzoPXEEZohLtik0D4n1eDVBYkAAAv38/I/9rV2g4
xvgHt6Nazb3+mS1VfSsjpEB2dZTkw4kmoEUn/ZcYzoEv1hq0KvPCIqU0u1a9v8uY/36d8teQYnd1
faufQNXhUxAnPo9rafz9dmOdKFlhDe1ZSpOwrDLOS3Ko3VTMqmbfUghN3y2Jg08X6NpjLWRMolCC
4KWr7/wtQcqzy1mVUq2J3Au3pXTOB5+UifJeR3yiOuubC874M4Hq8ZkuBg0zPJZ12K9aiL1lT4pB
uK3zIpzdxJmDXQNS1M0wiu3jSMZB4gCjcA0aq3YBE9uUPFR+OA6WhW5w7tHwU7usbYKWn0VJ6wuS
gkQtxF/2wBgHOzEoPGgK/8FI8WBfj27WeeFaJvo09xtYZJi7VU+EWvUCNr0X4lxa7PUW+nGeLiXH
N2hzVxw9Qy0gb1kEX6qy/OrPHivlk12Fybl5rxgOKRdRpaz/NmKXNmqfRvtnEQam0//+bil0ruCa
9+AeJSRmUaeaVI1QUvUAeKd8FR27r6zXnUBYtb28gM30yD/TEdRDWbw6YjWmfwsgRNd3uvUInoUL
g8I15Wb0YChJ6CmszeU6VbdRIBFS4O4OhBpWqleB2uNu+ROD3CWnkOMgWei2WGdoJEqAM8efLCSV
/S/rvWGRJpOsCHykTcUUyIHohZP9cVnK0kVYr2UjoGWqHJmebc4ZpBN3URTukZS9BjH+Z8B0CTsQ
72twnLeBefbi3NwkjNVuMJdzsasVNA8+edhgPndub8K5ACRMs4kwfkpWPLGk4w0kspKHlgrndRZr
XdjhjWxlftM4eqBza2BCAEpk6DfC/zLrgZ1tmv1QUnnFChhMoJxMjknTckhFazm7H/wh9PM9plp3
t8T3gVTbWSbbDPa6HLINEnJS7G2nlMkSRwmrxsUUjjzq3rVDvlJSdIx9tkABCVl7EClJr8toqDRk
0MDq1ZXAMkh/z9F3G9jiDCMx1VkECzqB/hkPzenQ/l2CnKen7wSjdsx3/ZXeMFK9qyupQ+wGlNrw
Qg0UX8wa0B3z5GaXkyBb2NHVkZU85+z0IDgx1br5/3WUcFqZm6yn7eUp6nUQ3YAiT/41ZJxRfrGx
Dk78YJcZe8iIYsOWvImciqxwx1E9lKMrNXRiymT4jxddcY+3iT/i0hYjyxRD8TA7sCNzJDu3pQmS
6UqEC1pxoFQIP8sjFLA4XnMWUYTYqja5U00Q46lbELF758cg2BoLNBW2i6Nk5YhlmQarotJmNHnV
BSwNKc5pkdnVyZTER0caZB00oMSkbO8NZIDP0aGXjfQKnMjvj3Um2boFb1TvqdIJ//ZtNJvWc0yj
3CaQy6SGHCAmIM0q1BvRj4KfkbSDXtF9/8NsBsMqUHdusAlpDTWHPEWiNchY2N8SjGV9Xe3Z9c4D
l1SFZ2SG4v2mfRdl3QOZH/yIuMu+xh2mfuKh+SyRGzOxVQBAdckggXG8bMby7N0f6+PIhW3w3LzC
6J5JALIGFjkG8NrTGW3/JDPZcrVeVyXUJsM0J6Fq5uyYp1Fucv4NAs18PRrZqq3xbD2ZIk/yfcf+
srlARMuZ+58ORD3rSxF+J6hPiSCGgC8EtBMREjs446/Z5faAWXv42FzkwRunBEWXKqxwiIdEk6pz
WujCGnWpryJTik++TpY4lzC3gNpEqOqYqKNnnguk0Q3j3Walha9nJ+q2Jwy2zCcGpMDMQWP8JmjW
KLQG+zpk9kVkQyFFBOraBz5Ba+dGHmIc/qVKhOaaWX2pVR8sf62zbCYkGuN6dZH5wRxyKHr4JSlP
IW2Tu2l33oiG5vfA2HQPi41YS33shF8KZbfK9DJWCdHmyWe9Ty9cyzRe3SZQW/wGHn5wfGz+G2sm
ldhnNVW5J4YHHiBnT737fFwTF0fVjJ+g1MloC7nzCIgR2aOW1PPXnXIL2UbL52UMbTyQ8MaayqkB
VkxH/O10VD3mx2XUxHykG+SJIcuoETS9gveAfi6HO21cG1deLzWCwlRVPmTfvXrz9jO6Dva647eW
hAag0Ui1suR58l4kUfb14r/I1r8cYhFTSvHX17qz7Gxji5bE/bPhzc7A/OtTMeYvlLWAOpEdWusO
F5vq+JNppKzr2IU9c5pSKj16o/TDsauso7xWezU4ILZfWOHjAy6DxWoUpuSGWzIt7Q+2UstIjtxh
YLQmc3X5ajvMB01Q5WUx/x621CQKjobP4UZJ/V4bNw0V9uV+0SKyV4QQCIOIg9Q3l2giSA3RtEws
63H9J9DOqTuL/i141GFao66+QyrxfgxNrSWIZSgclfDuQarrfrg33ks7DhfH9nifgIDYeGq09YpA
1iEyPAeTY59A+pKRMQH52Hu4I2RCzVZAq/7dh1Mb7lgU6xaVxAQ4yE13RwGH3rKGhieAwgE58gxE
oL/+UB9/Gso6IS9nTnl5Ulzz5vQWnQPV+HX6Vhh1vcO/Vmb7mDfeIO9sGzitoH+RJ6vs+3r7c0pN
ZWAinUiu6TLtusqOUQiRqHmspiKqao1do1TL37T3hvGD/3bzG6q833Bk5sF3Q+uZeibHSvHQ/zA9
Jawy537Rzr65/R33GUYZ1YzrgIJJP7MrhD+O1Ukg5H3j/XkWWAcNTnc+c/+4wAZcBxQ3A5S9V8Cd
sSOrCBMsPcxYtwz5i68qtOUYhKeK9B2OYmDBZZbQG29lfNf8AA8H36bs+Esiuu/mM+nqx1KV816b
/02ZIDX3QIyBDYkNTf94xFLJ8NGP2Z6z0Fai5gbQOJWRJAF+qf0OQE9Ckumk1vBAXlI2/U4kJDd7
HJGAdRnAllXHwVyc7bCCcxftGHf/UpAfVP7OO0QRAFU36Si33qMaqojNTdLgrljdNrUfrylHbHVs
jYc7VMDX1EyXz4W4heKc7B3U3CC9Qh/TUyeSbIpFpxLwPDNhTGXnWEqjLttRj9SicKwi696cr8A1
ekCWlyfIuy8cgI/8V9u93wzhwrZR4bKLc/ogk91hZQi4DxS4Y/ow0SPfjJ3U4e3RxWA6FP6kVSpD
4BiDhfFeSDf/L0MqLQCOFwMdI2aE+MQvG5PGcW6D+/dmukKnza4nPa//T+6tyMbHPR3ConVDKnAB
blx2FmF54z2ZHRkSTI1KfTJvCg66HnziraL98qC0OMhfrWyesYxgwsFpaJ2MKhhqSn2zZkDmv8Iq
cAZJV7yq7tTuQeXaBYw3MIVzlBvTkg90qP47qjv3LBDDymiuRXre41jnros3m84QUH4RngshlaxH
RTff3xuY+j9df9B1BsjmDsK4RLDdmDyaYhmnLEoQ3YBT1Fo0HSJO3Zx23dpuPR0RbhHw2rkzTAjR
yealJprd8hHgWmq4mOh764jkcmftGVodJ6xMG5p4F1g1pUxQ+xUiVehMUxTtssPjDODgSniph6Ay
YSYQOv9Y4GW2d9TJ76B9uNZT6puuvXeua7Evp/UgWmuJ0+tVoh0CDs/16wXyHix3Dpa+Yvmf72El
bE6nXzNK2otYF2tcx/oH6aaqNFyTUQP/XQEvLdp4k32lE9VMus5XCVdPMsh0Go9+apxRO89ZAKIs
Mgf0NuoyJo0VvS4o4aEsYs9I8jNnTsKBKl/21BBtuz/bbJ6HjaCMo1yJf08maLVmJggQq6XSM0KO
CMyogv6nzbSpcR8SWZ4PLuY4Sxt3ZP6ccAumhQtUYEDkgwr/RACptYhxd+VuWheM9aMPuwfO7s6i
DN8cXoEQ0xHpFfSaiJEgoSN65UWZT5cspPGk97RBzf7Z0SNlq5hbIgqq1OzOufSK54RtsxeXzJK+
jx17Lv9rTCTEWypSms/Mi/Pr5xyHeCKK/C24ClARX8WHbUGQ+0nRHVd92Ai1ZidwjvTrWi2rElOq
uJXsjaN3BlbCGPD0GIWhtcIGw/nhvBP7w33hqQ/f2LL0fmMBY+42dtYMv7p8iAErLOHb1OyIu2VS
t1V39G8jGfpXrmOArzVQj5aKpf1DMMQylCkX6YkiuDOeJs1Sg9OW4yMh+5EMGLx+2080/OctF7Up
rQzEfL9X9PdAPXEAhp5wiJzKEXF/G8HSkmG4/Z+D8xxVvXRguRDtOkIEVHBpNAGNRdBhTCQfGPuC
GyUYOLz2tJHd/FtLChtNzTTtEvBDIVzupEdAFyyV5HhkaT2To3i16TzOnZKd+h9W4loQPvZ1IhV8
Ie085Z8yBNEyWiYkgM8Lf4g398JY2g7U0VIPa8ZkccfOP40EZfbCd/WHWjAfvMIc4ta2vKAwYG+o
W7ChlvkQTNVWoj74m/2m9D9op4VaJLSU3yohS2wu2L8LbjnnF7+FrTy6jstbFgmnFzmenPk2o8aN
PHY5zm2/xTJgUiTitlTz3GEvkX04J/Ef5orBnPaOH6HcU1dZAAAAtgGeJG5N//K0Qi/FJ+78z+cM
T3gbhe1QrEJXZ3R/De7m0kg8g5DvexrfvgnrT8/0SLPwwoNFlBxxsYdbBxnoquvOT1JjGte/UiDG
dpEVDb7kuelSCvwuiIa9X2kRARUfjL/f7Mdm94JHb4Fw5yke1k9SMcc139/Y+f744QfSoPqmyXPi
I5C5V2PrGEMZ6xN6pCe59e36m5waWAvPPJCAiYgN03BOY4IF1rNMxnggS9oy269hO5yFAAAZ2kGa
Jjwh+TKYBN+Ec5Pg5K4wlervYKX1WW5PZKoZYkEr74GOC7xYnqMZ//kD/xELXscdtU5SZ+MPxDQp
3p5QOpbnSCJj9L/LVepSkgEBOxhZOSkF0Fj6zF1wyjJw/ugmKdsJky3O6RC/dkhS1jHuUI01zwWm
iqjLbUEECjVuI3cK4zeyZNOvJ7Wv9EQc5duuRcNsBLTb6AVnFhjt2W71LPNpFFYP/2EQuIrr5sZg
BAnAfPsp+UZGxN5r3psvnZslgTTDcukVyOIcU0JBNFYVAP7iVi86PnuuEG/lIArYXXEvsgCSOG6w
0SGuWby2/bWIn//1qe7/BBmVT/ST3ArAa8ENMVpdy8q+XmcHruxtAkY4E0f+HBCZLj27hBbGjgzl
Vx7B9ZqXw5sUkrVWjvvG74JgJ9bUP4nD8NzL9uJRSHHRzd58VbI4mXwve+SZjaQlBgPGZAIp/0eY
j+GR2CTeMrM5FvcBs9sTpwFv1q8EhsqBGhuBu0b+SulmUPbbjakGDHWSyrV07vQWsBVUrVLZbors
4OpxRGyaHMrXdyshi6SYiMMR4GDAyJFgRmRMM/Gk/ttzWIRVyEh5Le/KtaG663YpaqxTMMvlUZ8Z
pgD33rOCirD+NuZSYZF7xr0ctHDY3rx9hWeFbJESHBbDmtXr3kCPjX9NOKKvgepNiJYYosaqOj9C
3L+Ul8gyxZ8RpNH2R57nkw+wmocbzVvKSRr//Ywm2KPZNct0Jl6a3tV51nksCKNqGr3siZGeblji
8ftKO9KzMYuKrz7sUi8Y3ZTAmlXn7LEkY1Hfz+jP5zIqjs3MbF6gvTQkbsWdBEUXh/xJsEmR6w0z
n1R1zkWKyNyYlFGUkVgH0zWI/YCBYOlxl86PiCBca6MyNh9rpMgSIB/GQcr7KO9vDkPW5uloumEV
u8ntpOowhJQ5R3DRuunikOE0jJ0ODK7sKU+UD6F6i9cD66Puu7kmsgloXTBpq217sItA2IDtku/5
ZjwV9D/8f9s3skkZgVgJN50qSZQ1nj9JjoPIKKZHxyv20lLOPfdtci9WfoRPuxoLtFwnmjavmOhT
i9wxK4+J+C1CB4WttPGtV1zW1EdRJdqbLTowIOaYrKwmjGnBL5vRGCxe9aU/LDu05l0iOHenlq9i
9HDMsBouzdh0q+WNJmq8jjzoNJahjYIbT7ScB4DJES+Fh9lbiBm8nqv+e3R5hevZvbx22cIBuSk6
lPVSv8SCxYr7L/kkovy0Os2YtUCsxYMcf2iWjs3ZkBVEssSEzQjBC+n/66ry4caKJCr60FXA1ard
cPfbyF1EHlTXICizan/ahaGqQx6rGGNj+7PlFTiAtAK1FJyHhCo0UIetplzOvqOOR6oFbbdE5bix
gakS3pAbSeEcxyrXkVTDBPwxV+ntGIvzHIqSpxHRSmXpWdTB4a7oR/CDa+1S62pWWRP9H9od2e+0
Pr4HA130Qh4+gLvhW7P4HP7MNC+r2XXLsb+39rMGnv8NJKDMj4G8TB7Q1+tIEkD37AbOrLmD/GHN
Ce+phIcHefzBvhLyFJO7EFDIuUB+akH1XWL+c0KJ4Q/A7lnANIfZBFVXJjQF6DBAiNW9pUYCQcNi
RXi4UTpq6GXgrooOZSMW+6l8j0ui3a2/s/FTTY0D8iUsaVPHVyoIfb6fbHkRvAocEhq3Y5INij+F
0lol4UiKQMw+4M+YhS361kUuGklSmat5CVVVzcDp8OEL6gCQq0Rour9S/d8FVeWShKliLAwFOAbf
1FoehtAthwdjSCJwlYrqPHUn+2w53OuK8Dywu00uhOjHSOWOwlZ9Wq3EHjimvbhyGukqXf0fdPV/
57DweFJhnHR/58wo6pA4vB49Yhpt+j5KflQCM+/QwSnzNjCkO0e9YXkEG1H6LMeCsUMUutQKgKl4
C43m4L+VpcctFfF1uyideohjT6rI7IgCNzLtmFQN+DGnaJuOO7xEigD6NIEbsa1iGHslAkIjmNOL
WCkwYMhacWVpsVe8ySZzAicbIsvX3mCbhF/DLmk3PdFvxvGPjcwuiBc29e31pl0UmRVccYxfCouU
2xO0Dg7JTHoJ6ZmxtKOVb8QZieHIy1VB+tCEvnUr3HGap2W7Jg1g9oKq5+VyKAYePGttZGfIodrN
rAUI+a1SMthaJcEdWbh6Mv/gdF0hx83/mY9VMnKlLEMxrQ52ul9QjuU8SUfyriFHusZYPZVS4cJd
uKwP2BKnT7JYX+YCjLD1b60eVIZjLQE0QOa7nJC14GaWCk0gjC8Jpa9dzLnaw1D/oBRjv523GViG
EDmkoya4PyPplaMKwrTd/o2rAjUlpXKsBAjpKbMKIhqFN5TQFS9voaEcVU3ex0FarQtAISvvWL9+
5TfMfgt5GgaZYCoF8QuCGCWWGTT4FOOPgGkazW14GD3xfZ+qm2GXOyjDu/OFkVfb32dZsTnEiQHt
Oj0facVd2txPfLSqQ3X8OzsSSgEzrgrwZdfV+waIShbhwLaasEIXQEeHvEjkElEejcFCyXK1b0VN
n3pMv+CnaNa9EghaIC8ei3iq3gLfrxgoUiGeJdIZ6irZc8qSQD0uxurNjNYZaWAsYxMmSXi3WtIR
dnLsICz0m0fqsGd3aexFiIyi/5aWW8wJMh/UD8WdNOxzgb7wa6Y60m1lD9aKExegZrDD0CGRedZc
noiZFZPQDCDHe+pRGlIje4sVNYrkw6VjnJjFK8GcYZY579RgTiSEvHPgUvYW2ZPQyt+YK+jWUyg1
v+wPZkp0iHsaaZ2sxPvxvhn6938m4KuwHoRwt3r3kbxUI/9W9prpps1/j+pDHxMgkUoNY7jkL7gd
vTvvDbD4YUOF46xx6WXsH1lExG20e93mpyaoXjY8c+BsbNfLZ6AnrsEgVJutUwguZ5lf0AQdPzOg
9sXAJw6ncKRCzrGGessrgMAzOqmZg49HBbStdvbXoBOL5a/+mTVtxUR/NaWSISrCUgrwzpEzrW3F
kKhQJThafaROpDP6Lp7qUI0i/rT0VmH9IUPX4/9vfiLWV3KgOFJAo/8IZjmQVXQPOikJdj8goZ4d
/cR2z2q+IH3PImOV/74Kepuzbx2LZkIv6J/NuAha09GNdrbzoieKx/9lKP/m0ra0xhnFwX0jMnnw
NE4SYC4MATR/WFW5RrgpXPnxGwFhbi4mZBpndTuIhFEg2Ibh1kSeLDP+tZbYpvrG5r34AfgwgXRf
NQToWF3nMHfdim438Uwyyhyi5h5YeEeSTirSLGUP7ai31+/8jh557oH9KMNvOnNCNocbibUkRK6n
P4RmsrjsMP7Ahth9e99JJV0MWPDXkaneZ4mh6sLdbEAJeJgoqTQi1Z5EjMzEa8H9PDfWZ+wYmXK5
7sY01q6xIlkvwq80wLNgHqqQTHkrxhc55gD0XS82XCCTtAMXN7rX4L1cwgmxLWjPPCuGjeJRlBrG
BKURCdbs1CwKmMvGK3oO4dmwHfms/17DU99etiIXSDXtd/IIUPsgFUOuj8QAucuEYD786nrRbsNo
s8ihZOxlGVE74yPi4RcjbJh4uq3Bo1/O2ExejJkdZINuRFNoC1ix/CE8qCYe62qMrMX3J46zHzrr
dTi8PCNYCk5Lvh0XIgeMvPxIbFnf4Bt74CqWxAdYuH0cXV4bGuJFd8bKfmqFlfRyWtmK6qViJZVF
y6l+moPHwcdO8Ar7MprWnyzxAuc/ng7lXMJosiOkC+wAqxsU8CRyStI5DihDVMRDABE50GcLEk80
urpBk5vYgNA1s2/b0R6COodm3yZxoJBYT9yJRVX8EQR3IElXLq1Ae6w882hjX6zKZEe2frqzvcDo
Q/a3P57kEvqqD5H3BeHkyvcHZUhMoCF1AH3Kj5qLtN0r8AUC0YvM7TYQisg3lZSC8y/2x7MCfUb8
XWX/0G5OWZJ7f/wVKeG5KO9y2j5pQ8GA3rTdTxTztHTcp3P3dLKz66OBhOXpIQW4vhYD6D7576kY
HaNVRxvJ73KsnhOlRw5ZBVQGRwkFc5EK3c7ZROiYsuVsh3wACSg/5v6XR45MlRSf4cb6lETz2gtR
S69p9EJZyrcFcc3/zqHqIi3ZzKqnMiRkDIOshykr6IRWNAlwSAb56e24x6HReZ3D0AbNFHRm1nyq
gGzQiTCtrXub9uQ5hzDfa0CSVgWGPQVAl59akMLYqwjIeJgiOcSZ9F4sIvuhx0wrknXD18hP21Ui
uv2n1a+kLP30HPJn9QGSYnYysY2JMDJrohU+YWbZNOe/qNu2xyxJ2PAxIAVxuqr2D54bEs/rMUMC
Jsc6lZTsQkzpY7isdbz8rbTDMYLn9HAwAhJkdooakI/jZ4ytrbqsyPkI/MaqX4oUuTsWBDOOuI2i
PK9fPgpFX7ziRF0iM0/oZiPhz3uJsB9QZuoWFzFgqNi0SYMS8eJ4119lQWrhxlXh78s2/Fi3v8TH
YWITekVlKw5fgjHHBEU1mEIBrH3bJLs3+dxKwGY5fWdFjQNzN3kapeQjSL5kbYlsoCbmECXFU4QY
PFvuSF5O38ymGNu1hKMu9uOdDVyPbPUgX39uILLJdZFTLLXpYHqugsMp9r8eA//gTKX009aVK6SX
nLipeVuYc/Hbc114Ep01WyiEXxlRHy7gi8+D/OePXfUrh9CizyfUtpzejY/y0tZ87ynTORY87ke9
90yn1IOxURK9DXk1ImOxWUVSHV41GXkcuYGgi+AfAAM/YrWB3Rzqz3W0pRV+/GGmqU9d9lENov0L
hlfcv1P5SO90rbGLJN4Usq4uMwF8YIPlvwr3X2CweuFyKEV+f7ojwYXOp1UsMSspjZbiYwf5BB/D
UIVcTbfjAq4TnX537FMgxZCr0z35Z+oX8GvOKwivO8GbM91jYw/ABWGVQ/mvvbmalb1wlmTKK9vI
PwygPbRpxc9AQltbIRTq5FObKN0nojV3HjCpU4vI1JwinxPaZ9muJmpOzWqbQ1pndXEvlsIVF/Ul
iVPDIwvs7NjYOtNq/Jr1NtZ3UFEkvaOQrWk81PTkCLZXw9pyuGR3QkTY/8nUU1uFIjvfPfImWYzi
zYhwEHMZf1XKTnCXvVtXrZ7JwZhTOL3jt/DsyGHDhHg2q4M6bNgJAtFCDWM5Q0hsflgN0qFZ1NF1
AlqW7Ft3rLW5QVk23OUVeWGa0EDOHR5C36WU5DCUc3YPo1RBVBJUId5RbPNqpvTeJTcgkB9ysqpB
5/FPwqeDUbatDk/wyun3ezfEZ6ZKfehGn2LE54Z3a+Bb5wXsKoHjmkfbOLRRaz5h6//akB5vLQqe
Hnc/DavtsMd+Xa2eH62g6YKiunHvCtqKw0rq8Y6wU/upLPqWZqD+BAG/2vmbuCZvYLGy9v5jCiH5
KpILiVAQGwL2g5gczyaGJqhZ7RBEErPFQ8bn3izM3bk+ToYPYVZFEmHmuVRG4sp8ZyytlxXZEWlG
/e+TmXTyTz9i9c+tHu6m0jcpEaNGEpmVhASZ9p1w7vDreMyEpTqfu4CyfnhAk/tJTyKa/KuhujoR
wjEJKNX4zC5Vm/rjk83O1PHm/lkyD5JkFq+GXDGS3JxAaBUDR9oloYEzW1q6E+jOeh32n/mqKiiu
Qe6GKKqPbckCqcFpWGbeDuVvjKEyc8KI32m5trtvgpytIWILR7xSGHta4qFc0YUvhawCmT/BVgoX
NFQkKzP444K/bnkZmSdpZTCbOPf3GOz1wNNsdkiVO/tR4dk/Lxn0rZsCFdyhFtXCokliSaA8CHNm
Cco8eFvwvWPmHWnd/A+ElI59NjXwAoeehi4r1KwpQkwpvSCoPo1ruHhULqCG0kPSjFRxN6jcsWcY
4Qrv7v5pQoucUmU8My9bykE0bvVjo61V9L+3oKfusoTrJtUAgSc+9KVAbs+x4LdPnmrQEQ0wRD8t
quKm6KF7EPFiXURWq4WPnp2gH68Qthpth5Q0zSZa21PeM+DWg1HlL3bBe1wsE82N0+uHD7N9/S46
NWdKqy7x+LcXWGPV3qILfwxOGw63Py+UU4/6hrlJeCzL8sZc1s4P+9MNj20E5COEz3uKHtRwfKa4
oxNa3t294LQh8ga16H8YJu887buV9I/EUkAuhl8Aqy/oKvCpt/lmOMm4jDwZhubpj6N93kWqb4X/
SVzgcZPZ/ivLrJFk2xu+Uy3C+jpKxRDZua530EV+268ZBp4TDmBw2aBccNunBk3rPclLw0z66lj+
jEhaNzxa6wA07Jvk5t1Add2A82BVK+Rdu4jiiME1+YRpilNiCDuTR7GqQTvsbJahidkCyK9A5B3x
IPvd664vDYR4BPiJv/8NZh4kWIU9SVthZqPWxOiQy9wgFfrg/7wialb9grs7Y9NWrFhyqWV1/VND
1Knp29oEyPQtIBtMtEfevHpSee5d6TB3uDLM4Dfb9u9TanhO6Z9Y1uoa97MzMQltrCa21kBu5wQu
YiWIEb9bWggpAGb0OwP1e2zUm91R5W+E4Lg5pR5XxrQTNNXsfGZBYvUmYUTUf9OuadAAzC9vsjnc
UZHW7bA4cvfDA7EW2CJmZBy6Gol+BdIWiSfIUkPQhyIknQhyiBfYzZ6web1Iq5KNVZSkWIiF+KnO
5MiTb7+ocCMd5Pbv2lJP8oyiUYmhOiScVxqsq9osqS40Xx/lQzmRd4u57h5lsOjUume11v0UkCWh
HfKt59PXTdwyh/qeinO4jCOkRJZuOzUxqcu+x4tBEkT1HI1LQbG0jGiekkDRFFa75ZhUQuUkRnfP
9+FcVz+OSTZ7WpbC2tDVZcQnzCluVwfdLAoKkz8chjqawAtP8viHw6dilolSrZlZlnqBu60Hh8Dy
8c0wdpyOe6o7wYiRRbnOc1zp3d7ZN/PonHMeFXwQvztmMqssRkhKUp9EaHJ1NtE0Ta073PC7gZP7
cgq1S6zNOXp1dMVxjXOEBZjwak31wsPeJdOQhkaZesAvw107EuYyDAm0XHUjBn+Jr7JzNAs24bzO
vA5AkY5ikfZxCM/s79O1bPM9x2o+FmsBnQQJBlOmvHav79i7egFSibgn7VKL+QSbc48JJgUg6bFj
dl/O/5kWjn5Oi+7he8zdSvGTz9kP9KgBrfs/AUdRXRWr9ZdZRKmlVMcn+C6/atjKuKiY4IJ7vpk0
UW23LmYV0tNwJqT7sTxhsw859JCNIc/z99ldd0r+t+h4vDGfJ8BfzhBrRr5N6vsZTjVN/4ES317a
AMCgeW3IZDNZY+MuXx8ab7HY1CIX1/htszy8+gLbsA+rAX8AzAWkOZ054U1GOZbuMdAoJWfvGeeC
QgcIvxZOs+PX928aaV9Br3XR3anzCuGPPFEyG2Cmhhw+bEp4rIhxCY3A2bwKnNuj/Am4q1O58xNa
zuHZXVLOCUMDGTM2iByW/HID5M2BBzMd1Vu16/3tb/scC3kWEeqPPmuXijOqFS1XTEJY/EPxVykD
PaNzlCTeMtuzkkVHe82oqtlTTmcgBap5GqIPiOJMSrEdXNStu8CsMfdqB4q/Zaz36qzrjbfAwAX4
8jvbVlimV+rd9vutE9lhoTlrvA6PiOKjVXvXgWH/+6CZsWOvSumugqjVLzZBuq92RYPf32lg8ZmW
YFXVSrBpmPAWkgnW2C+O7HVEXh2xfm9rP3ZuvxWXQA90CBlvghAtLbk+IhDlw2VUsEiDOUH/zfbG
PlYL0cigobDjEHTBLKc4id7GX0gzdabeuXm3lSHITGJBMN8xg4vJixmNT7hEyv3jUTOxiyFKf9yA
MhRcv7UELsptkK2K3kmZzsMER7LBdhPJz8AiSI4z5NwkCLUjWuxz4/ggR3eEm20C3Nzqp1JaE2TY
xg8nqR6el7RhPKCKKFCBETTdpPSBE4fqUZraEesr/ZL8pFq65neS5d3m/J8hp+l4jXNZh5z8G8AN
XRMbkQ9/zan9MwfRj7xd5oOnQD1efbLInST8YGehBHeWjsqGN6P9VaXAkvk2R8Sxx8UBVIGOZQ7q
tuDoC4l/ntGSvDc/Kz5qdoOjPrXUZkv0Y5VuPY2Hpz/2rkBk9AqDUMNNRvZcf1N/Xs1CLQWh7pU9
PEZXdgGVHmQlCTeCQABn6mkwOrii4Fg4Pyrn2/fbHs5zeNq6qPdSKRf2Il4eDU22piJrzLYrPlX9
JRh1YMP14p2yhi00yw6hxq5udm2HPw3Y43AwcsUcMtA4FmMJnlFslvfPmWB4qTewIa6b9kQPFt/+
kAvVnd+GMlBHVP7/fmypd7lB2oyEs/2fqtUt4T/DguKcY/3/9jaxfUobqvTRFi2lNL342rRlO6Xb
IP7dwivN266z64YjvpUHSlp/TIfXwvMIqhFzo/AxFNf3OXBxh+DKf5x1PftmSgU4L9loG0VzzGt+
PoFpINfSIdVx6/FixGpZuaIgUd45ogwBz//iWTAnO0uHRnOeRDmWRYf5iqCkzIgSe5oa0aymsz9t
pAc+lIPjDWZtfPK8RO2RTg78Zfge9VRfsnecwZMIBmBVs6F7aDbjT4SqvSAUYi9U4DxSX/fQLKsV
hbJsl7I6sRapc4EAC6XUwYhQinjO3NfENzGbaFZnBUATckfozrCTPqDYxRZJFtOXY4f5Ycte0EyO
hsxAnjGeBtFypfFPWP8c7kCl8i1ZvT2YJ26er0wrHYyLu7Ed/vaeXQXyXw6luG34TpdXB6RGM4ef
jQvMFVNPMpR33HadC8pBW8sLnZPVnacAje58eBd/TKJZhbspj2uhvoUYTintY0Iqa+UXaYFdBeOS
Id5JuPc4bPAD7YKS+9fEqVZc9IUodfLXUgNvt/caWuMGqD3Xu3kUzfCvwiuM1Dats49XrHUPHMGm
YiAbYy6VL2lx8p8WAJcP34kETLBMZA/7IRIBe8iqPL8TMPhev8OIcPpAKVDi3neGICqyF6UxbM2y
vASNeQAAEsdBmkdN4Q/yZTACX/kK7nTj3ZJh5A/eVR+9QRszNWOcDi4iYHhfSjhXauAQdsR3xlCj
ZqYNSSub9F/YjQb0Ae2PHuBC7z/fD7B7VJSrdLMqdo4KRV8Ddxt9Kd2zBhdvN4n+JNoLgmsCVZns
DqegbZQo59mOypa1IeiqmOs04L1H67yAFemkt97ulYywVLS7cshBBOJ3gyimBVQO8Y+YF1RulgA0
aWKk+GE10oSIx9FwrIdQujsVO6MWSrGMNB5GzWd5SOFye4FksKoicRcJyGHrB1w6ggl2+F5E1RMs
jzA3MK979hlrqQujtJIotr1Ixslvu0oMu2sQ/2fdadjiLXEifmliNs4EaV/sz8lZYw7OtzttiRyz
0dywIsH//XGi/fffDq4kcLJwYYx4cxqzOGI9ashzwhWliQ7p7YO0kbQQL0azcHHcexk5Q7W3h7YB
cbd1g12c6jgmkaw6qaVAaxPEdjCVtmhbzAjjrsLTEJdGPfRDNA7ned/2wnkojSFFXeeiquAEmpAo
hDaGqk7HJONxAsk2uuQXWtioAR2pgM26DdpfzD1SsAQrcmHsmOe9hhLB7Z3bLYZKnSbfSJayQlRe
HQr//TeVseIX+zp6ZYUBjOICQP4D3L5n4i3RPGzgBMDU8uHvsZCkri+0y4Ri2tTuXB4aRGVRVoOk
M+kLqB1ewzCrIbiJt2O5Njj//xc4Z7YS4EWhOCi2x21RS/8XXakTorUYtkGuw0rYPXRBy8gcpPFW
AbOTLFxH4lbM+k8w8yPM04NjJ6/O10f63INEklFAbhAOTzL8thCGv4KkMr4qzUO64liivmHIxZV+
x6HsnhxjI0jXj5libhOf9cBpF/9bQiCO+8O0tvqMP1I0rUj6hNLqkMA2oElXot7QmvMxHi/EcEc+
y3ImQRsqA0f7Zc2KdcdJA1jVYDwZldkuCXFGeEoLfpEd3WOdCfIlCp4m10yQjQZu61LC/jX+WsFb
B0ttg9oT6Uop/AimwxSydivef6E3yHI2g6ZHtfP1lpBT4V9g1T+C4yorYXUBodNW0RvQ0al6K5GE
sfbJ10+ehDGbT36828cjLNKl36Kd21nQa6HDV9DS8WQNDJeIG0kV9OvKSfXo081FxIPTxeRsMo6u
4ADWNBhHDGca8324HnXbBtlU2dh30L29Fqs5h2EhgCWkF/toS2jRY/LLlEpD7j+EPMM2fgp+W2V/
m0yx5cOwkjD7YIHZnywRLD51ooT4vOgMOxwuwYt1ILzr8zeuL6qR2S0SeXVz7sZXHEA/qvjhhpJG
/zy8pPCdh8Ed9ohWdFt2OsJkdJh9F2n3YqquQMO9odN51BqpuuCtnTNd29hKXumuQHXI2s5oEaxF
flZPsjtFMmV3P2MNzwWSkdXjryGYgLQOAAtkGiniDYahSPUKLkTt3HBhYyRaAdlg9eUoIY2OKIFt
iu1zyNNTVg36cP94i/3ZgTYSwRlAwiM4e1PcPZlq0lWgbVIgOeC8ulXGdyViRUifv77/XgCPUQG8
3zC6ehUKoe3YnWzak8kVOB0QLoAtGzbkPJjFXLN8+/O3xcuCD7JoYeMMfLWaY5XoVaHyy6X/CvO3
UFH1mGwanchC5N/XuJWaegQzY8gPXfbNLYsDB1aNzkQkWXB2p+tIypQG0k5ygrFHt3k5cjXO9YOC
gLAD17V1Q7ADAn/bc0Qgewq+eNynwnWM6Z0l8opfTRbECyvN0ZB6LcNk68klE087yxUJmd79L5G5
lA9SAd3wC6dbtca9hYoqwWIsojN9pHITpKWc0z+5ina3BXrSjI758T7osn5R9VyqYbQX4md20Cji
bPDVS7pnRsG8CKRL+JXKlcOpiwPDwxGMq4W8eCv2FJ9ycyF9b9V8uihHq5ZbanqCuuR/rqdDKtAA
Pd67kg+76MpWTZTOnh5sMByWoq/5iXhd9voPmBrPtnLG8eeQSgp7Gn0N7v0u8ZtqeI75AluAVdgN
oNjm4aP4FDUSja/LWDP3C6LsQ/3/UXt5bg7DZUJxuMBOYP6m/3+4AM8mL5ZFnXfE6NpWq56jLcVI
99EuVxHjt2eSvMzjs2xY101dGbat6JUY+YPBYpwTdeKJ84jJos33tZzvaN+gUHdjmA+yT71uLauq
Iw1bSIqSO3nRIPmaf9XiR/pDNbSy/HJoedcPm9eOWSd/WBPRp+IkhiXBDc2yyKm0TwMy5OE3+wDK
ndPFNCybc2K9LxibQJuJ3lZPaequiG8vV716xpXbQnybBoFrUp0nvFk0NT54tXXetvmrrlxYJj23
nf5Dsv3xa3qV0yGtTMDjsGXLPlMeg2uOOp4wmgmBKtrfpF6b3nhRCHZYqd3kuKdtxd+X8XP4dR5f
/WOlBOAU6aZut590igihbRD3Lnm0/3EghlvqOoygKEeKrfu3NnVAjhOCRQovOppDxA1RmWYci8wC
YvrrVMT3laT70BIhz9wf/t/vxL4x2iL5ByDCosV3DsCyr07puxXHAGfxAgdQdMgYlSPVZgBH8FPa
81mtjhZjCVukQf5Qur4LJXh5iNsz7nkbhV//BXVAQpNn59OBBYG4OIJku+kBF1lTwYWHeH5eOP7M
KMc5s6Kiq2Z73lyGBFL6bLbkBqXgZv5E4nvuR6Y8tEG3FDzjwX4l2RD0KLAZ8FlYu4S2TAXCW9b9
68a0WMn3xHzxK8egGtQMl/Rhp2jJDpTjYeHl3p9i+itgivaZm7tQobVsBi4pm0iEzlZ5F/a0dAIm
kxDTVYdE0bAV3PjYUHWGW9X67vsk+imgtTEqxCNokY7yCUeu5DV4z53QqGu9e7St+/0SN4MZ6f0f
Forblkx3mCwMialCXlBudXj0w7WMgOgTyXYTIdEkK4drzAI24orZIlou3YEtj6EY4cdEYXSTf0Ld
hqqCJyX//08AVVn2wfxBkpGeVbxrroFQmDXjsGlmhH4kapyMNMT8aYnM/dNgH2If876AQjn2HE2h
jxVIPr8cnv3RAyFWKFfUVObfmqmc++d3UdTpj/b7go1uhMFIpXbjt//V4SAKx1nOAKw6PlccOnqV
YeN48HSv667SQwFFihiUsDinrnswi45X5VCLfX+Wid8qNh1NFKR/IbEmBp7G8FJ2wEhiXM1jO/s1
czyFqvGykP1x9Q/6kOIO62MpLyOB2JtxZ2UWf4dtsE27T3Z8RvALfU8fRfPfTVcHxRlZzGJj9a2d
P7u4kYaiqTLfPdU14ctXWYBv/ID4a9p86HvsiUSYjRoazlN/TWOnpoAfjts8VXmP4e7AbR/d9/y9
aV9O6q2FmzkoR9KLO7tD7Od+EojX60qGhOWdgEQdl+V1uH4pPjXWvmBLk1u0gdDnFLSxPcLaaKa4
KS+sUL0FfDBSYnTDfGSxWvtfviHX5Gz1UG3ktK6efuQS1eRrXfPpoWi01XU3DO6mEwFGE0dxGyTa
NBNyZPi/JkCG4cMnJ9fwvcbVYESSvRLA5YsvLj6v12r0B6ywMQMOP1PPqNF8OqFX+DApsdQvW8d/
DgdOe61l5zdgu5k813pZvjPc2eSHtdBFXf05tuSf+65bSLY8L7qTTGjFXhkX5XkJI/ntYTyz9OzA
KZCUxMaNMH5j1wpEyXPdsQS2wgI6PrTdGA/1fPiaUf6+b2Dao1LIxZEP4TaGNthCiECOxW0WxZQT
lZxwJT89Lt76eQzqZKZNbRqkLtLpR0GF+UJWRUrjFSrtfqhBvMXjlXRDA0xIqE/Jy5zQ/dgi8doT
IFwxbvV81IWJF0pfTFbhfLb/sW0VWwOX8tiddLX46Lcl/1VzcYmo68w6AndOOtPxjr9vMHkcBQL/
Csq9kFvaWf0Ur5EcBEtsEooa5FwA4RgNkW7/EqniJt8BZC3mSvV0NBqyIu5c/ReXty3Hgw8AXlYY
mAGLLLOQabqNKIMlWIIMUsRdHF8dqOqYN6cWmAIbKkhgz/UjuvCxneM5nJQyIoryGAhYY0iGVtqc
ePWqx8leqMKTMOL37zIBby8Cq3JIxgCrWRx+EGgYZ72Ide0FSjEslDCV7l9mzaLYCkYM2bHokAB6
yDWmCLd6aYrG5lbRJ0A3CWtRrAHD3NPBIJ1X/bzuJLwZ58WOhFu4rat7AKKVuFRKgrywIc4d5S8y
xzUz/+9iNF9kDniP5TyIddOWgRRncdl0N+oADCKKvz1rj5gj5ENx+PTeFcSilz+d4Zc+ROXzMFs2
qU2seCNSUxekn8ZPNaijDiSV5HZ2BbGAKassGNmZ9NmakMgjlLydd44ByUlmRAr0G48kXUX+ggmy
soFqH19sBdphMN7YYvxCa8bWRgfecFOBziEw/eouFkLc0KYfgm0pXCqujoBREjhVjjT+m12AuYjQ
xjBgOu1HgQZeWBYkM6cwLq8S8E5CrXOeV5FjjAwWaVZPzD4gOlvddgCK2SZ79YHBKAb8GLCdmLU3
pBO1v8+A3GHIx/IUxT93VM6ULvDLdunTs92XP9YkyvMTJyTmU3RCp11MdjuNtQfrv+4WpxSv8ZMM
uq89LSCssGvSLSB2EySKmRdzRWkR545ZQdTFMiNRgvhLECz6UoFz0AtgcDQBeqdGhMGB8OLvh67X
RAM7o7u2XtXb3fRWHw3aReheyh1zidPW+G3cQfqNu1GBW715pOFLXtNyq51HJLNyvuBicQmisda2
fOkQB7am65xFs3YremXcjLArEt00XiiEDQkb86rYYDa+y7y0IMz62NP8EREqzOr/wg/4/17eLKnj
8CxquuymQqbJJls2e7Sz8JT2wSEHGWx6w04aE9hJ4pdNJxS7fv1DmF7y0s0sPRoI0QEMg3otjpCt
qWuRyVns7YON1QNHI53eG8Wjj4NSeFAtitrG8oqWz5v4eNCS4t2x2mExRkAaGAV2mWh92zIa2xYX
aqb61Als38XPOZOmcG+GmFzFIk6O72x0pn0TmRCHRalWzTtO6c28JoKkfLzELh6nXHhSJnSkliyF
j0EsSfncGy5y68DZmmi4f91BCIBz46oYaHsvauI0k0YHWoCk5sNYimWQptFdUWCFoAMf5uOGxFUB
66JCT/+FQuyFcxVcITv2xtIZBk0YsXKFHg1y0r5k7GQEgL4uefwinobX2KZwoo04NWPtJph14Ogw
WsmoxwHLrEWMAIE2Tg45kK8v/R5BzaNR5RTEbZUdqdVx2lTG2OFlmyMf90RNfsXQRZoK40JGGWDJ
qKzlDNqZUKq3JpS4m3W2T7jvXerjHYIPbesqKGHkQ6UUfpu1Mlm2pnkQtZxhjt8hgQA//leUwFeh
sEbyl6JXE9ZG7vrJkOtYbiTQ7dWYqUEDiYniVHCFyXCEXSfU4PymMQB2/jYg0wjelIUy0/DOxb4s
b9/cBU+m/509uNz5h1tde+NojS8+YPvLA0KlWFw22YhS4AxzVTd0ZA9N2odGYi++Z8CNdbhjRsy7
7sZ40f/MnyHLRBwUZAh9g0qeIPsuoiQFaoMnJgbBzzgbs8hnyDmoFVKryZIH00byykGimBT0Kz9U
9VsV1CMNGeuOp8tnXZ2HY4RmJOrT8KWRULb600k5c5GSmiVv7AoCOZ8MzBiZNSOcR+kL5PkfkhLr
r8seZoLjlpBNPcU39ftsByPGgyslwNLV25aU0+d9jtRqg1VNcPvuoLcYiyhhafk3e40Z+fUCAyAj
f5hZnNL5ngGTjhBfRInkmuDTXq7/WYtZ+uBlSae7gE7rv3bGjTt/nfPFi3WfSEuwSDSgwfypt1Ec
NPgm7w+bSMXzyDmOlIzNshYqHTbZqf8NsSyIC9ZhfgAwvKJLCiGVstKL6p1abLCQN+XdMqxJvlSa
hXCaZzP6LNha2mSMget3QKGFPbJqTtJ4b0dE7lPALwILVwBCxpoAspZ7XeVoqvLIpx4XBYvw2t0c
bZWkgzHJAUpXtRmgdrCuliKdZx8Jao9TowJc167t39MzAWdN1eY7ui8a9DiPwMgMA9RjhmFpKd4b
QQBZ9/EeDtdqsTgcGkEMS7EyGG12VhQxCUNm+PBd8tYv8PB77B+jIlSLAS5pk75HvVTXl7P8H/a4
qwHCPeFtkyy/ObQ8PDO8/qOT4dBVdlJGSp+aviqk7U54wmn9Kl/mCBgAyjwyITvnOGAtATm61LSS
fPJXZHqx9VagswaKxNx6kWjt01bJf0aFOYXHKP7avEZU7NFk0PFj2fwQiNQO4RvAPKlS+gPZ73bf
7IDzY+wHbXwwKA9qFIk2RN07CdEt/elLmVYjf22GFEm49XRN2AWKXsy9AgZB2RIVk1gXLkSrC4gu
OE6tJgc1fjpZS5ep0POzmEZ5X8DmSGdErdqd7E4A9GLsNlnFxwndcyMLdycMhIg5UJgf+VwVURT9
3nnNNkCLIiz/AsdC4I/mzDQyLRqq1qF6aAb+oj9NwdDOl4vghfusoaLqXgXuSZ+LcUAaNDqhAkFc
NemcWMqan1J2mA9kwotYF5SEw/zAw3G/D1WNIRqUza5FaJHZXCBhCAxEgdCGuTsDWxP9+g/Z4UGC
toA1bQSZjZ3VxXvL2ixxfo8cL/m2zMe27bsQMx7ZyHkHyB8g+lIJZEEsjbNt20OQch2zMQByD/r4
UAANjbH6/sXY3hNiB4QNjgEHmk5DG87f2H5of2EB5wPpB819ILwjukv52e2h/N/1/Q+c2JZHHUzd
55o2awTSHFfZXv/eBWAuFFbgrdF7+3VhbgqAL/h7qQLD/z5izFmD/DMf/XkPun+T3fbA922wOQ5j
zHmMAAPugAAXjKiAuqAI4C2YBWNxWFy2QAuEDCICBSOXdA1WH/IcLAtFHhCAAbGtEHofIcxZgDwg
Bw7tye8u8KAkAHX9jBmHMXoQD+x/YHu4e7bZmN/a/vPvPP5Hr/6/7P7z+7+wB6w/v/s/u/t/t//B
+iHJXSTP+fbQZf9dw/xPqGM7Jnw/Tn6Gi57/mwvbQAMwbaHIQ91AADkP/QAAAAAAB5fK8wARx50v
9ZqcYIkeIRqP+//77iEvbpHY5JZXCBxCBAHsR6UAAt8AOOg46AlmEEdBYI4gBBGAIYjiBPkHOCG4
sWlItNHC2LRARIQgSRUpLoKAESEJEIAccJx0nHCccIHIcx/5v8voWYdsPpQPmn0nhAAPCUQAmgFE
gJAgUSgNi2iDwgdeAAfNPmv7A+bAAPpj5EAH7IZj8Z2wNs44Pr2xvC7HtAHhevbG2OQADhAeE8KS
AgAtJHhQtEGxeEBsfYmxeFBwoKIQHhdi+E8L4WigBsXhUW1bVsW1oPXWgBbPftsgGnec83l8oAEQ
UQDtACsUjsUlsIDkIMB/oZsAK6Bjsi74gShf4aAfTLTBsbY9Fg2LscP+3/f8+Hhdjde68AA/sfHQ
UUDhQdeDYmxvC7E6+AfSn0oH0gB82PpT6X5r5sG5/d/hPpn035APCB14OOA2J4TY4de68Prn1w7z
1fvu+PVvVu/4IRqP///71CEpbnHZJJY5CDQAAAUVUFoA2LRCCOAyBHQZjhMQSgaghA9QEKEAnQwF
FwCWA4BsbwvulbygAPdw9AyeXAi/4ZgyeXhChyEPQsw7ZmHbAf3P7H939r/oAB/0ycXJpf8uYP+v
oXu/u3+XkIAAAAbZ6H9P/d/kPpg+QHyP93/u4ey+I9l7I+IHs3+T/QP6M9/Ur/w7if1HiIcdB9Ql
U08z1gY567u+WnrVM/jnwfZuq9E45guQU47mgY4wzneD45mv+8F/uTzn9F/QH+SEoA7QArC5LC5r
EChCBAJhFQDToeEtCxRMAkBHHQErGAIoB1/wgad1x/nJFZ4UPCAHIfd9t/vD7b7h9oD/946Dwnhd
i8IDr39r+7+0/uP7X/7/b/Z/a/sB/af3n/7/Z/Y/s//v7AP727abADtThSgFSPD8ftYiUtSF44Ct
wByGggAAAAbaoBwhGpS9scQDsThsUjsciAjkEQCAAgSFA/H6qBx0GxLTATRgOFkEYCLSwBPgFAjq
IFoIIIgEcQjYuxuOgJIR1/Y/X/CBx0v/TMXIOQch2w//h/e23bAAMxbGDwmxOv7G+6+6MxhyHMfI
MxbG69sYPCdfAPmvpA+k+lPmj5r6X5t9KfTfI/TPpj+7eFDwuxeEAAB14Ovdf2OAbF8J14ACigAH
hdjcdBwgAALSBsXwnX/C+E46D6T+wH9iD5sAAPkQBQoHk5gsBz9POPAcwQHMAFAAZAEwBLO47LJr
ECBEoREAg4CQnIB+H4BYhuKeKLFg9UTj95BLYtsml9s9caDwgtAAfcf3gaDbWnW1bOnAGgAGYgAP
+n+Ox/C+F8J4QB/Yn9g+bPpfpfmj5sPmvmvmvmgfSnzX9g/sX9i+lAP7Cf2EPC9eDwnhADwobE4U
HhaKBsfY4AAB4UNicQZqgA8/EPCAABUHIRqP+v2v6YEtbJLZgC4bKBBEBgCFwDEQP8fkJXXjCBox
Db8SILBg6ycviRPxJjCORWTMsllwfU/qXDbHX9T15WD9A0/6D7L/tTuY/8MwcgfNPpPpv7sHyID5
ByDMOYQCc8g/wDbP+v+G2cg2wA222A5DiX1HknQeugALZtsKf07hB/jB/3xgfcfbPuH2waeGg6AA
d/Wz/t11/vyH/oABtnIP8eQchzFmG2e/Mhi/79c6cFtWzoGg6doGg6BoGg9/W3UItBANA0DQAAA4
6fhJpI5+EOAARmnAAAACoQAmLW5bG4bI4rDIQM4gMBZZBKxoVSdfgAAccB18OOAtNGxdj8K/hRf5
K0KGYco5FoIuYqmDZkf/DE33PtH232/uB9oDkIZgDTrZtkA46PkPoeYdsAB/abED33G6a48xBmHb
eQZi5DyDEuQvK8P+mnAGYMx8g5Btoch20APtn3f7R/eH/5//LYtnQNA0/QA08NA/3B7L/PAABcAA
PKHnDy8hGo/93f/xgTFuAbnodjAgiAwAtEVBpBKLZM4EItjbGJSEE+QbAiVhCGUjuAE+cIJokWni
CGoqECl0CoBfng4d/NbGnbp7VvxAy7ZDQdAANsDQQ0DQT7p9t/d/Yf2fdD/1+2+0+19190Pufafb
+6+59oX+t43xp/Dn4e3PcxWolckAJmzm4Kve++d+UkwGAuXNu2xaVnpwGZpZvlP7VYVR3N9aAx03
qv0vl5XGuCvdmV5zXcXMO9ZpaQ+s5qps0uZcln1cYSmcVSjr5KkIY0UUAFRzl25gmra5LE5KIwwY
ALcLa3QNZGNAA5BmHbQ5BQTNtrcvyk837/G/3/GX/Qe/vz2ghp7W9tegvDQ8h5fM8nk8zzH3HkeZ
BZxZU1/n3lyHbOQbYAAD/9f3gf3v7H94ItT+C6NXj9U9GknIrgmI88C1H5zWFVTwBu1g6Bt1d1Ky
dXIdndWt80XSdHVrfE0c7xjlDLZI9MTycF81FxOIz7GWWTCEbWxO4BwhGo/99f35gUVuklicVBcV
BcNCApjAoB/KeRtuASrIDUurtZA0/IkdVFft4NJ5XTUrNPOqK5Jp3ftGtn07wloBl4tuL44smu+Q
WvQNOwEtt8cTZotPAO9fch9w+vnfn2iDQaTg7Ew7YnXwnE1APIeTy+R5g+/893dXV9Oxb7f+d5Ty
+V94+/+8HneXyJe0zLlcIsJ8N3zCc/4Ly/fHlAGG3JQ1dyvWtXa13PMoaWSRoc7m70nz98q+ZwDP
a0xKQraEKk4vdAnLY5bJJGDIaEBVEBlhDK0e0AKl5boAEHl401nH6HSVh4PF4QXIcNxxBoNNIIq6
uj9caJfwgNHAHl+/PK9GAAv4BZpMYE8z3PG678AY2ecZjQxk8X/GA9B+7855z0HnPO+gedeh9A9A
fwR3p3/fHe953nB+W/cGjv9WgvR/Ye/7x3nqwPuNfjqg9XZmZycLybpZTpczjtHiIHqcBg4Br1jG
WZaWVFAm6fPi5ObhyHPg4CEaj/3Z7/HBSWxzWGR2FxWFw2JwgQxgVg/w8kCwoON0OIKpWJMCRnif
sPddI5R5g67/OB7p1z1311/sHXdt/9tB656507v+zRfcPuv/YA+0+59r/2+6+39oZj/w/6bZtn/T
6f6d/dgPiAH9h+lzD6DWhf822B7r7of2f2P/8P/UPuH3W3aftn838YNkSRX23OuaY/t/uAf3gaD1
zbABbWgAGn6DoGg6doOn6f+f/7VGKZhaBp2nf99A0//3+0AAAMP/6X/hP/V/73f9zu9wCTt0jsUk
sLhsLhA4hYJhAoCIKvTAHG2gAOOoIAgABIFCiwWiAjIsUWDwnhevBmDkOYMw8dL/jtgZhzEHIOQg
GnBBP0YLOO977vz4h8QPpQ0+2gtrroLa6779tsPiAAB8Q+ID/Z/y78t+J0HQdO0HTv9uuNADT/uA
+79t9qOadtlmuCA7c+xxx1zTP3QAAQhhhfiAW50UZgGGYd/uAcAhGpSVsANjcVhklhcVjkQEEIGA
uJaxyAA4BJCLSzBLMeICfMOsEwAJooEcx0AjgNgQAC04FEoJoRgBcx2z+d79tnbOQ++7JD32Y9s2
3bNPtvT9PDTtADTrY0G2/uPt/dB/YAW8L3ge//IAP96APyH4R+7/dH7r91mMP8noH+X/LtoAAP7R
/e/vH939/9////f/azH/1zHtvIAAMx8h23kG2ByHkPoX+OY/dSZWf48h90/ybYHvayFbi/ee/txf
ZHvuy+yQ95bgv99/vz8IAPyAHs/ZgARST9ucoCcNicQDcQLD/QJa4PFAAARzqFca51nY3HAEAAtM
BIALTAAaBbWY+QZhDkO2Zh2zkGYNBtnT9BzDyAMxP//+x/eP7f7//0D+0/9fu/c+4B9oGgafoP+w
W3bWgB/2640627ZAA+4AfcD/0/9vtB9seT7wAHnAAHAhGpUNpcVBcdBcVicNikVlcIFEQEAf5HQF
DYb0fUE11/s7+1CJtxx1lYFxSGdEe8xhtu2/3D+x1f0HVfG/tf3j//P7za9r2jnwD7v3eQch230H
kG2+h8g5DyDbAf2gGYMx7ZtgZj90AOQ8h5DtuYP+h+R/C/IAfhAHIf8dtDkIeh5g5DyDkIfUcZxw
GM4Zg4L9xwHCAsc2MnjiU8Tx9T4hgwOJ3+VQfzfoccN9R4lyHkGYP82AFzB/k/yf5Nt4QvumY/Qv
8n+f/D3T0DMG2bbyHbeQgAByD+0P/z+w/u/tAC9SN73n6U646Y57MAaC4QKIgIBPv1AUUUHKP3gI
/dKVuFUZYETp1P+7z09Ffz93FOX07OXV9PxRTkU54XheFE/sD/+f3j/9/sfa+3937f/v9wf+gAf3
/3v7v/8AzDmPkPIcwcg2wMx5h5DmPbAAPQMwAAByEPQA2zMW2cg5B/0DbMwe6Zg2wAnEHDDwCczW
cAE0CczWcAEEnE0nEEmm+7/PX11vE7vc/P385FFFfAD7/zgQL5sUKWTDByEalKXNyWhwgoWBZoUb
DmHEDiZA0YnWARgRv0LFATwzMmFIQ4eTKJOGzhS5h/6bbtnINs2zbNPtsNAv88BPQBPeMzFmPMG2
8hzFyDbOQcg23MG2hmPMYAFs22Gg21p9tWx/v/f/d/Z/cP7/73/4f2f3f3j+/+0P7f/7+4A/65gA
AAADbPdP8A23/DkHun/XHcE6/OJqHhIN6djmcwQAnkAnqeO7Z7AMbfsmDxui+ycZjQyaOVxyqPRG
Bwb/NcPeMVNmty4RrzPuX4DC8+/z7j7ey5TTk+J1LVGqVWjHXm+KxtmP/JtgB7v6HtvIOQZjzEHI
AD+7+wAAn3xZgYA/dYsDMDKdA42qE9RntuXl8/k+883lPMfxvaD+/+4/vf2H/6P/3///vH/9/a/u
/t/sf/n939/9v9/9x/af2A/s/tf2gP7v7H9h/YGN/QlQH6ABjf0PqABYgJ6nmep6+pfzT1xO/X7b
OQeghtvIOQZh/6/45iAJ4xuNxt/DGTz+Pfg2WAapUoBCgqpsvqrJ62c+4xM/RnqGc3zSeY04Zrnh
uuqtc3Ge7+AhGpSVqktlktlkILACUWW2wUEBO/DJytET5vygn5D76T31+tS1vDJsKTh2MALQdEPd
8w5j5DmAMxZj+aPpPkQ+RPiPy0Ppfm9P0DTtB0+29PtrwgB4TY3X/C7F8L4XY+xg23bOQgAA9kHz
YfS/SfNH9i/sf0v0gH0h/YPpX0nzQcg20Ns5DyHbMx/48g5DsUNiAHhPC0UALQAAB/19A5BWpf8O
Q/9MnMrdn+T3XjhcwZgyYX/KGY8CLW5dt939D/68h23MX/ThCgG2ch2wP+gbaAAAez9n8Q9m/zvi
fy98SCUsYFtQBsUksYBcIMW4JQFcqAAC0kUSjhQAHXff9s23p4BmHMYZhtrQLaC2Ati2rYDTrZzC
AAHIAzFtgAAehchzDmHbMxbYGg6Bp2g2wHsnswPm/pR8gfIvkT+7fIfTAOQZizAAchzCHIMwhyH3
YMxchzGHINt/65gzAAchAOQ7YAe7ch2wNsB/YP7wD+5wIRqP/e578wEpa5ZYZDZJDYQWBdgQKUne
JvXAqW8Rk9FJ8o2BLwh2AlgAEqGAIZhBPMULSQTQDHUuFwUHE60L7vtgeg8g5ByANt+mHxPsnsz2
XxI+m/u5/dA+aPmgfSH0z6Z9MAPZflp+X+z+QH92fTfIguDe+2VAEGegAf/3PZHxPxAAAdew3D5z
Nccwea7Hms1mgBOMcB4WahOOoQ7X/N2D1OGAj+wcdHq3YP+b9DMX1MIJLgprxSH6PIds22c+h/of
0H9D/I/yHnPQAafbQf9/99B7+tu2tBDQNPDTgnbEp7XJbEDwB/gBSmLbAfof/+32BXtC9chzBtuY
MxbZyHMQcgzFyHbA23kHIeQ+E8IGxQzHtgBmHkOY9OAA0/T9BAOuLZ0Dr3X+vdf2P4R82HxPsvy/
2T4j2QPyL8L/ev6D9T+m/zT/J+JHdD/YP8//ODr/Xg4QHHQdfDjgNj+F4QFEA69RIA2KAB4WiUde
69whGo//77X/ATFxcYCsThswLBPZAQYwHjqAihFp5AjgNAQ5ggiUpAsOtC+h8cLyH/HMdAszD6B/
0tsNB0C2O/v9gtm2gC2ADQAC2gAMw5gDTrYtvTtBtm2gH9wH3QAbYGY/+uYwDpPkihA8hrUP6IaC
AP7j+wFJ8IPjiaAmfyMuv/gtjZBTQL/Qfdv+uY/Q9t91AK3L/gFFo2Px0HHAUSDhIFpAogBMCCUB
HX7SBaQCKAWRmGgjWBYHVPFX6OYuqprBppBtO656507T+/fztsd+6AAAHXPXVs9chbNtWxpwacGg
6DoABp07Z3PYgE4QE4rC4bEDwB/gCsKALTtqk286FyBrADzGcQFv/z+7/+f3n/+/sf2/2P7/7T/t
+ezBmIMwgA/vAPuh/Z/af3Be9G/BeF40XhtgPt/aPtgHjXvOOA0Yv/Z69QpNiy8TZvhdiUUANjAA
eFtEFEgDBwAABMNBmmhN4Q/yZTAD/6XjP01Gu26VUc+PXQgiedMxGKeQ9Jyhf9udH0RrLhXv7Ybr
vtpdIXQAJN/HP/2d+5DOtwEprFYb5+MiND+Ht7p/ha9YWN3iRAIS/VBsyTVY3uif1FKZcu6yRYDI
1nZjf0GKWVARNldW9JqnXHOjmYBcOrFV8t72+cyqkZLuKTbGPt82B0iVOyb/hWOXZAPTIi6rzWTk
3ZzGoDqZ0k3NhMKNmez7NF56SAjMgZ9McqhRKu6MmqidzgjUZcvm1s11TGVveiXfo99MYmL3q6PU
fR57JJJEf1WttQ7Woklf8lWVXqGMyDpPFPJi453cx3dju8QWsESJ0ir9TezRlPDrJ1lQuu6gm05n
jI+4qxceYkkOBkMfjfxTucgGf8iZZNa16cdfaHxk4gLf8i3Ww4PpAmZcQK2f1g65ZAMV4aVz+qjN
hr5McS12phs4cbeo+MOQmdM7t40gssqFk12Rj3UAVt760HddWbSBozU9Z1EyiTCn6PkTS05ulrSc
kx9RKO5qdU0gHAchkbg4L52juZetBseAvxSbjL+r5C3n8wieuXJLbtIavrdOEZP/ueDxBFt5rAp6
HmeV07a6ngYXoUSdqG6zYbLYDCniA/H3bi3xNszxjpwFDg7n70YQEM0hGMawfwEACwNjYqdCt2dy
F3Dx0CTTQIFRaCeFCVO1z3Hjg1g1nb237hv//pQfZqym1SO3Wx0qs8GlFiB7qCAg6A6ivvbRvAU7
92Epi5yPfwUCGF4SGOzJkBHfRXix2s+wWgMcIojcfUEQaA52/4E0skQUb4G2ycSzR44D/+V9vjRn
Lh6ZgAUwTAXAGrr2fMjYayBw4ATSwY7b9LdBQ4cSWbj6pbi1lJ5JNs5hkpD9CIhF/fkdgRWYptDN
6QG44tHb08GPVRyuAQD7u3D5H+5/fpvwfKvAzq0eQT5AhBEugrGC5zqoxwWHWvy/w4XdS33Whk53
DF56sD2urniy/+aYlK7/7EMVeK7WBvmsW1Rgu6xYwx9G4sOkC3BMlcbu8S5O+XKmuwzQg2uE+pio
NCebuK0KsuSyhq4cgc2XdFL5E1jirfdxVJcuNJpLXhy4FNFQOkBFEtY1Wu1xQKnZna/NNcEzOJeE
OfQ9jDNmP2wWdEv0+UzLcxqIHGvKDko2+3Jdq7OGnhMTzBCmo7MrkD5/cvj97YnvlhrB3ntaz7B+
RQU/23KRTpCOsTSFwzATItG0ACWM9KfH3h6yivBY6WFEW2DmEhhZIuXnfz+7BvoaB9PLvZlpXSc6
0q/YFkH96ajmfEH74ON+L6NKDbFN+psVWfMbO0fN89AiH+e9pkWSLl9Ly+STN3tUaa/oqhWjsDuq
3Nu8vpRvR9l7d9EEfiS6k8Ley2aMyW2PfkqQycHp8ViHnRb6P1bDF7H9OropCl9wdrh1oH92l7Rr
lO4/OyJ2h4ZhImfDTYlQKEAZyQh9NlwA2S6xEXnb5AFnzFTOdJRQJOBw8sY8/RfpJ0b78b61WvAM
nnktKuxXDA3Bb117F1dKsKKPUoWSk6IMOWFUfN9lgBQ5ivxC/oUZqjAH/QifdnmY0SDzHmAuOeRM
TdxT5jWrrAjjEjxPvZ8tc7MUJ+Lzhw3hgzP0EbOPbETtAAASE0GaiU3hD/JlMAK/EqBpvnoI7EMz
1ECLi6iSwSaryL90/cRjXjR4/CH0lCzrGnSbOPlRu+vavKNtE45eLT8OHgQXlh+HwYRIAXTSxzPD
U0ZQFdOnzykJKkZ1fYnoy+0GsH7utQ3gok/rZe/zKy2o+8yRZ/ai//EQ9oKznLzFSVuuspzMdMbC
78eBTtkRiH6WLbxgBc72hPXSW6U2clhPdGjAF12kbnYGtDZ0NAngq0vBr8eGq+G30MJr9/Lgjy+Q
0h9lkYLxXY7rXiqO/vkbcTxyuv8svvhkkOIfDbnqAAnSIGzoWrjaFCjnmebnhFShlI7FPwuEv5A3
7g9OPh1dJC52QZqcejMBUZavj5rrwbm+y+5fNrjxwWLBrMUyLW0+RZsAqt6E+LLfWH6uWWk5BqVI
yWX51kQgzSKVJekUox+3B/HOlHFIUttz2IgZGFzfmIz9yXSjRxbHFhYfUapzNl7mQGkNiLjTzVN+
T/SUA6Ogl1rDw8Z1sncm6ziPUiYo/jVoJBQVo3DK7bH9m0uaIOqOZpIy6S3gGsaLuw6NfDnbaVs3
SKjSlumRPD5yTgvp5Y2yXjySmHQtOqnnRdOPxDl/0a57c+oc0WPfM0W18hPPMseNRV/oeJwts7uS
SqzyItznvMQQpE78bx1YmWgAcugFVbpk/f1NurNDIqJL0FzMY0U7Waw9fph4clDyohX6FCTJ4NkE
Ae9XVuNg4iXJAGeo2hzTseTZ/Fd7jva2IjcUZR/jwfU5IiramqdVnoIHmQ0pa6+wQLwUIAZTlvsx
PxdSIbAfUwEJ9dxTtCr6jtBRNk2s7ya1EZj6dVOhTr6td6MBA+ZZ6rgiMDV1YnDTesXg9A14zgt0
BPY+mQGpzfpWWBhOYT8Q2NwGWfXL1RxFish5QpWxxqugwcNmDmghNKs1VakbD3JOMgDqAFCV6eZT
EcQHXIbHrikDDtCWzb7DtLi/L4ZtSQQKSf+IR5Jqk8k842qLG2891BdjiQS61btQOrlIwiW1Ub99
U4HvZZPg/PVWCdjjt3DGwG78deHkJkS/Ei0PPPyuKYjp93jfN0tNnFIEFzs/b8AuNN5tnae07RH+
rJSVzW5QFZNosY4SH1uiQnfV606LdVqOZQtlM06YKQesNUN2uJ1+n2os4/cxveLOvEJ3fg2tJfcG
fxyCrFpDzw+Blcx0Ux2n2mYHoeoCzDNYgS4DvdFQ+bnz+Kofs9JM3G5KE0G5qtbiFUMwq416qJvc
kjhKgCkTkU1SB8MAt1hBoRNgo2m/rKPjhkt2wQGGyrUTXjHu1vwF6p7YmV+baVcR4FVrUYuh5SUG
yMTqZdgPVamb7KIbCbZqubNHYohxRBQ1Ysw5s/gKIJ3OMxDCHufkBoz9PP4ASW6zxEEKa3zDQ+ds
addnfM2EZulDi2vW27vOLx+uEwPPaaCbQAwdFJuYmg0T2WMDi/5W00PGYaEPOYzgFKyySRTr3kXQ
VBsMUrQ5XCG6fyRZ/OW0C8O42oPXrmz1SOTPcH61zSVFWQWKfkd3aI+6uweRoew1t2xkRaQhZxnQ
1xQV5grIgp3/K+ZZNGswqD6VlVIZCxx8H1ggqRWgub2DhtlXOLR2xsjseH91vmiZFqiXWtlNGUNe
ZCRAnXY4MNXHUt2BJwbSa/faCsGa8KeR27Eetc9xVH1hLhAZZvlOkKv8bTO/DoTHwd6F1yMYiT1h
FmYc3RkwQFI2Ai5k2D9/uEm/qyTGek62sHbCWtOua1VjMtK14A6n2vm4HD+JkQPhh9Mfz6yhNKkd
2rHSqkNk0iBqpWgOR6SK9qaXq3UA8bwnyYKR/Z4Yg5qN7UEQxfK++cFSO6mi+IHMZnW1Zgbb3plv
jEhih/KoKfimKCrLCakHoM7/59hFFopPB88MLWDzP6Pq41P7gHeB07aCX9S8sI2r++yEBKRYty2k
pN397WZ1T5HeTZMtzmzFiNIBntbxsZDgHaGdkP6uK6d3Z/f987+NmBYkYYTFDy/jZQgHEZfoxxTq
bIsWdNCOfR4ryoHhVuux1iXm3pIiR6lnX7aNSstIGzfxu3jbwJAHLaByd5cko2v2qBDXNhIdb+Ey
rzxIOIIhavicnUtYkqS3E9iNIjaznwsAyk0tZa/DNqf6CPr6NzUPASMeg61Nu8oVbT5mQ9279UyL
YrcE4BKz08433Z1oaPbx/0hdluOzcpkimjovYjhvHaGCLAnBHEzeYghaoUwAbagCDnBwWSUThWG5
kHyWOOCsso16ROInFo663/W2c0i2a6M/qFt0VIwl51GtRIEpk7tb5CF40hfMnfqHQ8xVkyo1m92d
zrGHlRRmz5rI3r6GB9d3pep9QBQBBfNneTdYECZNCYL8X4PORsQMIFMSNKVX7tjVNYMVlVpdAVGs
Dk/gMLpqc3oSahxTSj82WVeAJXiCC6oJ0irH7gwvRdpZz6NMHosU2OXT4QlTm7FzDW85+f+Y4+6/
fX4wvc0GHZIJgRZU67wgOsv3nWMl92oXRhw92TsNoE/UX+7q/3IsaL4QDS1dR0CB22dum3eDbWt9
Y4+VwFgU8HGonoOXsclZMlPo/75rZZgu6n8B4i8qbzaNDLSVY+Tid/M/+QH48/VaJcqOcyS3OHKp
waEADjtu3XAOXPIzf4LefLbaf1BdH9o5CwNmKiZzTRqRl6zzZBQjNF+o/mcyYHcZAB+ndadTDbv+
kaSE2hl1htWlKL+x7vS9Yvj77l8RVFKbhaiXH/ADxZbvwRi3uhN2v4K5+YERFFbH2bSYtcMWgi0J
yqlj2XVt1GXStkha+QojcTbPGWQp82nYhFwnqc/fz3PCo2dwWakgVOxCXToUu18UlCxt936/aufx
iWtZgtTEoVI/O4KY5FSfQb+jf8z2gDWMOqyKPr+9SjvdRjCSuCG6wXhL8wT7w3gLyQFzvaWtJWgg
HhxF6AABT3b0iBzTYGgrgf6T8TxAJoyP6S4rcxhPBF9NlcM3ea57AP+EtNaQO0lRXxqlGYj24ukE
WijmhJvoaYmQ1EtuLqW9dnY8ItFv6BYsCUBAWbAmo0KWcn9pxGaWKWM+QO+U55BZ/JTeHjNT0Lxe
ZC5w0Pew8Q9/fEYggNONscmn5ukj40pgKNKI2PURIrQCSoTGRhNxUsmJlvG2q3R957plzfNxsNnL
QQmHttzFIco3mwQB2z7qnZ5Zra5I/KzPNRfqLyOGZG007s3vyWNgstpCXq42yRzQ+B6bDMc5WnKq
f4+XxGwub83YDS2E+ewswNowqdBeJHAmwFgQustHck+D8hJdpcu193iQ8YWCTlS+qxzl4RrEgjsY
Uak1pi3sAHEpr62Se2v87ksgs/ceKnAl3Q0gQ9Y45mDl4g9k8sEWQrcbjZcQs6eeEv3IeLuiokry
Itg8xd61+cMbf70znIbGnBSfnEbDbZamVxqVikKX08GJklT2EjKsvVkcsn2Vsj/owoJKVbF6dhS4
CstY4Gr/N+lgDcYCqwod4WT9JmlBM1p4f3tNZL5R5EpR2lJW4X6ksgmIcvwB/wb1BInGqaC94Krj
emBnqoeXIptXGfeWncvdeqLttEPVeh39MTPG4M1UIdtjjX7noiH3gOHTmm8n/Fc4mo552FmbbHIV
x/kg8M6xBLYrs9UIKbzKR7HeWuJWbGgHrKWbnFtbULnco+pjEPFi1VtHds3eNPqtVaOt7yX7vhO3
6vijVjuWnXvXLVJPj7MN549cb9IkRkcu9r8pvVVBX9eBPozpqrC3PIRPq/n6czF+SOrzRQ46y08f
LjQVlhYg4DD8Ogj/5POvY00bwjir624J/4Q+oqWf9o/TPGaW0BkuPNKNltL6skYqbJdb0ivJ1TdR
5G/bOv7542oqY3aTTSWrA9RXklPcJKMV4FDvqer/BtVSNFrRvMVV2hYEdZJvrdna7mlRO1TMT6Ef
gAl6UXKdHfj/kfHPSV6gTQmRD5d8FBmmpK+JTph3TXWOMCvsO/HOJm5zQZjC65o7jInnOz3WOSZD
WskOutRlZXPmB3d7v2uhrn26blCCdHWJnEbxB7GkAB392CM1VnShRIibTqG0oT2talmLpVwwWK9s
QrX0wJgJsdqM4g5CbCOdzqH4w77VK50k8uY+cX4pChBIKI1m9AvEJOdtPRjN9AXp12WtQL6JMvAp
tuw2/sFj0xMwcG0QpCZoLFPr6g3qiKg/NewNS54IP5jSauGlLvnZZJNtAdjTCkwxVOKR7N6qxrqX
DqYiHTK97DvrNZdSw246dfzeHeUwla+DH9fiXFqpQNwpi8gKZXmqUU/YD/nJBIw8SyJh0vsLUYUQ
wm5qorR+h7I+x5t+v1uGzcVykIqJRohsKr86rJcb3UDp+4j59HZEYSOUBZdDi4G4RmY3elzsjXcj
qZsHPOYXAUUdA521TYH1IIQpDO1NuUABj4hIBthIhIEFrN53vcKR+wJhqZykk/OHe5dXi0nb3VrM
XwRjx5ao5/HZz3WFofo+M4UQ5SBx6T8kZHR45fPxC07+BUQDcS8r5vk4Bz4WwUMaYwYTftXFfbf2
d4OPkvKMKYI4XZe8H2cJaWx3PgzvMiLKKQulqG5lMX+FpBtAm+EqLeAGZnqGaSvc4ln2jX3T/Sd1
9Pz/YuGhGXF9gC1ak8Imzrza3Qhdji0g6csy4oI7wJeFcF2BI3JqiVwuTRLKnwC+zxmQjdSMDuZL
9vRbCVVF1k/0I+13O+IUPzExk8+ZFpIgsf9zG+TZSpwbbV8ITCeWcdTDFkOwGy0ZyewlJgBE0XT7
+5j4r1NSDxQYOev/P7R0IuwfZbX0OaLWMdqpNdNhtRDnXmv5QbpL9qD/8VMZUlk7agzJMOO8GnAD
wKUYzsgwaZDIyMofPVGioRxhydldmCw7pbUQHRXcVb0EP+i+O9f6EnyEeFq7Ro+Ad9ykH5J59+ac
9sB4uBM0ziG64sifH9kDxfhdvigcbP6hMmDTQJ8blJZRMOTY9rG8zIi3xIyf2y7jF75YJdGCaxdi
yf2XZqXc1xQsNTnzcENTNhjsqjlWzfd09Tmc/r0vCDQq0Rxno9Q/uwAmQL0WjRwIrc9d1XeLh/tk
zb/hQ2iBRm3hqDChAFsH1S3H9lbUQKcCVtI7wv2luo7UdI6Z9Fsudgcw0O/RSKwhvGd7t9QoJ1RU
X4OKZtCklZ7gqLzt8in4i0ETQgc+O0q3wxC9Vhi7rEd7tM5SJGBiwx3m2TXl+6RN2jmZHl8nMxez
BWSsxgyWgtlP+zanBeQX0wUNT5s1MWa5PduQcVto83cmyBiAHrAC+XVVsEAHd+y1aIxE3cXVl/7N
yG50xdrWQcrlrt2Xbj5wBDYfKjCOpyyeF6vq3bNFRMSLNkju86byQRW8PvcCSoWkWCdhOCM8Jd/c
vLHlSasOHyrfKjLgfsspdiBxuaVYcGknVMhUkXpS6y6ciVJNEMg/7Vblik7hkTVX59pNKVKCq/Vz
nWt6eB0M2lzYnClQveMPuZ6dCCquIjHPXa3D2pN5N6pJcfjkp6qP8vGVGsfXPwVH6m7hPrUMkT6s
EwBdg1Cd2rTH0b04qZNiPzPwaEF6YIPvJZuxbrZHMyr581q69lCaoSI79V+x4Z6MrWcAnJiPKQkV
fX495CFf6g5PBY8OdLholEMg9T9gWJTJxV7BmvGeq3NkXMXbrIZN4RrItvnEKfvqTSUNdrgxt/ss
lArs+pGiJ9ZC9kWTao3GuhFL5GwG6FiwvYbKKWVC9FEJcKraQEAWGlMbv/Ix+Roct2hciKDGc0fZ
HcGQ0QYexmox0KST0ztxz1ikGuNm4JopaiwaQc59CJF42dQeSL0+Qe5IYC7sf3kI2YyW+O05Hy1y
sbZYAhhgMSRnqSEdwn9Yo7ewCs7jnZzNCCL7pvfWzxDeyuefQEYhdaqklQ6A1aE+qt1piqrCG+rH
asseHV0GxTb7HFLtLer6ronf4XG7595GfCY4K1Z1uPCFcP0phLE0k2kKY4YMmezEeDpBEIplI1+4
mFwINLzsA77mqXcYPK/UuNMjfT+PiAP67tn5CzR3WJ/78HXyKx4oUFJY65rSikoFWiPmJjw2trSs
ZjSoqlcxp9hRrRc5s6aa/4FPElY4qWn1DPa8LaCFWFs5P67mcQTYZ4qb27ENV//ePCsLJVuNZGhN
Y1RAQ7Mh1aUAAWs4wLeyeFgKRji4MV1uRa0U9x8kW0ZGvVT9Xnon/8NDQzR3KlEAAAu5QZqqTeEP
8mUwA/+lcvt5IiftCdC+ocyap1NLaNe7VNgPF2oeePOXxSecV4RZ7T7lji9pP4T6uEzhTXU5gIxC
m0lp9jWoWecRXKHGk+5O+tQM1fdVlVO6dpwuc6YOdcETAU/uBtNtWEC1QxXjd4FpVgFPdt3qRaKL
0lRYg3vB52+d/q3Det0uTm+5Tuqpml6tSOZDO1od8OH1N8x4dSFQbgRVcPuNUdlrrUT8cqn9j1TS
TWb3Q1mi+63jSP+NMijbKuq4ZQsE4GmT25atOskUW9jLrS2fPGK7iCFhAHpn1n/sbhmenRjBhjdB
XYcRYbF1ZrmuWd4dzQwQJVgvPrqtOj9ZJMicbE95ohLDdMzfkzjNfZBiU++yvsPz3hZVIeLQhv20
LDz+476t5yemU5blZcu4KcNMPBmppAMrpjFC2oO7+dS8NKarr0XRar1pqmW+TvUd+phurzm9mwp9
DQ391i5qeAu/12nXSdFjKFhNM1/RLoKS6kuyoNvKk3csPPUwNKSsYi13orXemX2zKCa0djSvlTfs
17i1BvtS4sA1g7wC7TPVsxON029G6d1LXoXli7noFRAGsg6kLQNKBu4oi/ZKQywcHGg3TGw2/rG7
+Zr31bEk9exUDF8nq7fjXHLaRl7ijpYgqrJp41HkNy2xKO0d1MxLYld+25yoEJ0nq+FnHjoNjgZa
SMn+iylTp0+ZSdTCFLFsyX0HA4BSnP2g7ozo7WNSln6t7/+mSc1e/gyYViijGBbK9XEvJ7X13eLR
iaKVzCLrDPIyMv3hwQs0mgl5XrMFdaJ95elTimzb4x0WkYw0NeIrpAf1gMc64SJr/vNdNMpoOpQs
CVw4oKvHp4jLeQDEZtq704cWrvPQBGSkz/PVquw6TwqU3Y+QCpEtwl4IYh0nJBSKtgjuSWQnP+Fw
T1d9Uu8arOVZELCthsrM/LiomFBO8g6S8yatQwBBN5whurOQ2fkVk+MPuIy3VIGT4dL8CSezG9mD
vPgnQq0X+ApDKGVm1q6w0gwBX8Mq8W/HfEuJHSOdisRlhm2KqXnpI+AjJmCj3EeTUDvx2NoUIkqd
LNfXpLxAXQ5zDUQB/00PycjrQmEo2UydhWn5C/dgHmLY/oZheA9SkzBOz8bp4Z4EjwM0eBBmgFL4
iObtoN+5URT1veMoRzDqzRDSefp7S+BZUTyneJE2qiDau7TvZ6nA5tC7lgRDrlBGbVBEHpmFvLDq
fRpTIuoEb73oY0VTKD5aZMhwmr7/r+qiQ2FMlHYBC5hXwE8fyXozF1bdX58ELRFrKz4Qn13s4h3A
m2UcCQKAcDjMwU2wUJWt8rRV/UHjQ8VrFAiNK394Sb6RLpa0BLzdRkgLAze8id8WY2YNt4xjmzz6
QIxN3zXiMDO2a4X779MbSmyAnHmHYx93OujYCNc/ueJ4ZdcQmJ3tyDSTXTJup6K2WcKqDaZY+pDC
ljkB+9ImQ7S89nxCBCYgOaxOzsAe7LP3iX2U5eooWsOVHyFsrk4GCQpcYfDOE3+UK1OES13YWKwy
9CCYYcpLYG5fOvNkcjUc6Yfu+t8NKzr4mTsUpFxSrKAPr+yvHbM6BV5ykyP0uJyITcTECXS9aySo
y92rP0J1BOfAeCKCL499RRQ2fxFC244EuevvLgjJnWVt5RXF7QTn/yrRjYiSd2xjWJpCuIc0+uBZ
CRCKTlJTfPFgnzFjJTWTXcZbzyeuXBLq47eQX2zAzySfqAXFdiCpQog5arjmZcDnS+OfOTjDrtR4
0dq5vEl+v45ylzkpubeB5PYW+BhZF0BSotvF4Q+T8tE+1sg8DfSXERGnLysvc+5aLE2kkL+PuBal
C1vyJcIttc338VBB5sxE3e0694DPM2d5yDK5S8cQAMgLc7TMquigf9m+xjn9rOHELHQiQfegKsv3
J5i9Tr7mF6K2GzIMv5R61jUZXTethY6m+zbbMxfqY+7WD066uRTz5tFfz/XgR9RS2CeBMpYtSFaK
EyARUR5zDZPYhcPkuPvUA+kJu45QEPm1xItdUnu2bQdU5QMm3XG1CcrUwfc//cDWu0CwDJzrs8FN
uH6tdxYXwVXjjEkoZ0n7HFz9wYNq5K+P34i7Ep4d3PwraM/l9P9izRA/UnLk7Wgstz5otYtyiwZ6
Sh0TTZodDpsoaOhYVGBMvv4gKWOaSiIG18GVCy94CFtGHNhCI7rcB+Per24cevUl0lnDxvtHSg9U
kBRzEDeTpvtHNV5Flxb+1Pq2B8g4LmDFbrRmDp0abCc/Gqk3/C1ICP6HRn4jaUtB33fzg8Fvst7q
ks3UZ0r2Htv5k21EqZke5KnDvmUUQaPLyO+8vUPZYG4GRYSazbITNyYnOlLAbViZnIidKt8nof3D
Y2wa1SPmoHsRcSARAHYHUZAl+pReDaVCfS1Fgi4PKPBN4sN9Ra5k++vbwqP2cLddb2aFl+CiMv9s
57wdKUOClPK5A2vfywPnnTzkCrYr7NKy/YUMq9AYhunQj7PruOEnRgMenzNpkp2F/KWLRW/hZQ2k
E70XVpr5jDJl3SpZj/SHznMVksm7ZJ9dMk6te4zAdb9M5zYAE0/pDSlghKev8dj+bHGS+HODIn0c
bYHqOFwzbyBDM2iwkMXKB7y3XahlSYeG3C21WfyZz1eEBGBJ5EDL3GfHdQvgqRIm8+hAI2HtVPzx
9852oeEb4m0s/juWYTkMx66yQVBc2HDB417GcbKJMAkLmaRI1HNQVITCzUWWrVLta9HAs0AU+Rzk
ivoK9MXxr14hGTd8ymC+sTS8UupmAmbm/9xH0zuFbG2QZUmVxrgtHWoCNa0wt7UgL80+VfRmgV0z
DCleUwF/kwAU8+/lKGfYyN4a2f5ILMtkZ+CxPHYEHl1SzZ+OiQ+Gi4WECzgXvnb0iX/lR49I2zSj
B8OoeGi/LqG58Zlvjcn2uSwmLXgS/caHp3dZ8OXQTKb20j6r99+t8IUND5OWsv9gjvRZM3gKAM1/
9CJh/2bwN8T17U/FV5ynItfiiWPwIUKhP/MgAezgi/BuS1mz1mZbVwPPsHW/9GxO+aL4dB1VFYVC
CFN7R7ikskSeL2U4LxF2Oc4kUdTX9ClvvQ3MHXvcCMkDopbpmvd4IViOXhYIJKgG5k6Og0ZwMFc1
Yta9OIzwoKJgH7a1nDKljiuXqH6TUKk42wzFF5i9zsqdCHkDrRKt0qywIXi328D/0eLU1e7rqHI5
GcP9b49W/xHycdfq7051e8hnvYhF1ImZ/YFheuh7oIrk8yv7BMUNThU8Tw/lXJ7ghUwrUqkx614B
/Ubk7J5l8oVvZSRo4atz6nxzo90CKcqvFaudjxGLKEKOeR+8dm4fVffQSC0OxQ7RUc995QqzEoY5
dGKGr9cvLQvFPKSr8I4vRB0UXo5eh4gDkEjuf6LCrYNqD6PRUwXXBj4cJXU6xndO+Dml0RRI4PXS
Nl4fV/D7Gs9//sYF0LIanD/42n5vt1NsEr4YY/5xYQ43gx6BppdaIx9aCFfN21VdvLey7nTk0W6F
gFnK22MWfSn0cnacgIU295rzQBB0oS1QTlDue2cAwBrdK4MgF32JXZTXvPd8+BkYSnbG27+yhnP/
rPHsRzq1GpSzhaij3mfQC1vUbs6llCCmJbcSsLS4SFB4J1B/fR3OdudNvPTgUFS0Jyhmx1sM2POu
EebI7MsneRw4NIlVnWW3Wss6UFD2mGvEy+uDeTPpsYh1SbAZQ61J3Ptl2PylQsuQ70ypIyKnmGo+
nPHV9yvtMJ8SSiNXfbeprhf+q8V19vWnpkLCWHJoNM2MjjtpjlYUZ9zWezN6RxPmPSIimN/as1Xa
zbq43GVie15pYeBD+PxZUjQX6iJks/NGtuYIRLxT0KLWnfxDhCoslvfcQBjqhKiG8px+1hTxcsg7
3ZQUnMDYy9XjKpsOxnGoAiprajf8XzVC+jn8JDGseNu/+W70cRLqqoNE6PMmvSQ62CbWVzrbruM5
eBAYPkwONE5gvNT/NiPyHG8r8RQgk5YBNPZG8MAGuQAADVlBmstN4Q/yZTACT6SQpusW2TsfFWQj
iuG1jF4fWa4i67XxbxQvn+1Gtst3U55waJ+jyzNdGY6XN6iChVvY7LIu+QWi1M1j1lKp4qg9C/ds
54tYERQeojp1bmxNtN50/RPAG3GXhRKaXYbwvJ4jUuHdYBNLmGxtKBGPX3Gzpt9Vauzef6RT8ipP
gbDMmqaK9ePUb5kIt75X1fC9ajrmhQkYowc0l9fuueW9sSSIDms/3xuyj9PJlUpq45Nzxz0VCLma
03rwO++SBDfXbpk8wmd1ehiOIWYseYwfxFugXYaELp5iWR2Dh0oib+IXm2RpUaoIlH9tYup1KQcZ
n823hymcGDF6FnkpnfSILGwCNZsU0VwNtN51C9jDXSqdcWf/d9XHeR7q7Bl3SkVUYMEYgkaU1kxM
6Du6Ef4AGBbfnKAPTW1+lNgctLdUIE5xKi6SwFDIOYzq2rF+OqKsz8ZrKhWk9zCyzUyEM3l9Bi4Y
RvVyCqTmh6LPd3mHwpuL1KEOr/Hjxse1bM5tSlADbV0935NGyBVt4g8RbR/zFLAO3iIUfg4wiE8G
2OWDTZx3HT3vTCjPijYdIq0vaa/vE29cyZHTB8tdS2cgDc/rzZvKD8Pgdudfcn8sLbNUrKITwC12
eGD1KeNGYyWqy/LsqzyyOVB1Y+JQVFGLKvNQy1JvdPp6XhzgWxHHf4v8U70RQUMoQqn2MrPwrdRf
5bG8vqUOqQXzhNwgTpARwC+H8AwQmyiQBxzb+Oqv4QW2eqab5tzlIaHIIGjAvtv1CP4sbUOB6mv2
MznnwQPwacND/XTrEn4fcTRzO929ii5+thhifd5M2H+0YkwJwpRJm07419y4S4Jv5NtnXCtJXszJ
BX87C7guNELTdydSezX+5G2IN/SLfxmkR0GhJh33+PrUvsCOop7gCCNrKHPpk/jZXOKVSsGRSxUS
KMbn96onDGQC7teFopHy29uO1NGmToBG5H0qjAwWE6w3AqWyVkQZxjNnFAuckZcZZG2BlxTXJQAs
9iFvHpFrfRyZ060kSgqy8OAngYF0AgIx05QE4vCQ3lVpcl+JqbpChamgSDftNwfFncyJN9MbgpJx
MIoJctraFPSv9pKxmrWClfeg60jpwxnN0ttEDSpxFRuHCzeFNkotsLQBLrbvaoQS/i5gahr/pbd1
JLu/lA1nertWtRVuMBwssVOn/uXArKaYSGgqZ2Yzb1nUp0f/WTjZ0d9aGx+HVVdRhhh+sg+D/Zm4
d0pC6a9C35fWahnpr58LSL8M3dP6pXkPc5M8xsvyx4njfW4oXFrJLtnaPtW7WX06haKDY4A/utAS
ADC/amrzUJF+rDOjqmIdWWWldvyb0wf12dPQmVHAkLUIGir9Mli5OaznHkqXRAz3VcRosD4pzUx6
tXQvw8ZyCniR7KoDt/+65WkVqLphWSV2hImTK+CY5PWmamXx99HsmjSTfg4OsaR6ADzwLA6m3bvl
BuSMkJ7D0hLU6FgmZs1ThrW11f2UKILQFRG5o2KXjICEdn63vzkOi20S8C6KCUyqWnbV//Q0uWm9
Lh96s58PtmnUy802DfdxxL7MYi9nsPfqEZzITEebx9K0+WRWQkh4oSNSZL+1TvCIf+IMkE7AJzMh
b45j4/+bD7lGMvsSPMbJo2oiOID+XyLGfxFKsKemhM3pr7a1LnYAubP6OrpZfBsKKz6Jh9jQUxiC
sxU1t+ubrueKsONxxxxjdOz+UF7IHyEQwe+zHjXFdxU6gHfeqG3Fh86zDN/DVbQyBAj8M2uDcUlb
EaBStm5jBACdS7Z98xOOn70XhJQqqCFoCbqrWwGC2tyy+3DzssDmBa6RfaX8KSsyvqPa69nc4tAp
omFGV83fKqqAYxI0SgABnjRJBpHKNXf6dMBsVMrA8pCKO+BS2ys+HzpeT4SPzV+a//iN50kwWKYq
BN7TE/m7nKOdUmDbgf9AoZq8PFoB2rWWyEE7XujA2KaeqPoJA2KaxuGxE+JZdqGTHaGgeWC29A7O
eg66h1b4Ihw34ECQlXpjh93h6oS9qKitxNhB5x/ZO0Gsm+8CqRulzlNmJXthE3pbJ99s8MWtBBsL
DVPYtJgi4wMrUIZtl/T6+/7tF3vAGlDQEaLzUD+5frnIDHiypOprnhwGlSbFaZ5TO7MJst8jfjUE
FcsBD56tLpIPPYfBr/OSf0vVFRkTsoBx5bPellMPLy7mcFkysJPLFjKgq1XO5KLcGAj8YbRt3F5t
V5daYj9WmDEEwarYLGrHfqA+UBknZu+NGox9voGZrjXyniNixEP+4YZExqAGQlGmRLItI++yFZPg
0uPC4H6wr+m9oJaU635l36zJ0jv6kBxFoVGGJWQLxqMmvJRhvJNnKWhZlwhlx1bebwcQa0/vEPrH
iHxE8OxfzE9LZDzzLI6ljcAP1TlLtikaJekTsh47PojpACa+G1Ru1FaDjWn1gc18fAogM3MpRyeo
v2yGIUywwqyCDfqHXmyrEszIApxFS46y3DC68M3x8HIAMdsCpFC7iQwpKDRUBvK1+ORyQtldqmCL
MvgV7VJ0hb3N+Vqv+yR9jRGuEdS7a5UtcafKV4Xs4mJz+P6qoLcrKgLY2ZDf2kv3jsqh8pTxhzkx
ZtszJ182KgBQbTqHWfZlpVIIllSVYukcJWG3pLjevllkhMYG09kh9mPB/+gcyS5H24XD7L1+nI/w
kwiM5VKOoCnsMaXKoxLU8cBiu6Ex8ibub/K2fo2IV+nwmKvt3O004TlbpqMq8I23lQajNR2dHfhu
ILdq3l8rul6jvAuXhPMtW8o11eIEXtTkOY/b1p4tkoJ9U/N7pJzLj1+PaO4WdUFeI7FIAHamJrN0
YYJMTDdL/ORlVSon8YPkRpkLkFiBUyroPb5T35wLIj8PScTwwcElZ2WHn6vZGcA7zl6bmQYO6rOU
mNwbMRDktzGnv6UO76IfqcbeuQWzf89Rt1QBfYJt6thm8CuVVDXJxLEhKpSlsKfz5iXmrNhxLGyj
MDi8Xca/Cs7Ao9XNLOeG3pnAZbM2dCOn3HGIhQHUPRQefKxtAuKUMBIoUgvnxckPJlIXTJclUsNI
JIxwfBE8ddkaUTn/pVY1aZGgstaMnPaGeWUJuM8zmEdRcvsMtTB6yHUCE/gvmYPPXb2vfcu58GFP
7HJ1zWHuokmIBSwQ3cnbX5/I1jLhTc+c47zdmOdtwqouinn7ftOe6yWbpp1xfm4ZsDB83NTHUEPY
vh8DSAICPNYRgJ7KOiPQfCGVA+yzhABP1qY+vESN+A9hqbDiS4+AhSGf/Yhees3MujqiS2ElZnCm
Ofm2V0x++ZaV4xxN8bZiXZVUs4Ww80kmkJliByBoMTL2+PvNQUyTuFqCdWrdL29YEUTPpLtdZt2G
y4WtEszaGj0wOHGEOYfwlpCELfwWYiXbtGUVUshg+FAfv7NZFwEUHmJkUhZhsGFi634jPxK59Kx+
xb/CidNWX2nvwosEwy+SRvQ1TA8APWyyuKQ8QAYNUxy8JgKaKuug5E4i+a0T4aGIXpr17ZLPVeEU
CwPRYNMTRSr60EYE4/ko9lQNrbnp1vbaiK/HW+EHS0pN3TPU5Byhto4I14W2YvRhRDlqDs81WiCp
P+gA6rjI4SIP3+bSU9pdRe94O2Xt72MXt/Xe2gSX23Q+VPDF/NF5Wa0xs3Z5KjwAhSyfFSLd2TUA
endB+BGsEvowFvYL8j1rdR2NsAn++eDFsgVU0+bguG5ypkRZjsxqxjRCDKBdk3v+x8UNCcK8d7zn
b62N+ZuKjWpvpJtR+rs1NKmoxWy4tIu85K1+N88dGQItdbxwQ54X33GAFj//TInVuaGwfp5Modw3
928w/YRuaeoYavI7yoaYYhpQlU064CP1IbogBNGEz+kDoR0qg453LDXCi1at9Oca+WrRvpWGS45W
DGMC5kHb2anwxZwVZf3XIt3g2/o9p39X5tl1EO3BXr88MF1Z7REp66P/KqZq+reKRZ9YGnaOuokn
AHyrOhCzXHqkIMpnNldSBcUnvztAeB5neVq6+2qq8SpDcWBr0LBbw21kYDCzzIyt3MkWg2+Gg5M3
EELKZz4JmlwTr57Pwiw8VP08GP9/fm8hU0k0aNI7t4gmq2DI0iCRTxL4OYWxq8bNnZCShMraGr+H
EAsWmsgh0YHyirPapNGpcsGWDymq7EkFi4jgAfr0hpn0SgZCSrNL9LcSZ3ETkFXnm5PsvEL7P/FU
Q71Mres8M/VPmMp8vaK9zW0sSy5Qrqw1sJuz6e83+WY2iZs1Gyc7X/s5RxgAc5Ky0oI+cMR/5WND
8ASZN91oM95SrmJO4yQZVf7jKDdb2ZqktagxumBC33PMP2woqpKpOo4+w9aunEH63baZKR2PXC/i
7eA0ToFUedHWdtk1mgKDtI+DJ3rjVrCnI1M8Xo283rnmZ4LMgIoL7mhKcLvOVv0CVsBHZdSv4ne+
4vpu5+R2WEDL/mpE5C7t9IHfZuYtYaTPzg272jto5nChxdiy/ZfNby1t86U417j5619UBC772psS
cae7CXGJg96hSDd/7vsdNmus9uHh33K/DT8v8UpkLjAAABKRQZrsTeEP8mUwA//EXpTbrTCMMw5Y
HZ7hxD9WsBjngjeAYfny9cJyB7WsaQADw7JTlydZtX2mxVISqcaIYLMifsoUzCJFtIHx87UapKuA
Miuyekh1IPDMn+4K9sErw2Z4Jx+OxDs6gVTnSmgmms0iv8mrMeAtGKWcppQiu9YIJN3dSqjZfOCF
CW4A1KPKGZ1XmZXBU8mar3L5nmmvBSH4nc2gQqEP58/egl8IGIrFDaW/twCF0oOlUAT78cbVmFWB
dgnX6PaYBeaRt5O/WXnp3U+O7cp+M+5P1CEySUlLB8b/Mgf9NrwLy8uJgcaxKSKHI6VGgbQOGlvY
dMEK9RXEGzNgsOh6yDDPFwAhtzyKxP5kT8hR0UDC7APHEYEv08BUxmM7DgNm889Ej1Nm5hM4lBaB
2xgzt5DIIo+TanIIDRdjYxBuJDK+fJajF+yWZvVUmGuDvFjUhwRVaWpp90VkTgqN+iEra4mQUVzW
293aMYTsHGV7zGsNOc1sRxrHv/1aCaTqvhmMRN09PkS+p8vpCbxNOUD0X2c/Uq/yAPMbqDZe8S+c
BRmZET2AVYdoybIv+xzMWPG8jnPRWwqMiITY8n73+R6t3BZY6khLKycOz39Tl/RL+DpaayITzcQH
1ySWH7hpXdxyikZnn9rP5yWYzKXy/03y3f6A0maTONLlsqChFg5XXtqfz/5n3fforOlLMQYuMEXD
sQe8A2s90cgDC1qnulaHSDZ5iyQr1awj+r+QFUXxibIxFkHUqbJLYvFPN8Ql2kJq7oC9VXUOGyRJ
e7B3if+6MtORzg6gdCJ/438wPIHg4ZndrhQ2p6hwwyIKdCE5tyZCHoaX2QZxfT5iY11PdVKYxtNR
OAq+qY+ouelKVhGL8QKZkjZvq3RDL25H+1E8YWqP8kzvLojIkPvqlAEsPdxLVUX3p+KGK9R3V8YV
A9mdjUtyg7FOsRoEFSKNAD95tofbA34ZSI1nMDCHPl7ra0ZGriCqfJdYXvs0bvhweawGyFEcQVM7
mC6hSipDzo8jlgDyfUMTFeseQJQaTxykjkayvkYvG/B3+qF29O1piZ6PRM7EgrJrQqJsToW2igPV
RPOGpwsIUiy/itku+sfxf8q70a250G79+KItsTYtDqWplNBRB5mtGQ3J4hpKsAv9whijM0JelqZv
ys3GlEsUEuUdyYAeBnt0n0kwRpDtvu/gpqk5QWAs3Srh9YGAvKc6/pl1xpk1pj7RyS9XJyPmFzKD
vh9LZ/UoKjlB2hcGmhzrRWEvB+ul+4EPaXZbMxdkeK9W12utDkv5LctFtWlAwAOkXVu5gpNdZxNS
AN2IImCX1I+LOWQttLnNRUShs/AoYZQmrHyD+XtbNQhUNgQFTRu9iJDg94NDCz+Tz8/Tw4CKjY8Z
HJysrrrdL3qweC76oeFKvlFatnNOS0HYQ9ZQfXp0lzYcJHLYFBvmqeGRQAIAI+kWhsfYRGc2f66j
SGxceP99Xg+J07JizI6LUPnRrYF5oyA/3w6gjVEJirD/gGSdIC9moIq7IZZpVRQX4HkBcdrRxzA9
hJY2n9rIeUeatg99Zr7wH7spFfcsJzStQE8b30y4t2KZkASpceVv9yyBw1xLyPLCX3JxPEgmQ2BB
22ZJ3mayhsqLweQSggWvFLSKgZhEyrBsa1wa72Y/n/3mxnKZvphr+IFP8hDos2jApkY+PTi2kbTs
HH22E9jZmKYUXyG0W47iITCGfwEcFIzdlgO08D3AutTEz3q89PsaVLNcCW410aIFop2/qdWG/mNf
45tPJ4Hk06xrIcitTIRf61/Xj8z05STqdlO4uA4+f/gXsvv7Erduyn7S2refZJDXjca9joDdJQKd
BYNHs1wMyh9pN2jdQBTQh74UpvK3eXzK3SE406A23/F/Hg6h+p00p/otqDuly4Gstfmznv79VfFR
zzS0FODf8y9NXbqiD+khQE6E33X+5Yl/MJ+lL1XG8l9U3SoJnaukdt+BCihcP0d/PyMa2tZlU2Ps
I959hg48A704ojT0IAfDUTBZFwkoSjNsYXxzspiLQMrdv5aqAOlhJBYeLkjzGeU2oUaRI2/xW4iI
0WYRt3mV+TlLfknB1Se2b6pRwBDfL2AraNlACn6kIsqgHtD3R/wuYFws3wFz+qj1Z/hykXMLbtRp
C4WFykP5BKqnWHf4YUk8WrDuxV4+1pvLFXlygTqpJRY8dQ4ha4ZllHL9NXPSO8ZBTeDBNZonLiU/
osrROXu1NwjufrfOKj22wQlFoXgPByItGSIhMFvtjzNcthsDDYp8zbr6i0ra5BM9dtgLahOlo5/V
1c1vXXpfw+JALZ40LjBw3oDqvPjWyKPFtMJq2R2C2ZDR81XnWczc+nmck1GsuM3tX4N4S+k3vSIH
FA1b7ph44C/leyakVPZ/0YmkmwUway8A/P03EK9/XTfGs3Tx7Q6XCTLLND2N/qxnEn7cx6J3EyCT
Dn7fIa2DVkJRjpL2X/BrC81ch0nmhLHK32YdhQ9W86wGbAE+kFVFqNrTwTqcnjcor/Zgo/uzun/o
2aSrHgAXQEPSUl+IRFOdCYMlo0g6cMOxcXcDMG67yfou7jnEvI0KULtxtISdgzJkQz3IasZxF07R
lxWrBLcLzEBTGWufwMSpCDaMJTURgKlLdPhIxJpjzq5y0OOzxf+s1QfIXmFNTk3UabC9CSYRZ5Cn
o1FECxWj6oXByT7BGMYCT6G5BIo2WBhJWlAsw7s8EeJeTTA+z726hruX5XvD7JA1fCKNoCmTiMNf
2BtvlEytAJGcwhs1EEE/o9pH1WQMH2o+jOMZBvogsGtg38niUwHrXadV6l8WtW+s53VmIULWfGCP
+EGpYI9dQKmRKmEe0NqhhlVQKyXY4NHpg4oZhCjGmCXUyqLITAur+FikSSbA0+Hw5WBnglqXMhH8
QOFiB8TEIJKLErl0LSKvE2bjhRnf8o2uUYy4aLC3lxBBm7yNFbFUFGAfzhwjm0XYmi8YXoBCkndq
JCSW6YCtiZRqoJ/miD6hNcqFegOPpOt2+VreYI5rV5yC/k4A6lpkT4NPGqKraJQJFNW1aLEZ8F9M
omUgs6HEdTDVkGVloyMuUQ6PXFX28WSEBpMmCaWpL/JFRX59ulUHW5+wtsHJCpgl7TC6KFiwm6+p
1LlJ1Krp8B2fKRctIYlrKJtgA16H9AJ39Uc263wh/7/j3gnoMaHZcPu+nY5bG/QapdhTavQ8hZLU
0yCX6Ri0s+0Yqia2qmYvy3TjB3xi/7a9mjGMRdMjYR2vMhqiYDn28z5zuozysCrjwcAlA9Bm7C25
wAS/HSoV7VWfTCaWaMe/ni58ucrkuElZrmkJUKDlEr6TjZ5Bid9aRAIMpU3nEqaw/V7tZfmvEBW1
UskcdrbPVGNRvtL2Av+K4Bpsv+0xTE6Kq8Z8pyXqDSXoP75mNDdVxLruCnyP9AIoKn95TEEgbRbz
E3vAfVUWd53vInHIaSdHbjExp2VHR8nWgZLSy01zSy7lfhAZc/P7f5WhHq4TP6KawADDsaeEcTa1
1hVbMu+I0xYYxWjI5PUil6qHlg/vmB2wR8SKuI7m3tcdy9hIewr1hTMlpkGkAiGrx6sWhiThXUb/
1NPcwOLzYTW6XI9srkLYA1zkrVqu26s2v40VRiXkOPiQP9yoMQUVGtKHvaFlpBgx9m7dLi1tFwU4
xMTtD2VnlJeQuDmEvDz44aqjVfme5mqlYbkvjLkiPHE/g53C8pjtvxWGZcpGaBg6hRZYVUntl+XK
5dWwu345RCCKtmNWuPEZkBXi3OA0IxXhrag/06RrmFa/DN16LAHcwG7WvBvTXKIvSieqXSGcLgLi
YZgCswWJftyvPQXrfT0E9CCEEUBBzIM6CI0zpGPrSPthWiIW/NIsbEJfFva7ln3P5eGSx7OKCyU3
4Qz/08OjPY4twZG5uwZ1nbgr/HGPnrux2EFlB4j1JpDf333+te2fncTf5NznCZZqaA3psIH9CDMT
GryMl5bRG3atqTF0pjbRVLRODy2TY4qwp75yBgjduP8UgBSQBS82VvBne1mILPw+qhCbtBV4MSyf
dOL3y5ZqwIuVQpOZ7WNCTtacCwSB1JtxxC61ZZTn/sEMw/7mInHKe+WJnH8bCca6qdUkike9kEei
HMLS9Behls1hyteZgkkJ8GyCy2gF183OvT86QdIC6Cjr4i1AV0zbSJ5SpS1BpT6wAxVFnVkQI/FD
/OIK8TZhOfei6+YUbiFmsvVnaOjifFSYz9w4bKOjhUgkXVu3pVuq3UL6lSk4tua8MPaEcrkwlwtv
jniUke3dH9Q4m5/u2sWPpAEQs0YLw3GfKdCNL7i2RAlhbxKlaGkoN4ptMlorxZkzA1BxQZqMkLTp
QyEvTU13b/ViOerSjNfmkMwfNsSozVxiqkquRUtXKbumnkq0WbCqJbOKCba2AYkXEfFsbo6F8Hbr
euAPO/aPDFzAEMfsJW14S++lJoSWl3MazA/khlTaoudGuk8YRw36MtBnOLY4FGcLuWCjCGd8wlvf
DfsunbrH8otE1ThyGRGuT8yitOCgYMDIMR8P98uH+IARjssMQPvCuQ2Af9/SGfTX2NnEQAfqMhPH
pZEWxX5UKXdgfGaRJrQk4qdsL3oDaRhgFZ7rjQiWKOCC3nvtsofEUPpMP10kQ6k/KBgzMdWUQPig
A+1iuPSbhtqVSD5tIu7nyhof76g9FKlNXeDKXwsTEJEhQYwSxBRZIWCIP+CjwH6GBo3TQRN3RuTo
WwRzX8Jj8e+fMzhiIBvPfgsGW1Tn47VttEjkNhnfqnk7g89K+nmyoP+ZHguG9Q9GYnoVqjmjRl82
kbwJitQGsUI7Du/sfMe3pOBGxCgWrqk+LbXW/HzNKm9nK3d+MFxuzXYjdQWRpokMwsIqVxUY24k/
vdgCl1F0fqsaH4IcMLIKY+dziU9lTKTBQggYduQ1EByymid2qA/Ostp2bJcdaXW4Kx9Y5gPuee9U
EEifYcc6RS0PrjYfa+zSbcsl091jZqB3RDGoRoUPTx+Z77VQNKKDhfche0K9fOwe8qOg1y0gc1uN
jYKNKE5YvpUHp/PKivN+e+uPjUsPmlHW/0ptmJnLF9VdjbdIvMoSdGwDFMNAmJigORvQ0bm3ds68
mLKV0cEh7mODC83qCNqn3yCWEYlvGk68AlyQ/vizhjmksuJcn/1spnloDUAAcaOW28xAvzy/TqKf
EgXWWwxnQ3xwd+ZvVBZw79uE2aN8DdZzS4XQpzCKVaUbPEkiQxeK8Pfk/9WLyuVamkqmAEe4o0Yg
HIkTd4YZZJ3/PKfHkaH0ImSJ0mZE3IT2iObv9bCSEJxHrF7lekndCuR8EudXt1d+fYKUuK8h5D/e
PnGDBDVkKHFDp+WzmV8giwYn0uueZjMvsEXxVUZQMKAcUJPo6B90KimSVrI9fTnQVQ6jJ9bFZ/s2
8tt5Cu/esnovVjeUyGf4I0ntEnEnzvMFe/2rXPATT5zX0Ox0KYpY0eHLzATOGbiF1rj2tqQ1Ul5f
X0844NMzKY6krvfywCVNcWMLj+QhWUrSeDo7P3YsIcgOWv7d9JnJWzfYDYG7pTMisNTBeuJUefcp
gFJfJU4Kp9OjoFGrddBoVpjxRQUrni6YYwWUYUVRPOCFLxoZ0U1vkuu4cfVZRoGLqOfX2U5QFr2n
e+7emkngCknFb994sghIC43XZXQw7xGj21fr2UpVSl76kjz3bue88pzH4mW4pu2zsOk88qJrJnJ+
oLhfqV2Qq8PkALR+HH6ioYNuc/ToGA0dCe7xLeFVpKeDE8LvznGFuv3ZDCInlq/XQS7vagMENiMr
AYi18AhjQSRGYMXW1BJAsuwbOuVjUVO8rT+gPuNsah061VyNx/+Ckya8KmyhsVEwdaYprDm1W9/O
WhmfLAUeJ7O7BxP7Uji0y139aXhn+JUM+VXPLfbfJhYbjS9rNTeo+MJSiAggs+2ymWCW2Nuiq6Gb
svqEDb3mQ3zKLq41+kPy1LsVDZ3iHadMczfRRJhDW9VzYK+jNPIWM7yvtRi3wShW3eixOzGUBhoq
+cCYbcCHHPTPTlHzQgaUHXEC8C7M1Qz4tgn0qQDby65C7DIKWhSGpSTp9CxNmfnKlT8kpxMP52pi
e4G/CZR9jZlvD4qgUFYFivvPxIFSXYc48QWwwje14b9W55djebjmvuovzfnYuBPNEXlhd93BPIvs
eWaJL492nzGnLRpUmWkPGImG0duhyGqEOrF8lX7ZTii3tLWGFAo4OkG7P5xmYBJE+gfXnqAQ559J
qWde1jG1BhUBR9RXIuNcmp/1ks5R5kZP6BJyJQOAihwTozAM8WXYiqnjlIhr2PP5zEN7qVgoH0Iw
IAAADIpBmw1N4Q/yZTAD/5s537/n0kvrKfkm7Cx6kGOYc6MevajKu7iph9QGWIGbXvHZHSQCKyl/
B21An/6o8S7p7su7M8mhzsyl4UmJssr1dj+Lpyjo2t7k2yLr/KUdbVDqz1LyRxA1hBGIqQicD721
za3mrxrD9dhlsb8uhffeF5Jk3M/2Ju3jb4/R1sryaVZ8xVtEGeC48/zZy/Z6RfE8GATO0yGheput
bvxwCygsaPrqeRWHtQ1mqH2Fss3IGpN/5beM8q1rE+ziAXk4wT2TbzcoKL+99hYqiZ0bCeLwkrgs
E5cHiF6uevddCxg9/aufZt34EMFkoBHsb1WNOT+gETGzesv27VnJ1E4ZC8Ua+vOiz9JnYifBszgr
i0Tu8K0NqU3jZ/athXdp1mHlQHKCJ22axcUyygV2GApUuqWBlQ+c7NRfDqDxQL6ILlLe68sLdJp9
go6ZU7MGlOG22NtfMImI0E6rmiGze9LqaKwjdSi4XxJKY400SNHUusEGfdT+Mzy4ARgSPe67YudA
P+NDbLj4TJh+s0huLHQS0vyMZu2Ymlsc8QqVoK2jcwtD/KTF7oS5JhTm3cJsqILdDzbAtMrBmrFt
Go9DzpQLV9soklGRfvcX9iO9hA4k6u9z1mumvKet8PwdMsgZIap1E0PlQO1taiDKViElxRotbWBM
DB5Yrv4xXzum5kOpAKAhBw1QhyyNj0G/5naJCoOeND96IkcXFo6+rXyG3U+ampi84YPugJRKIm1v
Ruso5Ml9Y+uDHzs7YJzO43XeP2Dct8bPKjpnaB7wjr/EN8g4Ve73oVIsuE/gOFlY6BOCZumgmYXC
cRk+mzSvLEgntAC5hhI1io3wMrJwowid9KQfHmj5U2vMbD5DY+UFczJEeQcq4jiORUAlvUSd32C8
jwzR4uWpaiHx1/AaKfQnxRoeM3mVeFonWNhvHa1+o17sE9FOFrozxrzeizB7R3bZeFLDF+dd8Fpp
TNrfq0V5TXWj4NM86pMeXku2sCzim4Q3VUtJ4HNu5wi5aG/85r6+kRz2k4308wmzN70qE/I5R4xb
0+XkXYXnv7UAk+8mecorayAANsJzEji09ArZqqs6AdfV6kp6j0cCKSEISOyYCWT8CttluUN5wKgj
tRHgAZ7dcj3T+zrVWoOOZE5MNB3pz8THu8Va3KJDFpgj5hi/Fh3PWhNNBQf8Bmr7ViEutEVI4Lw7
xdI4Tdi4ryyVy7t6OG/2Rt0YAI8n0tbP7AKeSDfZVnQCvjXm0r0MsoD73oJiZh1kdlUDRRpHSFnU
RiYZAfuUlTzMrgJHqxXMqHuHqJImIXZ1/5ovZc70JXwS2P3cT2I2qzL8h5u+YZsrRVp0WSYe2q4C
JIclk6UmUBPAJYRz7+aVoSpEMLFa0awjLFHI8ecPHiHtslkAojxntyPC8i7lKI+AU3cZXi/9LJdU
eW2AHR1D60/BOAkDmhUKX6eF729eqoEMM/2qEhZKEXl/9AVDKTW+v80/4wv1gokNoFqwoMx+yTZc
8GOLW5RrBKw0z4iIHtY7TipCYI17qr9WWgRT0Y57HCr34TS15p1CDeiSV+rtOV7S5zbI8NC1WLfu
PtiP9l4o5KRsnUg9PoGfyuKcbWFOQQBYb6vP4I9fHUmgDN55wHOynQVRU9IvHo01S4xXBaQWwiev
yV3wEKDJDFMiwmOseoCSsmRv2xuyW6dPD79RlIrTIEaVFo2xQTUUFJzm3t3zt2KFypGDGXxmYSyJ
Cj6a3Ia6nJczoeAZTY3NTTGRkY9PsSbDbwzW8AVtd6KTtDL0nf93+DgR7VfiVGh3eH1NtW+1Y9k2
WYpgbD+PmAQYpBb/UZqAcC+CM5SV4ZvTDTvlmxr40TZkjZ7ROZLyGvfnwSUY5JuWr4aBzlgjYC62
ug6ZQ+FMumpiPUXKU/nubTpDc0ejelP2pMJKZ99oBSgFDXADemEAhqtZf3jgR28FZaZN12+EMMCG
+g6NiU7OHbGqgt5+ZXWIZzSkvksqzdN5wZ2ZraVGrshVnJxG7eMlXfFQ7M2QV964vvD4uqAuRGtd
L+Fj9os2ETbBJ1297bC+uv705cLWW7eEUh2FMqJ21K59Zw6lqrtZYf0aKKCElVQ8DFwpiudG2aIq
4kp1Q3HNKE5bF12QvkNvz50Ku9ETd5rvQWi+dDTb/8dvlnzpN08C9RBlnnHPbtEL8pHNppQy2B1a
A1xWda3Ye9anztHWc/EOHIM2GdnvSSIb+3V9M/7wbqh3amD5xTdguKWSrTOTkTA9l3NLBdIiH8n/
xksRhwkXw/iueBJPvbOyaD0ZgC7awp0N1YRisl1gV6AD9V111uLCBDzEywZ33vDkuFmK8vXtGaVK
cmxnOufOMLHLcJwi/4iCPYiFOoInJXnEMB/Naev5/9dtQrxvgDyEzS9tkgOmndoKVXIqEsF7jEWk
qj6lbULRldjkErbtJREetSz5XVG1/lVUDK8YEwCjnRQBoOXrOVMtPhkJifQuLEk106JxrTtnlV5L
F/1dKa3T3nFmPKmtHrXS72PsGJ7C5t4g8jpLQ/i/B7uZ6xuIa+jN2bTybvCrPqd7XQgky4rI6SWo
BGS0+QueZo/GFEVY5bJ59mcF9kBaVuf1RF5TbLPJCExDVtrpnK2xh1uhqEROe3DDJCR6nUzFjuY6
EhLekdkPHVfFyHvMK/XWBZfwS2c3V7UHdwHdEDx1l+NUOgDAvfhfNpRGk+/mcjqcYlxFUyzq6s3X
ZyZUM6sH0o8XwAJWFAaKQwaLiNT2FFwM5wV7yVZn7otY/wlNMtEi4xvgrV7e65W+b2FbJTrtPVmL
P8WmzqrA0v29CTpEZr8Uh18I+z+tMgaclrWlzrEq6GriGExhJ4TTaxtXMkrrCnsYfy03daIt/5rf
lAubq4v1vLwKA+0FcO0h55LiDICn5MOVSZynUWOMBWjzHALRhsZbLDbxxTcpGOhfgwRajvPykFis
zt+aih57DXxXakPUYjDyTFiCxys5/Ao0ZGteYesPLvOOlF3q2gjYUynzjNOTK51E64cRMaFujJxe
eoF3xQuqf0RN7AvECr95JPscXc74gKmLMMNBtUL9NxAdYIq7kHtor3nFLEO2f+kdQbdr8JDcnEMX
7q+ykI5hnbZjCHJ3FnV7CWpYfRa2ujI8PD7DgawY9aTki2+CTh++l+QhbwNu4/i7nom2cYOI5tyJ
trmBZNX95ekw55L3kl6T8PSUcFIuip8lCtSiHGDQHT67oa0YGrnTN5qQokq9kCKBKg0/d8JOtakN
EN/Pjn32D3vEc6Jfqh0aG/pW9g/DL9JBFBDFytoZHiqRvEvp1avD2xAtH0sVYCowW4xNkhMLNiRm
ASOPpPeeGvQBflLxuO21DKQSWnGFktVeXxosxppJsUUErA5PKKUdwcnNnk2nBfv1R5MNIkVLWchI
qcw6TUcBmytP+makB7jVZN3km8pVFaQdGLAa4js1ZNBu1bQurtlx4zcMwmi+QFNejRVdKChQhtZE
8mooN2ctycjrxfomA94f1YbfR5FnWUHZ7ypDUWSocrkV6IfOPpSfmK2aEpqkZ9mDdU4sRdTL+iIx
JQqf7OpLw3PD2YGrzM31NF1fsUUSkpJGPrVsCh59QApGxpHFGR7Id7nivtTGDCAPcErv1d7LtEXu
JRlcaA0boJ30sNfjFgtvJX9t6SNKEWtnzf1smELgA6OZpkRv2rMK2oTflUBvUOUR6bRGAhT7cm7J
bbI1EBMYBZpIh3lq1iFhpMEf386xyL6Ap2iF3ioQblgf5d8hPkvX4jMfxKO3fYbD9uFO3aX2OWox
x9yDlC62ZkGxZGS/yU/Cs1d+YydCBFnPM9DXl6VoEI4zuIuyMZ8duTNwsJ41MNQXghZAZDySMsjG
aEm2fQ/h3irjqi2xX8Ni+ZNmWR3GNZ2N6tZYo6mrId7+NWitXP4IGVULJMJhZdaS/uX4OICYTtLh
lGA+eTW2DsfmOu0jyG2pCnnLiGmdJxBZGH0GxTi4+O8PnMN6dAc7gDkd10eOEyXfXWjrZbP6SD/U
FmLG1lYaj0rUrE0STZR1ezzVuPLmiUihxTkJZelWAlk3JFSpHrzzkOFA7Eu4be0QfqCcmLhxdH9Z
cFZRLPC2lcOqn6IB9lUPDHF1nvECDvu4Siq8aCTn6cdnYH6HPEc0uvFNhKkrzSX0v2xhY1PrFki0
HOW5ZSy2YuE+WibP8JYNmAGnDRba1hcLjYqiW4gCqa1A4wXpywjdJDDLgG4kG7TebqwCptKld4Ho
s1ByRp8Q/salEIRUfkOOs0zI/CxxbxkAAAVzQZsuTeEP8mUwAr/BGJltb/MSb6uXXTGwSSB/C7wg
iNfnnIfV10MF0YNkh1ZbvHq/KVdKAObTMMHC8RfnVu5WPCBXur5qXLyK7jI8f1oMTUo5iLePb2Z4
lJ1Omp+wGOoSqQg1CSC2c6lUlc+XkS0rXyeNZHilrHZIHLPmKD/PXh15DCgoUqPgZBxy5//HO7r3
LCgL80rStGnE2luVyjSZN83z0JaVnznkSQqbeMDdD4lt6weEHBBHZub7jNYgKnGfntTnSnYMYMh2
VST09Snw66PtMTv08llGpYoviBgkPDvSMbqkQI5ZT4+x5U1y3D6yTsoF0d2oYINd4C4CGE+awk7v
+rR2jn2Ix3oCxiBGD7mz+lcOekgU6CSo7mmVhr1eQvVmS7i5Ry+C3wME9Z1U9NWk3p5jtYa/TuhU
AgzqnTReELg+md/bIFe5OXDDxT6e5uSMb4Xb9oOOcWRIkcMWlmkCWXnO9LGMWQIzxBmuUNK18EHH
TzSPYN20hc4KKRTtI50ZUs9Ed4xnqlpqInu2eBSJvj40pYD8yCH5RLvCCgjhYq1Igd024piKO+4n
5ob6YoNCHbzeceuZwPZ8dYglYH+ve6e1uRBzsu2zIIX2ud1gVKfVy3h5wedO159SAMvc8hOq78sS
YelBIbea0pWIVzq6e7EZ5jr4ic/V/GggK1Gui/g0kS1q+Ga1z2eLp71PFKDy6wqfGsmFQCekwI0p
C/bW2LyVqh48rrO4wEkAVPR3+P7ql3v1yO+1YLPwHowHSAFPxBBnoeRqEKo5HKpsxEfwp9qlcrPV
VLaSnKl0KbTibhFCYi8mpGRe274FWNL/hp5cE2aSTIIxMkPFy37Q6tJ6vc92DxmgsDBqmPWFnGjG
GqMOC55OXZRYJQv8eA7p2UbPhEBFE+t9g9VDuIMAerbnf5prmDf5VFZXGIZCJ9iblH3Gxn6UleOZ
auN2giLmLhWLaD50A2Y4jB2CP0NzRYHF/MLVH3+RrzvUs4qN1abFVBxanJbphzaTx0SBmp9TnWe1
XacR/KLREwTOhP8ukoPSWaR+pYP5ZSYPMDZF/3KFnn44mNn5zcrigOOykVcsZO/Z2IkAbK6MjgmB
4jc38oFTVqmtNowk4vImzh4t9dgFWAv4Ze9oJhrgXslHU3vryyztITivBlJeKxl4txahOMHUKPWe
YswY30bFlsw4XTlsZny/zWtTXD5RoqfVSCak8X19cKddiVSqxPx626DIoNGWWYFfOnSJiYkL19Ml
MiVVczuTZcHrB2RYymqO1cVHnDpKXQtZkq1qOGSpm1mNsXaCiZt3YFvb37qUkIsaapeuBkqWQvN6
giamav/5SpjIPcBE/Rj43SyY6xxGkbUkDV2icXKBirMnz2i9DIL6SLnUBpZbcQ7RgghRWjSRX52j
5pSv1uqo+CZhsXH82kFqG828WCQS10n3olPL6iLjwhYmXMjjRwxyfZ0X7REi/i0aulEJWG9+q1pA
9Th2TF2OmChTNFvPNSKPLvKzJmOiStM6CPaHITcqb1PegtOKAW/JL+Lf1mWQ1QhFBtQTABdfrRod
YamWRGws6Mw3SmXYNO62uYrgXI6CHYmw2IMmMRKebx2Eo5D4RSN8i6uVVXUcU+b3AGe1BOyOiJro
Jh/YGbK+AgUvTGV5OjWyFFAwWmabPI2WxIaWd2ictCv7naai9TiyPs2hbM9M8vQJlOgh9rogNZBA
o2lAEOtJOucZ+B9p/tYiUE6eeM0Edp8XRuaDjJsV4KJzAB2QPe2as+RhXu2H2fJjzJlqyO4+RrUO
/UEzDFY72l5JgqKBDst/GvThTIpgUNBuekTVJ12+0/G/CJSqiCsuGlxuzZqKbDVIZmnq8EVBAAAJ
40GbT03hD/JlMAJPE8I4tG7dGtD5oAg+GphcOEf40k5VndLnNCAAOeCJFXV7MZwo0+AqtFugu7Xo
rvSE2ZeHWt8RrDMfDcHqjoEXlP6YVqzRdP+mC0nqIrvmg403zeA5j5yZTDWsECyS/STnfA0gSH3K
NC/bnMW5ov/fVdiihlJGDuLnQOo5Zim8vdfxyk2fg4BYqTu9TM7Ed5b0FQgZ58WNCjUl5hocNC7Y
Z7izwE8cwF8f+b5Pm5tNXnpqjw0dxiy9wTcELm/5goAsZFzPZlMaAYKBYET1sIgiF9umsozzxg15
zQqowU5YW/3RJwOAB4fDi/5ygZobKkXsqUz+YxSsU6Vx9o74v1v5VQln20Ikm/NIEC/BB92/I5H6
MA/mfeqaadFf2CFZQEJYuhOQxVXOn5WBKgAF9Zw1BlECnk7PhPoXCUBjS974K1eyBhrI4zduc/GG
VMyysvsLt+lJmM5O3//0sqygI7nbqBP+IJdghAUoUC/sgU8/29JkAiJ/qLTEuQEtSispSZFidbKH
4qpxKs02kRi3ck+8Z77ZS9hCIGIDdNslvA6yKu0Zfr589aQLuo4GmjDJuNKPf/rXpdPPnHYLF1Fj
t9oEPPiMRZ2lw0oT9oUcZ38NUmX6TMIAiKd29AhkLQGrqoXBTv4KwweyZXF7of3d0G4zWW4h5vPA
pUX0UAa1FpTPoJBO+Qmr/nQR+nAql05cSZNPNY+lCsMm56C010nBbGu2JYdBO/jaiiXnMHU2Cenf
bFp+zTnGu4WD7Wi5dmkXU9BH8/bDTo+WxiY+Md6rkE0DRobaVD70o7iDbwBHzES04eZBuKbOulcV
vOyi3sWkgw1jI95InBl4TtbEv7xgsDTpft1hi/a8lhsAxS4nlANg8U3V4M7nMhCjTBvyL0uqpamj
Ydgzh0gzSH1Uhq8fxuMvF1cjSc9wNFE27ALgANE3k1tXF6SiZbMA57AgFstPKnm3R0oGLmc3VtQY
0Lf2izfJzSc2BEe3MkvMAgwEq9xm7Jrxk2FYWSPN0MgtKWFwN9VW5YsbbGIulHUUC6xCLqIGd2/h
1DWRxz+ZMnM9RfUhxwCG0FKHbC5cP0IEim59yV/0CuckITjoNbQeBEwj6uoJcSTrawOd98mbWAQu
cU4XmutHalbeo0Azrd0NJT0Q4T/b7+ajtQor70p9pxmq1TPxQWFrbuOH4Zm+WUZdDeOp2mKZzG0X
fd+4mNHNpniYJVbnI8jNVTIknceeowwM9GUyUzDijP+NgttHIKFtw2BlDD6XVvanBgSTOW2P/fb1
s7+v5KF99+ptZtE2mAGF07n7WejH/acIzbIwaAxeze0cxnvk1XyYqiRwQUA2cNVG9YJCaf4IPee4
f2IrnfOA1ZEAPIgTfgIYlnDweY8uVvG8XkE+GNSGqGRCWwigAa0xoN8R1Wpd6k8LlaR146GYiyQe
RhEhhYSap92S+iyKXJZXhOntU6goZI+RmlCSrnjOx2NubfJfiEb21WY0AXD5VmcwK5+Fa+l2y8M5
EdqcNHIbdARUo8t6YH0BJDsvgaTwhJTWC+QCIYmsI/uqGx36Vkr/JTDgdtHy/na5vyvSK/A6MeMD
f1Kx2klnzBrOn7apW+Bt9d2PTFrHy2bFTLCZ2B203YXN45SckC3hBrKb/B8Wh++eVhYkIhm+X/l3
582n1CnBFdxTjDElL/VfEJazM5WHteLQ5mXL5o2UjEbe5ntPVBsch7l12giZkgF4PJeiO8fIPqUL
cZKSing8RXYTlpz7OZj+NqwWcYj2r8PxP7y+VHCAsu7A+9vqHoiGOWyMGN93RZPTOGyQrVdIdGww
3kL3HoqcbnymlDDk4TVpAbAO1vojA7M+9nN+vtCVKc+Umt9nRjHQPF2wxmfDYWA4n03G3RMX9pgq
CIpYNmSEHfxFFiUWPK5hQw2/LK7ho0NOcOgvnbM3YqcrvsfJ7gDZj4+RvdJTpqs4O4nehOkQHyHO
JO2AGF54ByK0tM9OyZk86YsSNievke8FNAROZjVKLxSj8kZvhCWTSY1TgGpd1G3HYCWw7BweefP6
t2/w3f+G89zIuPAqo9Ou1hzoRbuMZO81V+VFKWZEcsBEeg3Nys2l9WbMosBOuLKPxBdCOGlluKDO
jN0xs8YPTsFV1FA0MeujRDim6unV88yUuPTkPR6t1zVwPMhv6J0gUn60+4wpCy17Qe4SXVXshZHo
I1ZrUY4/qzF/d5W1zGBMJWJhWuxfBzXL5zH19o5o4e7XspSSKu7MyGGt1ZBdhR5Xb2y/1YvaVbAW
iO03fk/9dHrPcVGEnLPbQIcqbPdAlBDIGGjsI04VbIUFqtpAiYJDyxhsdXQCycaPL0tpeGGvj51e
LNHjW1E/NY48HtPq0RbTALcdXQmtH0icIFHLVdyYFKbbyMHpATzURZHx9AIDUshnHS7b6f64Zftr
y0ir83h7wqJnq1i5QlNb2dipW/vbQ+RJ9DVt93O0jJI++vUP6PXkcKj3R1SaSH5/7pog1WbqUKCw
eysLb6etTyy2JyjUhgYiLokxqSHbP/lel77Sjn55f3mK+88yawM0GXEzLcRuFGfQ82oh53cjiuSK
gT6/caGq1coSYjWU4KxWNt7cb7T20b8rrNoGeoyYPpb4HQCZbExBpb7F1tHOcl0AOeQIUaP09a76
KAEcSJ048qLwoJKQ/JdBF+EwPv/xMdMwH1GTR4FeZUjJuPNV0Znf21LdANlwh69lOPXsB4L4Xgm+
IEyfSIe102pbRMFC9fZHe9Bw6o16tldX2S8F2QAXLvMnYa0DsZIgr1HHxYN2le+SiTtmHgQC/X+L
yOiI8kOiX6IHvSBeUMwVEv9uPdulgJVvkj4N71l+b8fX78uQfWZjF0P8qCpjRGAcH0zX0/7iQUHR
2/ApBfdqXZmd5D/NkBO68NrIQLGauO8+sCH3oiLAIZYprhNG/BMcnmNu10h74vKpRIiCkkZAFIeN
Z9aBO6oCnH+igpHQBDY2r+A+9WNgv0gO0bz9iLN/WhmpR/6M4F5/HRlpbDmyZTRAcoWj6P1plNYQ
7m+/b6fDY1VDx5ddELi3wIPTP0MycreHK5Ou5V12MNAnuIN9hewQsiv33YVP1fWbUBPHgiWL7ULT
kgjUqLtC1qhrADGGsL1E8muQkqyH+kdlrSMghzDM2IDrfCWuhLQS9dHdJWArtGFqHZnE3tOtdtoC
OQKmxtaCW1Y04TTGE3EcC5rDsE75MEdMx8MfUAR+FHp3MHi4QsaLoDUIY0gor6Q51t+hfizK+UOV
8B4k2UCV9WDSjGnB9tMiMjCZTu62plGIAYbHRM/JdPFu/NzxOQ8FrMfqxA9Q0WWWHbOMCsDXfjZI
5DGN6u8ry/+j+jC8a9Qpzl8a/DsXkpJ/AAAKREGbcE3hD/JlMAJvKTOtR6tKLwaX0X2tGSp5T3XD
hRqm6MyPSkfCO7GwrMfiUXAMGL2fwGDHUvsFDcgSL+ii0qVg0nPqengzgeF2mQfUvzhoBWHePJN4
vAelpv+h5Y9E4zfk3E6ftLiGXPVahcrRPYDILhXMVUoE3fMDHr/+sDLmx3cRf4IQvpCB9rhiK8aB
0aYfDYqAk9aBObCEivJ/qowD2S93YRuTUjbfsBuIhZ3RMMnzvjZCWBqZVThs7uIpi+DQS3yh6ihD
M3kU8WIYe4HHW/bqu2osUPI1EF2dF2erVESqZMaLQL7t1NHwSQ2LtNW89JYQmo2ECdX/R/XE/W2x
tDzCOphhxrVYfSAIekmU1MsG1BHiudqKh4ulAmIl3bT8hz6m3i8I++S7mJGGMHkKQ8U6JZ99BQaQ
vVQPHKEY6XAwxYTxeOQe7Kvil+lD02IdUXa7yHaUffwxrnaq+O4orY3bZ3q9mQbF/8Cu9cPWpUe0
LV9of/mbxLLYKK+DCzgx1NvRTfuJPpmqk1yCMMc3uCHmL1cpnKe3BVmtgXrRIoSKae/OEuAqaztv
V8pkQ40I5KHI0/7Io+OyNofwXEZPY6d89d4lGKB614kMaLfbpenPj88oYJWm7rYQmnA7tQBTy9si
DAajfRclFFLduD8Thi8IQTq2T5mRDTDzzmCA0jMY9XLlQvIat+whDfzgggvZxbkXwxJbNoVa0VAa
5mPgbemKrtB4Gh2HQVsrVhh7dtHj67x5tFyDHmyvL8m/95J4yZl3p8Edg5zKIsB2FdDWOPhY9p0+
hhTK1Zr4gttPEtPeCzJNZ7Cnkix5LuMxg6/YKVgubQrZ67+YvK/mVUKKQ+swCz0smbI9u/M7a3v7
RSvGoc4NEegkLUXYlyShLasN0TaZzAGtZFYRXFRSYnHN+GjgJ6gGr31j62opqqtFsFKFNkvty4OR
vR6B/uKE++7ZaGByDZlCozgjSIcGj2+soDVVzzOK/jNsi1B3Ym1FsInwh3FfQSrbpOzyHOmhRaXc
hwLv9OrW9BZY/Y43kRkbX/np7aGGatDZ6I/Icpxzkx40a5kVLUv+djsOefYwglBj0CSOMxo2adrx
S4wJ35kUh21zl7/u0nmo8uyqteemKAlm7QwzxtT2luOZMqpX6wUura06rqOhSoWUzoMcpnmKQ+IU
VV7pP4XCWFFugR43PZBsnfE83WegRr6+HatSA4LXoxfXOly9zS163I1JRQADshSl5XEEYzboQIpC
0/MufBwIeiHqyzWKKHQIgOnvuDB84pN1KxRieDVSmnGa1I4mQVxF7NhXYwEDlCsAx8E2ur1Sr7dz
fa/U3Wp5/0a1j+UwR4+FFY7r4P/uDaT/KlBazRVqyw/G7WJrkky7bsdvgfxKseVZ3rnB8ujgO2cU
64fU+vbUUOxD7opjjdIZOIKSuE0sBRxMjC+ijixnj3+Ibj1uguFEXLOyGBU5m3B0SoAG89FGTGkF
Y7t0WsD3hXSPFqSczxsbsDq625kDKJHy15XwnhUCdhVM+Iy2As+pDlTduoeB3GB2c+923/sPz1Gw
tb5DVezwN/jLXY6r4dNTTy4h01NIC2vMnT+sp3kIFOw6+0fV37QA6Trucoi8xq0ICqmqtbz8bX4T
7SJyU2qIELqlAKwx8RYP0vyadU6UO6ox0kiz+qKmtQu2VFXkOG9VmYf2HHNRg241ptkOX6K3QXnn
F+Bc/vPsRglOnyUbVGJJD5oM15hTM3HfbljSVSpgIdnsi/H26vr0RthQsOvjpooR6ACcplwRgwmy
9sSbRJpUc7nM8+2lJ718EYzPPpai/BSdaAI/0EehN5/pxUBwY81kG7/jdWJ0DHLEEiPk/rywZLTr
HDol+i6H7kPVMW+fL9H7CivOhobYLpUiY+D6NIuI22IyoUhHPIErsuDnRKfhVuJzsKY3XuFrIRXk
v2Hp4raQx5fWKyftMIVasTPqAq6k9A8KHJAlW7UjUCMst13VqP/IWW/75dXK+2YxDPvRw3PtFO2a
SDVNbiYTqGyCXaAY8NaesHDw7L467WFz5iAxlg5r7mslW06Z8POtRxCiTXTzHM20NjWc2XboC57O
2z2USvq4rOPB+B3R8e10qZUEKhuHqfY0QQKeQ1GaffjExXVHmgjkSTg61o0R/gDBybaRR84wyu7v
OclY1tq20gOwGjniK9pnEPER4gveSRVAy3QKlDA03TkbpYqorlblJfu33P+EFagAW2/fQg68F+bs
bqZ9o5/Id3rlDv/daYtGO9Bq0kSP310ivCtJ5hPTxHzFHXIEmuYTOfPeArpXBQvrJk7Sp8qgykka
GhLFfwC5NKjLbaMfsL5VVZgvRGRX1oYW5dqL0Jkrg3d2UAE+YuTlb0KzYX5ZqOqHwqOPP1RQ8Lbl
kIMznnSKB+YPbjE7fK6pf9kti99IlqG12OZpSnWO6FF5RJ2GlrfZw65h0/Y4KFrK6miPs0lpFSl9
YQlKQPMIIqxhVJVA7z8uOgmSx1VIFiSLmVw24YC4uBuHywVjuMXi9WoNVGP6Qip/gXnLm4qT7VGG
7Mv598UOhscFjPb4l/Dhq1iAjVT8rdBS65cXiUQcfCvqtSwpranqK4UchZC5lNkZHRQ4p1BU/Rz7
HIqgJDvyoPHug3z+whRtFxdfvhb25b2DsAApNAq6n1SpuPVoWOMZZvOjZKYju7gUQM41Buh7PR7f
Cp41sNLXJhj8FpKxxpBma0MULj/UWF4wAhGS7Vk6yQZz6BBVYvq8rLxf88T7Ad6WJqEhva5SmaRZ
cqBWxJAJhJ3TJw6NQibQFw26rVGYQbTJS57Rop6lRvApnzAA45j2OPkPPPTq5Z8yZsJI4PXgGzaK
ElnxOBl/FPgDibi/gpGw/yvVuEXamDdCAHQoVbfr0Ln+6ASFfhnGyNUuf1D/Gfxpo3hxQ8E76JR8
MWaRQ6JrpZiSOP7Lp/prYfIakZTWdqSu6Uf5z1v2dE1R0CXAuytT5il9oMVIahhuRSMJL81tObth
A9t3PZrVcv8q+4qEjgfanmp/yA9Mvx9L5QuLP61Z34+fnXRMlRQfQUbV2eIxJjHHABL9ysGNTGtP
4h241AFPj3UAXKkumM6RBdcaJl2Yp6kztqb6kNLgE4e8ACqKejaoSnSqDbDAry7Ms8ajd40L6G2h
zw3OkdwsUi3H3Kw7XXYlK6FGzHem1KSmAvdhf63EEq/HYpx+0kMm3IiIEQgNKYkH4sFHjLGGMj7O
9TzAGOxK7tMeLt3RT2Ph8Qa6nxJ7rK90eDzKhItSEgtRoanDKzZh4xtEsWbFpQjf8aFcE3GLkOvn
wLJ5UmjpZZtoRUthBl7AYgPGJgp8ky8uOdjpx1gzXm4CtLZRmXWka1cZ3FK56oY22l4TtrFa2KGa
oTZftnFcmuO1ejPNimD7CPbVwYmP2ozdMAA4XypjVONvs5NyFTub8j9QMOR3jK31/wWdko6Hnrq3
enpNS2iGAUYNRwG8w4J4Sx0rqoIrk2JpqwwVWFTheVQJwAAADG5Bm5FN4Q/yZTACv6BuQHfsnTp/
NlVSc23CnxIkHJvTi4f7+ARXF11k6mMBR7CUQbit/KxLA1YjFXEqekjZ5oPPfFtv9BHj7zdCMsbc
TWKPZarxT+phAJQjEOePN0AQxnvckyagqSvDh9FOqhysxRyd/aByOfYhQQH0UZ5E/YQqG8YOGDde
ihLmtxgi2jOIy2rRLSB31pgLiRHc4gvWZd9ruF94i7+M3N2+6zj9U2NtntpqwEOHtWXSUjPeo0Wt
B0Fg+nccj38B8opOXcFQ440h3X7NHbmjaerQtAAm7ypSUGHPpHuVTYCSN7ICgLhWfSDplpQ+18Ph
5frPceWPYJjw3HsRsAlgyEm5NktJgJtUmU5RwVl9+U1E7FUK4QnMscGCCF9ZyhFMtjb6e8hrTjyb
farQdZibp5mjEuK0L+PaapjLBFha4wZmCyVmJtYAzGlVwDemgdI1dojeWNpy5AgQPqxubWJkl1S9
dT6E0d2lg9lgGBxh3kd6N+3qeBHERy8GI1BqJrBvSR62cJJzOTsHS5vwj90Ls+Ad6QPx/MIOdWIH
EiNhtKfbYSgTkPGVZIFzbHmEKDBw8ya5+LYLSdYOmdbA+EoZk/OG6L1jGpH3GTlo+D6UuKvwE2d5
qUZSeAD+bPNih24QZOIRdfujW2uIdT6afA46b7Z/EL183Z+gfCztl6RTLywNDIFuK6ByZguKLt5d
Cn/6eUq0JUJa/OgmbC1IoxZmTuD46BmBnNJ9szN0Gwt7Fz6ILpeUf1H8ow/yTun6Sn2UNR2pzN93
HBHfDImT1R1QCXqYzMD0lGYiZV9IJMeTrx6F/HpUaCWXhxJd6IGt8+YsSqN99pW9EsPT2RhIEg4k
v/akeYxOoR6a/vE42Z5Iv7bMCWudPZqR3jG1QALwo906490cHgGIdnYFmhLKfenARBbqBvSag75y
wIQV8ovFlM1+r0bw79JcSxHQpk118Ey03vREblMP7B0mPwvn+0092FYsSNwOgbMGhAqu6HAzHFV5
hyTkdaVv8GxdO3u0qpTT5vaDEy2e5bi/DdbkoAR8EE4fi9dPR9ItvFIRtS/aoeZMN+rOFfl/mrpo
ivz5Z1tAN+Yyczq78yQKaZJ1ESBzfBzUWT4+wjwBpgXN+re68GUhWtE6sYe5valMtlU5EMPgUopv
4QD2GC3BRNcLuyPJu6Pb6H4oM3ZHItETktZjQHOuGdXAHtLmgcC2ECDQx9NPpjJ1xnKuerzMqi92
P7b2HjLmp5mV9mfxk2wwj+Lz0xxzyMIqoc/znnnj4VGujq+gjCImgKiILGOVHp/ojiVMw2h3CJJF
z24W0A/oYmbc0Xx8idH++PEOdvBx66mwqvsi1/d56jFdNCorEmLZ30camuPxLSIgnedohupuCxTX
HlZmgVA2LZyyVS/738rDHHYCNV5Sajgw4jmd7V5+61n9puvZB8mgO6ZOzDGf9uJJlYlRma3CFs79
pkBHIgIHcs79UUaS9BE65R2KOPk6PTlFUKLuliwA7S2bKmyNl5/xG0SEQPKtdWnLBcPprbhxmIwX
lpP1lFt7N1nquVnfaayqFznDU3SXEOkmPYbeItNrvnGaUUWwuexkbJ9nWJYWjbWru7P9tzHuWXaS
UiJw0RAuDQQN+BGNZUf1lc2w4Dz/11ugJmIK7/OoRTOElJc4Z4VJCK4eYzz5jovoytHGEO990Bb3
aC0SHMPbpxUkg++/kInotFHgPaqGdTXkgKYVkbEbJwuiZkEkAaDJNLGG2DkVToVnDjStwtSsd7J5
+DhmLAcIJGPBC2BtKzWejDaxtoxdJfQWYcwvjiEeVPpLvZnxwhjAqfG7wTxpjkIll2mgrHNgbMJ5
GTurzIaP4kZqI1cDz0kKs7sffnn1YmUVZXOWtU5HMWCriqwAQDKu6C7SlSl6xThKttCQBIdx19f5
bh4lkgchy5CTQXm31N02Nv0JcjC/Mmc4IV7qtpnnMruABCS2ZZ5WRqSIn7QXN16Dsx8Usq2y0+2P
+MfLcw1zful0gMrxX53pE4P4wc5aJN/ObM43Sd0aSiPgKcZtcDsBLPhCZSNSjrIh6+l2YB/TmoOG
bnkpriVSEL6OMLxlApzprWzs9kcDo3ewpUEBqStV7hYi8ZV7vKqDW2JL1iC/64KINo38XL7AeHcC
Stn+SGpDn1dFm+NQpQ5m4eKp9DpA6NO2WTSNB0AeODd1WEPwU27/l/wbrmLjqVQqHdxc1/k7Wlce
hfc6BF0lT7tZX4+TbVUrx49xIR98g7/SaEINsl0J6xBTegDeh3iIGNNGe10X1ji6gea/WdmV1n9x
zgGASIzaIYy/7YmASipzZXo3mlsKzSGbo1MSppwUo6un3fH2Q2LOuEKDAXVvK8xqxhEX52wRXjtn
fKR3ldyQ89B6DgFuzw3/CkHfKL+WBMZ/cK6k3NoPT6e+3R9fCkMRZACS4Ad5Eq4zqapCwf++KIjl
GUSLF6ugr/IKdlFadaBCVd/pQyhYIr9UCNl/ofVuNZk9qJvSX9KbuF6UeKLb9E1zCTrJvY4S9ajf
UmqF+0TtfWIutJzmpMcDMnD4TrdeyW2+3Pvi5GOGIrJnGrYoenKt84iTMC25vRGPgivpVdkMwTwv
43VET+T4Vr0G8x2IjYcn8SzSgQwm1v0Hg8PWE4qF5PYbSQeJx8UQfZCYw1DLaK0WvtOraOrAT2+8
XSSv3/5Wun0FKdrpicQR05YKrMpecwyL46WXV0ACWOLxvhDBB8tiB//4G3GbLXAw8pkA9CL7ZEDA
GlMXL5FtX/+rpmDFUUGbXwqRYAGIJhbtM2jRSwHG5EzyN/WSKQ7KoAzohbWtDCGpQAnXsDaNxgW+
iAp3fY7L/F1N/V+sNb34pY8u9bQGekwbcefrZn/McNlGJWcmDs5Va07ByLpNb0694A0qXrClRvfA
wl+et+lmcrIqRGBFOdD18gk+EMf02aPg9CypQJAVVWtFSXQvk5U12Ji2R62uHsMx1/9WZiSSiPCq
d/TlFYm9mJjPizTB18UZn+li3cQfpwn2m+ekE48SfnLKN6LgCOkPaPqCsrfoxQDVTvRXxZtOk8FW
6lJ9ugrrpYValkIQEnWHDKmowCqc14dzI5fDfRJq0SQbBJWX9qUHUCmeoI4wOXXfKBWtUeFwzloq
8/SuxLiBLDeN5XhMOvCjmEeJOewhK0szKI5T4xvLv8CpsckziRKfTs6ZdydYcX8d7xnfaT+ZxFVe
fcuwYHLNk2sDSvBsLc1dhleejiGSJmXtj9ibmt2iWpMoh2uFCKvTOa5FMrfn0XUXBrBCuY8eyf+r
dtnuSP7D5U9YQtC14tq1m6hUOinUNRmFFD3HN+5y+gbd046+0CuGC3Xcvxs0shkmtS+1iAqMYMTJ
yvfjos91nb1nbyMUo2I5JQpywULEHsMAeb9ZNZ22o0kTEGteHStKfPyAoHNQuzOZMCsXZpuV7X3Y
Bh8lQMdgBE9wAZnVwzaT5T1QLgsDsFDnos+fcoI7uBko4DvXkdZt3IoPhKEw7HVcYwAWdvrvS/Jf
pyhYyj6uGagNbhJq0blZZjOWoSEHV1iBGF2D69RoD6hQpe8DVMbKiB/ka8l6+PTg4DIA6RL5FemD
QbIOaMtYL3tW+HkqvOdkYhRcsbesuMz6k+gnT+20x2eS9WQJw7fLc1eIaWOIUV4guLRcE0ItZD/M
SeuDQNTsbC1Lly1Jn++h6otKeR6u79JLi0eWRacClqugjThgu5Bbr3l3mKJXhkHEFxSwU28LELin
O959T8LzhS0I4GSVx/VmsklZHec2JOq8VK9cU1GHiTvcR1SCwTh+MYxT+sS57a3JvF5OZ7d3bLfd
O6KQwWobhP7G3LfIvg67m2rMUuJzmZGsmQL6G43apqPBCJOdb0zjoCnQf4U4RxdZKAl3dXVUfZeQ
/jYu3Bi+RjApDdu8+j+egM6t4wuHDzNaunTckm0jFMn+Too4yLxFw6JAhc0cVEJNImAqGUd9k8As
VQC7P0Ad4kPrGE48a8EsDlzrz1+szwxcyUoVqTc1J0KA7CWvw5yoQ9ocYP+MDb9EeeO+xAfifwey
wFNKZQn1ZIETaSPtR4zbNNqbvVSPhthGM9C5iZRXcmUYU5yw+8HFs50GsNkxwQLvlNp4e7m3+ky4
NK49//2evkC8Nzk1hEDqlgUBukWr+C4Cqi4EzLdBYuckaddTAAahxnb9JAFD7prldPyZwOoGOT9q
eFbHTkvNxM3zRtzmtphGbuwC5uheUOXmfRRyUCEalKWqX2YCiEChaLQQNbqtuPe135BKNAIrrEfB
+RI8Czk/xvqRMACS4xMtGtS/9Mweg5g/y8g/65gtsH93+mPkQP7qPm/mvpQAD5sD/Z//7/sA+a+k
Ppz+7gez/LX5d8R+Xn93/uz+7fTgH93+mfTA/72agkhHCI/24VAZDRZ6OOIs1E5w6ah4SDTSahNI
L4XqP/pNJz/1/x/6bB/6fYYNsDYOrPx/sUH/N+xSaOXB/jTX8cILsPtW2/9gC2w0HTtB0EADTg0/
MHIdtDbcxbbyDkPIQAAAAgkkbGA7KAaCAbDKLC4bEArCBxCBBfCmoVyc0Q+B4S0pBOBgCSEEwA69
sXHPugcg/zWz/vbQaBoPP89z+1/9MwhtoH92floB9OPp/kQ+Q+mPkfpAA+Q+mfTf3cOQch/wzDyH
bQAAf3AAeEDwnhNjbG2N4TY4bE44DhABsQADYpMAOvAAAHX6JAAdf2LsQPC9f8J4UWQOIRqVDYoN
Y3dZgIIwIAf8hADmHMrz9+2gxScPIYrzkEsaO6filuCiL/AOQ5h5DyDbAf3gf3AP7QP7f7n9n9h/
YH9v9397+wD+9/af/g/v8jz+TzefyeZ/e/v/s/s//gH9/939j/9BmLMXu225hzFtmY9s92/xmmOp
r4WCQbYwQfHcGgvv9E37s6/dkSqPRHZP+OqezZ50TjmCS8HwnX5eLOdi4ZBgg3hINbeOolPUw5rx
zSeYJEpSeoa14hNaEXggbbtwOdF8cfxwNitzIRCGa8cLYpfRiQT8zD+nV/QEAWqIxwFszroLioMj
oQEMYEFqAKGYGp17bE+g+p6Lxs8ar79tvTuuoNNZqAeXy+by+b71955vM84APv/P5B5/I8p5x98e
QAX8U/fTu+/cb8+59z7f/p90Ae37R7ei02IxX2tFicVo8RptN8T7L4n4n2fxB7P/Lh8j9MAAfI/T
gBhLoeVZyrUUGUKKs7qtmaWTCPsoulh8uA2tL2JXI18zz46BAD/GFAHAIRqU9a5NQXJYnDZgG5AI
H48ghAByuq6T6QRxwSfDb0kKNryh8nIIhDmKtC+g7ZWpf8f8m2ZiAOQ7bmMf2J839Kf2J80fID5D
6cPQ+h9D4/jdXP7T+1/f/eP7x//D+3+1/YZhDbQ23bNszDmAAzAGYMxbZmIB5vK8wDHE5w7Dw2LB
Jxh856/p9t2xbGg2113oPXdRitrrvG5c0akcq3CtGUe7r10LX0MfdtbSc/Zer919GZIuFfl3NGUf
Q8wbb/gGY8w5hAA/wAA5DtmYuQZi5AHINt5BmEAAAAsUKBzOfn5+bm5uix4HR0c4c3SADpDoeGOj
nTrls0usjhAjjAoP9ghQBhUbz6+gP8uIFpA2Ptu243if1DiP83EtOtgOuA+kB8182+mAH04+mB8i
HyB9M+RB/dvkP7qfIgP7r/dT6f+6vp/pvkPpwfIj6f+6h4QPCdfDr2xvC9eDwmY+Qcg92zFtm2ht
vIdsCqK/ub6nseJyRHOE5yvi4bIyJbNV/zbPtqyN3pdIbK2UboNLfSHK8+zygAAUkDnrm8HwTn8E
8Do5zpOmgDghGpTttlVnkIDUgCEQ/0UaIAUG60h1qWGMkwZESPa0aQiiBRUgnABRCMAZWrKBL7ps
bYm27ZyDMO2bbmIPCbE8IHXtieE8L82PpD5sD6b5H6f5F8j9N8j9O+R/uj6b5H5H5EezPy32Z7N8
T7MeyHxB/l7atq2bZtnQNB0HQAANO0/T7Y0AAAJrhsE6+E0nHPwY4gkFg9gzSyuQTmCTjecEg4W1
bffvXNt9ddc2xbVsd/W1oON+ofU+H8N4QE8fUuHYy/zxf8boFsW0Ft2zbNtAAW0AafoB6p9f+5O8
d+d6AAFgORw+HD5/M4cPEHl4gHAcQACwAEwBGOKZLQgE4QIZAIAAH4KDjy0Dq40TJZ2HJedruQMt
ZSisYYemn1tZ3ne9+793/131T1Xv++eqjvnq/e949VfNerHfg731U9VX05dxXe9+H6NfXd9deHP7
zfX194d/6Jvd16P5h9+8v3wAF4VH/+P9/7n+6/9HdH+IPXAcIRqP/Glr9/87apNYZRQbHIgEJAGI
gD/KAKKWqB0T4CNu3pWj4cOdPwSNVZ4Rp2BGZtof9swfEvy4ey+JH07+6f3f5D5A/7AAHoXIAfID
6b+7vZAAd53/qrvj1fvj1b696ofTj5AB8T7L4j4n4n4j2dHuMZVshZFMDtkhS111wjcmKwTcOFYv
VHN/vI4gkvBxxh81moS4GDc+455+6/NMPDr+H7E/2nOGTWCQYPCwT6/9d+ld/3gO+d8HeO8O8ACi
2iaZWmWy79FVBWfcVrEmoARYDtMpoLjoQCcIEEgEAAAoWcAWkDrwUUDwvCA8J17hAde2N14Ni6AF
sf79cf9w0EPQj5E+m+mfTj5APm/7D/YviXsvZHsvy/4n8u9kPkPkfkEV9PeF66fvr7y+c8vmefz+
d5PvnmAef7/zAat4Xit4x+H6XO7zYMdedu41rn/Z9j0jAZj1frn/QOnw/sOjp5jm8LmDXOnDHOLy
K0wwK/OJUCbgIRqU7bnXZHDYRG4wGIkez4FgQADP1duuMAm49yYTSubFrtWtk8YzxgMrhGf5sBL6
H/h/l2z0D0PMYf9cxAG27aHIdsDMG28h5AP7v7gP/UB/c/vf2/3/2f2f3A/s/u/u//P7/7/7h/f/
+AP7/7/7f7H94H9r+////u/sf3hyHkGY9s5ByAMwhyDMWYNszFyDkHINtzByH/rmDkEQ3TsS5d/y
LIHQHkenRx1+qY907EoS1QfCNdx7B4/hskZm015/P5x5QAAAHHCAAAAAAAABj3kz6BIoDZu3cje3
Df4ADp6fD5nSMqNm/lrATVAAiANapTZHCA1KAxCCBsAB+FAT4D6nY4PqHHATzf+IyoD+fifD7a79
tjQLbtrT7b65DQdA0C2NPtvT7ZDT/iXxIPiT5p/YR9L9L82D5r6T5t/YR9KAH91fT/IfIvpnyAf3
b6b+7/TjkGY8x7Ztu2ZhzByEMx7Zwgg972X773gB2V7/3nZWl7AfOcdDfNeJbq1z4dwxwbIfmyZh
3XI8fDKzG7GGR+4o3cwPugAA4uQ4OYDyAADyB4gefi8AAB4gFwMHIRqU1bpXYqFYYCAnKBAf6CAA
oDPgvz4Biz/vsmQvVuSKccXGZVFSCUgBKQAkBGxgti2dszB6B7rtv+OYMwZj20A2JsYOQ8gzB9P/
dT5ED+7PkB8h/dfkH0z+6/SfNvmj5t81818383819KD5r5EB/d393P7sB8if3f5H6Z9MAbaAZj/w
AADkGYsxgAZiD0LkIch90tz/5vWe665zC5PPHODG3jG1uzzLE33ZbpI0LmGl1iqfm/jccKHa4fmf
jgAAAAEaJVtN78yRxll957jrKSgBYo3g3AbvKgH377+n3yg3tjfsDab9hubm8biYAloANilFhkVD
AMBASlAg9vYAAB5W0AThAmTNU8X7v8Mw8hzHyH/DbfC9f68G2cg2zkGYMwbYH0w+nB8g+nP7uPkP
w/wz8IfIvpvp/iQ9l8T7IB7O2g0HQA07QdPtvT/kT5H6b5H6cHxI/LfiD/Z/yvJRc9te17VFF/7i
5/aN5UWrLMwqvT9WV7zVuscFt/E8DYcu2i9c72TjOLtMHneECjFpSs2wrtRto8HFpLsgoNCogDmA
cXE5hz4OHJx4/P+LyPLx8vAAeI8vHxPIOCEalHXNz0KRgIygQCCwW5BaMnR0D+Lx2rWK6y1vCRSL
xcdukYsWZ5ZAUWoUdc/5Pd+Og2KFs6fbNog2L18OQbYHIfz2nWzp2n6CGnhoGg6f14PCdfDkGYNs
5AABmPMU1nE5nEHnAeV5fJ5Pv/OHmHlB5PM+98n333z795Q8nk833/3vmeR5PL53m+9PP5PvKxsV
1e3nmdwsMDe8XdyM5jtewuZ7tTGeOepXjB+0d93n03eHf953nenfHqv17vvrzvO89UAPZ+y+IfEA
BReKIru4rJne7n//L/9V/w/ywAf8Du/lk0Z7i4aG4QIpQIA/WVFeQoOTrK60APUzqJzsbD4JvOCQ
QOvBBJqE1gwAAWmDwgAGxeOg2KAdeDwvXwzAHIOQchzEG2ZjzAG2+E6+AdeAAzD6DyHMO25gDbA5
Dtm27ZyHMQbbyDbACDzWchOJpBoLjny+cPOLu+u76/n9+iivvCnPWXj6jk/ed5hJ5n7n5d7X6RxE
fldie7U0+/nEVHmdJ9594AAAJQAOXPm+IDmOI58Di4fPlzAHBwPl8Djy+JyBwCEalOW9zyFxUVQi
RRgRXwcRDgMCKrrF5TyzQECr8rzr/LUoLoI/9QB0j55sTHeGY5DHAY6nITSc23p9saf1xp1sBben
6dbOg2wGgP7P7jyed5x5vM8vl8vnB97955jy+fzAPI9V+lfcHfH3ry+bzef7zz+UdHT90MEljp15
kMjrWd4/LOegI1hgCViMJVxYM35TyfGUt1rvOaxxjXFfGfX8vnNsmz/D0lw5bqGuSPo2+Jbufn96
v52/u566iiiiii8Xn5gAAEuHa1p0ibpXiQgAcHEOTm5HDmDgBzDnwHyASAGobiYTqkVCsQDESjAq
G4ll5AroR0Cfu566vp5+g8Uyoyxy+wYjnPN5PK8vlDz+U8oeR5w/iPJ5fI+8ff+X78HmeXzvMd87
zvPpXfO/7zibeODiSpCZf7C/7W91RXWTdJnK4tnbMv3DVeDnuTjHPI8xX7xGc/aONHxzGsUm/qUm
7CZChaB1Y3LKB2u+qtIiF5AUqcTjzPi58/kA8geLz8/B4nm8APN5vDghGpSNwATmALhsbiE4EARa
wNiruI4QCwCRmk4MytRY+FJ4ukKAbWrf4U54p3nBuvBNYNyDkO2Btm2W1p1saD1/wnhevB7zskNt
5CG25hzDyAA+4D7Z94AA8h5QfeeXyeTyeT77zHT0DwfDE0moBOIJBAg/p+Opx/N+h+h9R+p/U/qc
8SqDBDcIC/8T4fbfXfflsfnLZti2eu+ugtrQdP/9/tvu/c+19r7n/qA6HgHg9Lp6AAC3u6V/hOmz
AED37Yeby0hXFXzHWk8NYRXpdY1LJAC0iVOMAuIzqICLFEAAo08jgJ27326ur6d3+6nvDn5y/iu4
rufn4p53zvO+O9+kd73h3zvu9A7zvgO/D1X1cequ/AAeQPP5fL9998+/84eR5Pv/L948p533p5vM
D7zzB5g8j7wAB/+gP8YABCcNY4RQRZecwxUTXpPZc/h8OHABx4c+TmHIceTi4CEalHWyXWNwgNSg
QFgMaMAQeWgWOAmaATwMAgABJYCa1k41sjhgE4ECfVkylrUv+QPCcIAOvh1+2dOtjQMxAGYw+lB7
N7L8vPiXsgD6QHzf0r6U+bB80Pmj5v6R9KB9IfNv7H81/Yx819KPmz+xAHzbkIbbtnINtzDmLkPo
O25h2KAWiDr+xyIAdf8LsQA6+Gg6BbHXVs2x1110GnTOL/b89bb/+B/b/b/YAAkCKg77uJul7o+X
JwA5HPj8nDg48eA5nwAOfHm4OL5pEC0uWgFQgIygQkaAACj6AehnzGn56VE0bNLu+nLuKK/3q/vr
q6u7reLu6up+fnrqcvg+QD5EB80H0h80A+a+bfS/SAHzX0o+b/sXzf0h9J9KB9L80f2A+lfSPpfp
T5r5t/Yh839MPkH91AfIh9M+nPp/pv7t8j4eQAATEpww+F28NXtPdAO1haJnwZJx4dtNwCEalRW9
00Ow0ECCUCMP+XAAGDv6ZTyIE6jcOt6UzB5xzYTRYJ4iB/jmDjoOFB7t7vyHbOQZh5Dtgcg23kIZ
iDMYbaGnadbegafbOnPuj7oB/f/eP7XkefyA++B5fP5nm8gAA2vLGFNyb9YoSBsWYY/jOZuFU2ee
tasc8fOQSRUwauIePc0fX8NmsFCcTXDAl4s1mgTmfu5zf56d36f3u79dfT9+JCs62w82mHOjOKgF
5fKhxToBgSmssqoYGMoEcAfvTgADHDigNT9u3AadkZ/R4hBZrBYPNINNJzmDbA2zkG2+7baPmz+x
n0nzYD5r5v5sfSf2P6T6T5t838382D6U+bB/Yx818j9P/dj5F8i/utJYqKsR9faPS9+xgOnY5nGW
eQxEFDyNG4EeZClYZ1Xw8i+CiU+RWtYE5d/8t3vX7rv993fXO6Krqx4hGpTtscdicNhc9jcQCMoE
B/oCwFA4BppyMpfzkwy+Fi9LklkypR00SamJccRx2RsQKLBRYPee/2NaAMwbZk8vIcx+75jzH/Yf
3v7T+4/tzDmH3fbds2zMPIQf25jD/r7pyEPO8g8vneXy+Ued5vN5TyffDzeR5X37ynl8w84fe/2f
/n/+D+7////3If8/IMwchAOQ7aGYMwQ/dfyNI9v5rd2pe6oRuzbdxQLMfIdt2zMf/QPdsx5j5DmL
bdsD/+AABucoAEgIr2g/4T1v5Xu/y/8ff/k/+rugGcTlucQCcVBctjcIEEgEB/gGhkEF459pAHPv
VNgAzshQZi939DzD7vmDbMw5hC2tBqAWgWkDYmxNiaBp9tWzoNtW1pwP7f7v7n9/9393/4Anop6c
nrt5fvwH2v/Y+3/7H/sPtH/t90fcfdf+r7f2v/cH2vt/bB+f062O/9PtnT9P0+2dAhGco1fKmngW
HMy9ZV46ptAL/PATxjZ4v4Y2eg1QHhAAEQY6e3F4Y5vJ/KcI3pEkzr34IRqP33X6l/9DbnFQXTY3
CBFIBAf6NBEWLNla5e3nAzzHP9W1gcFx6Hw7cPFpfCgJQIDl+uf4Zi5DyHAC8hzF6D/k9C0DQdAt
jbNt23kIbbyHkH9j+wf3rhj5HwQH94AP/b7gfafb/9X/u/9PuAA/9PtD/3Afd+5/7/bD7h9wBx0A
eEAAAADrwBmHbPzfxqmJmH8eggXWTtX80OQZjAAzDtnIOQbYG2baH9gAAIAJDkAHL48fgfLiAAcj
l8R8ublyJ+0AKyAGxOcAuKguIRAIxgUH+QhoCkDynAAJEGHcT0YAcKWtC6125mPMW2bbyHbMxbZ/
lzFoIBp9s20GnhtvoeYNfzDoeQQD+8A/vP7AB90AAHr/xj7gfaPuB/+/2P7/7X9n9kUW08lNlXLa
ZfmWHazYn/4D+z+/+0/secAAAACkwiilBrS7OH/693nr+u/wcAAADbNBm7JN4Q/yZTAD/+OAA8io
fCcFFW6kSiZOIqhsm9oc4xftcG1MUPAzAzOVi27BcG8jCf48VW5DLzpW5gCJ1YKxoyyx5GLsgPJt
NzTcp4tskYDoqGmlFezyM4BI3bQX8rTCFoqPfvwVV8NG7PnGQjh7sYfZ1s7R6GeN4RJpwsBqCiTD
bmUtdpB1dDR5njs2aDXCN1x4HjAnYUK4sxYDfFTAv4tSJWLPjpf/KQh83gjN54Tnp7GDStt4pVk8
quddO6YbPa0CRLAoSMuzi+OV9PU8MBOUWExKM+TeGluIZjc8vThP1Jsj6/BDoUpafZAAQaM5evYg
fJIYPnYKSfNpg/pj66gfV68Wtu3FYrl/F7/RLhVOUGae2bTTsDxxP2BEGL8gpMFIS78kHgQJ/xXy
/BdPpqCAsBcOrplPmLh/5OwuJMLk6kw7cxI3KP2caQ7kNSq0XgE/GzQFC7kbwpuwxuR/FMv7Ry4A
LAhDKvEl/5SxDtQx+mNVYp8awzi2fSB1je0azp1pdz31nKdzNdPvZ9ajSlBM7dkyegYS3gfvWXsO
eTYRD6T80X8HSuy59U07D5sHYaCSnsqv6CcDtEAB4oUKK8yvE11wKKnFtxU8QXDn+x3AxGNkBVsS
87C6qQzWpNezHjfd40Raa7/WtUxh2u21FbqQjgwzSN/FmpLgIm0Y5k+8NRuHFg5qZD7maO35PGOJ
UPdFE5j/NQ848F4n9/EKkv2LM7xj8Q8BFZhS6Uih8Fd5279eMqoJ8/Op49Vwm8zWPmPhKI113L+p
ZutcChYFyNXyYmJnu6Aln7iqK//legBdDiZUWHgWi4hvNjOykwhdFAr4H/t0nfV2DWMfQkZXo7B8
qapTneNzBGy3XNegIyztacuZzTHNdMoT1LGOsC1DY9HT7ud2JC+FWK80fK2xd7VSG5BpdPFR158E
tp3khWY8a9Wbg1wdp1JGBcJ7GuQKAAKFzyrV6qPpIDqkWiVzGhKgr2cJW8iVSyXOUaZRfMmMP3Vn
squDPbNGiOfyxF+6+AYkia6yHF3v3caeN81i+a166LENYj5R6tVl/HzGsWy3imuPoOC+Yi1hkpQH
qg5RFuzIGQTbFw5CWEl2e2rtvHX/juKdBcOYjuXALP+vtBw0gTT82Okn71GzNWH0hFdxfz66A8Vd
/ifkFzyN+FPHXlX82npnU8hKKG+o9N+2iAw8BMU/jvd6iMd+E1A8eN7+spMgMGazjymNFy0CwNT9
CGCeQeWmrzjTKeqAA+VOSdzTbQ6qGdb8H9ObQYCaCzkh51Aem3KL7iPEMQ7aprPtaULjsQo4vKZH
bInZ29mpoFFPNmsBfH4ODGQnQvNglwSsajIHhGHZ+6oPXlFXltRgOuGbIw1OeDUdSHPbH4O4mosg
/JuUx9cpHYHlXiwcDD/5znwRnKSRLJSJTSREMNWEC7ywRGGdMGdGbXx8pRwIi/FbAJUf37LAzOZx
5xaxtmve3ECBx5pS9+adBuiHgabFe3pqdeTmDVQ7gLB+4k5cos0asO2rkOF0h9ve6IGV93XyQwpD
lvMHFhy4yrK28QmRsLYyVMTmJosSh8p0YO/nygY+G+jgdU56gngAt3CGC0q0rvB0HEj+1JotDA/r
KMxVPETp9ewLDfS8y4Gv2hid7+GkdqMPsocOBZlqXXPX5M7h9T4w2SwRsnlCjnG9dpxVxuvlGdFp
bbNCZVWEVK8RxtzKaVn+mVpYkvVQ91PQ1rkBscwPupmZC1LBSKN8f9AbvV0Ak94bsLSx+K1Ux2ZZ
0iAr08PRvR3UretQ9yeavXkNHFSFVqXyGSIqgmYz6Oi3czccX4f/C3gkOG7+6FEqdQM1P6Y82KZc
cCo5zkLAbrZiRnNTsb6+3qvBf/3OwrrfYGV6BxD8skyRqDE/nfZgbuEGg6au3FNOX70tJiqiy2EK
y7JCKyn3R3SzbbQyprHykk/IxX71z7NnAVvbJMqjGkKxZ0FTYQenqjDFfopEc9u3/0DUSAF4TbZf
ZHy+n0zzLuU6NVXA2ukrqtkxp7i55ZyrYjqg+xxvea4tGSRiHY87q337IwxYHd/kVp+AESj4ljb3
RYhgch9ydpy2bL+V5vYapNgicV4vTCH3+/GGms/5//esNfgKcQSSSi60nsstnEbZyNla4IsqIW3a
SE67/qTMSwpAKDssSA6Y649cb7n+/zrHtQpudDd6szupbB5wz9E+k6+lydgXkGu+TNfeCKUET1Mk
nDnU4EdTgFXgjAkA4QKiKF7/n/ylE3rUvom8ZkF4mtHa7Gu0YDPO2Sz39EC6zHco2stkD4VtTVy4
TKZPNAj2CwzlAEqE17X5qeKk8BU71XSHYKy0gJp9CCI1SbRgEN7BKGB9NMrBXYrp/wEIu348HTAn
TvfPTar4+AjvccpOiwpwuLo+BK2J/7LI9S8Vk/A9ZzvQA6PiVF0Ol4oxq3fL0DmdGo/9EQQGF3Jl
qrQuTQcWt05ISZznngvBnEgLiWZ4z8RiEIApx/mh5t32sKLBunFesZRy9lnkGFCko9nyTl31lrtM
0YHk1CvpKPJcLzgdQ9pH40QLoe7gC1tLEJfXDSvowT3h6OCpcLSTl2rvLvmVy/XXwMU8YeOnTFY4
6vuR8SVt9LMI7/8+m7qzPQ+gMYFlMtXpzyEikJcEDLq9sgiwuoM586Q7XirAz4gtzBQaXQpjh2Qz
lSd5hqRsQIxppu9BU6TjkNjWCz+MsNb0FKclB6coERPY4lKSTo1GCGZvYy1TCpTmqouzVHQwqf4I
kaxYugu9t1mWSnN0CHoHr5dPThAbScHYhCX+uIqIlWYULEmFMdPiwt2fhkeOP2IGt+RrOnujsvi8
H4zACYenbfWjvFKhdgHLICtZplIQcW/D0j1ld1MMPnlaM7gP6WOj1HP1T1NMfO6THtaKo29bwS8Z
SI9+rTZ9+v+XZSdBBt0899KC7naAhUBr/v/5eLlm9+a77L+2EORzv5w6ViNkpQiAqH73sQmaKJhU
YcrS8TDGvHi9B2HohiRFKZ53s63buNa5bFMxEodRtPR3oS60BrBaypmsudwQgrbYRECUi0t/ueo+
Z030u/fOub3VLLMvtAW0qeypjpJbGZrL4JVGO5hWHIGlvQ42JcHyuXyzw6SIBY0VSXbW/l7YNscE
Y8brEVfv9E0TqWtF//XLMHmKJ1isjP7eTJD2NQYwKKD3PW4UrkXx9BSpbbgFWDQDY2FJ0htY6xju
8NX2fubEDtryU1rtlLk34Y1hHARINVbFdK+CGOEvQ4P7D1IhCObkTAhLIV5LK8RZ3Su51TufT8aV
8cAmRZZQ2qEg4oQxK7Uimo5PNMpQLtMfRBBbWGeUxQzR1gQm944NeEGfHjlFZpTTSLuTntSA4FHu
4LFmfdgvxzIipomAiRCBYYh3HrTN1pHfcTn9HXKw6mxRHIOKXt/QBsUczbf23ADsAlpYz3p9T7h/
d3weg0gGtC85KHhmQtNdNDp2oXRXjbK2Wz5R7z97UlB4L7zyeWmpmG9u4awefi7yq48ftr32MyZV
kMppovroLAwG8xc2FKBiisg0UYd3UHgYNtqZ4STsugTQQpkA+SARpLEeZUN/LFgLmf6276FdS0+c
Sbo/GueVnqx2RcSX/M6gj6LfhL++xP9PYLwsmozAUmNF67H8TmdbWqzoyJ3IDU7a3vVH+30xoArG
BAH8gWjFY+CxYKLp1ncKG3tOgZLgy2deI3HUVG5LsyA6VoIDHoDhmQku5pYHYAzpazrimGQ8QTxe
dOMxErmG3hWPgwPoi4Rf7uW9M3M0dWUtRaMwOE8W9o7ApLF09pqP4B9xx5Yt0zbnKJz9yp5iyqtF
EEnPACPhBfBUw7CaTgPEu+ngm2w6EPgjRwBFMZQTWzwnR6pkNEfjs8UgUidhBTwgvhZej3zcBqog
+40tNih/oR34OkUvmODR4i3Ot7eQgQTX38/hJhHXa9ydVQOc1B7Zd09LCI9VMk8+usRe8iw6PkHP
uKg28O290dGUdMOH/qFEDmNjE+s3hFqciwlITdaOLU5oMYYe9bKwku2OQ67nauKpXrhHlDLJApKz
1V/2N05xPAUaafyaqK6Amroi/TMrCZzSiWHGd/Yg+LVDn4rq9F5wjlgjNGGxLcBCiwdlkmqKL1BV
FTaXJ9XZG+Z4vq2hV6BJ/xbqQ7vprGRt+ilpTKcDyM+fCONSIOZKvtAJdI5k2RqoiUPhQrYWjJkD
TGic6yb6h2L2yJJeeRyM+z8HPku0jFd8Mugth8Gjrc1xCH5Zc0PZu/ofGuXOoHL/VAkfDCOUnpHB
WgNUo+rFolNFOMDAWKYlBS6HxDdWE8IQZik0YIElaXpzKarBGC5IGIswSpYUPgpR/lnzHKnyWKCW
d13DC+F7BpLBTUghgbMQQUuGIctC4O1ijkzfxRpMCaBH/Sw8cc7EoLVVkjQs7m2JnXbJVbU+1AVe
bheEMa1sovpL2DaMVy6svTBTAQWx/I+s+DfKI4sSfi6NdRkPrwCkhTBMgjaHNVvr5vsVSaN7XHqx
3B/ejQC37dml9LuLx+Tg7FClXoNkt8pQ7tweq/aUvuDvYdvw8KzmO1AL45wu6IRdnwmVm9KJQ5HM
Ltfd2F0/HZGlRLmrv7L00kVRjknTiZFeoujzbEzGloQmoM+ozP5zsWvv6beseLSAew18TRePJx4H
V3m11aKGq8M5OgwpBhEAAA0SQZvTTeEP8mUwAv/JL1DvTUcQ36zphYlRE/vq4Omq6bZ6hKftejxK
i3H9qIJInEKAdKY86G7pCWsOt269wCD2JEyz7zBOppzApVAyhWBgvywqL7dwhzEj6E1qqBnoDi5O
YYqr12157qQn4s7XQCR6V/iv48Yuf5e5P4GCa36+VGQ2ziahLMFaVIXngkXwprJtdD302A9RW7J2
g3livM9HOqPjuv9kCcweXjLK6D1hbTMf1tXW/hppKX+FknRomSLZAPiDbNNG1/0k3Ds2TRNIktvp
pc8IAFwyyROn+/z9Klrjm8VwCFi9Uhhd6H0iZVazjgFlm9fqFxX/NqjU3YiqJRD41LnVkzcp5aC+
mtkNYgBrI5dRAPqHXmjHwYfii6B3g3NYEzJW3v+DLHl2JndTZkYzBYd1pvxV0xApZziqhIPtsr5x
4xr0SiU1descl0m0Bpi0nZhUqKH9czUwBrfwlXiqKz33ocS8ry8DVnfCrcdl9bq4gjXSPdMMbco+
d87vI0Yf0d4kyuO18JOpzB02Sv6e3KZqxa5snYK4ZZk8iVh2PQjRt7pbdcdw93AHkT+YWZCRrEPN
+kwBG3xKBmuXK5ja1742sezb/X2OVZ5lq6pXyAwWAdohpMxusk6N+TKTtmfx3TwwvpvYBw4GvCiy
xPy44PMneSYVML0LswhK8YZbufp1vg4YuiIui5oJZEGKt2gQadyyktjxU9WVesiGZi4odiheKTy1
K1V0ixqQCg9wLDc6bU1SsOxaGD1AMyK48AxSp2+XojNec9EOm0N6EuR1RTaioK+bq7eRLDpWourx
qLFQcQIi4RQ4NcowRs/k1IIcQ8027DO7FdC3vdX6XHIgdbOQenFPFvbV2Qtrv2l2d/7+yJ6THOHH
5/cfyqHbExCjonQYEM7o7SXNyAG5Xk49TPrloSafFfkWsI2tQ+YJpuxQIAg2lmwU6kR8Xsv65cYl
zev+gaEs1Ief9hyvWZunjCes/TzZoaJ579KLNksBCU/+rvX7QDGgPE/Lx02At054xWp2dvmzvVCN
x9tzItW7lAqka+YDXtmdSxqhFy2T7aYiMC5rWCOS4pPjlIP65I1TsZNoFbHBYDU5ZQOiWsGV66xS
H7hMRH5xmPm5WdsRDu3hjsxOYw10Vk4CNaKbLf8iPLhLn26Z7iAuTf10Hr9meSgEJWf/EQxkTbJT
8IFMA+HJzKDn6C9JGs7piLt0FnQEP3mRvI2fu+Ed370Ho9FIxsrF7+bRA/xPhRpAoB34SY8FOvhg
QCHNKNc8qQjKlwNOZ+KpLGf+bsufKUkZVd3snykVKy8NkoMZvzHVKJc9i1hIwrvfFtrn686JiM7h
VUxhAqwl0Y68zaUQdxQPoaLuYKp6KZkjoafBJf4kED3m9Fyor3tHufJKGJaDVwzicoY3TVh2ok4H
jq9TC4WNfV8aYdEJpsRogIUXiMMYpr4yYiZz2S8C3JYXYYiygjDO2Ury4f1XTfdZDd0zzS4h66mp
GUc90949k1nuY9S6lkfMdQYHp46BCQpfPrVvA5ITgYckx8B2Z3LsCP8qGBA1J4kk1zP2l2h7BMQv
OvsUdbsOhC2ZRhllBhXi19D092GrSYj5RNQXcIwRy9XJ+OnF4pJstUJyrsS4vSjMwa6HtHoI3Qdl
1Gh+kM/lRSNF2g9On029kISJpITh1FOSLcyqg4CA7/TVgzVNf3jBh4/E1dOVgZmbLwWvrYOzzBSc
8XKDBRtdeoMABXxyP3+a3sxrImtujw2Ze30uNS0mF9uwnUmsFPco0uR76ybkOlCuk7xuDkHsGaVl
wRJtzRMPfcFv7+EP86/H14BG2k+UCdXu3tq/ZRRQ8bn165gHwDz0nLHbWj9bQ94DaU/H09yAI0C9
KAzmcSre7PzDkWUS/ylN23+kyVn5NZ5cBaBHYKMDu0Ke9LavILYhiG8M3hSHsNPHZne4OZ/D+XBs
Mg4/I7VnxYP54g2OEv5LmRTkVO1hG5a3vJL5/gLpSjCsJEwCQdIrNhfSA5lvcd2nK7bZ65Ch01YF
UcPfjE/+ODC/A3bjb6fVjSJI2grDz7/s8qhimvsi9Rz+o3giwt11owHSNDUG/9wu67+hckFn81kX
x0T4/i1OnO77cufjON3eLjwNZaZv5O77LLrQrrHnXabXZxswJCHT5/n16gKz9pgjEpL8B504t93N
sWFmCSwvsX9XLLAx080HjChAURzr20/vLigy9bvR9UgFxpcmlX7wcBk1T7/t8uxAyygWJg28NlHg
QAxKBRdOoIxvlYpSliDkEpS2PRdLj3FBKUYQXj9P7ZCYN5qA++0/RLj2J1D/CCU1yT+0dkjRx6EP
VNi8XQmMlvI6bOPDlAm2gvRQL+o0tQQ57Y6ToY0Grms/47WYq1nHr5AhBKiCz2xR4AZxEqkg3ehY
s16PgWEkdfaNO6EgoZf25JYZr7ec0ffc0WXQok3y5bP7c46dRwhx1AxGX27ySWWOkRl1mSOpzOZ3
pup3CQK2VHH4RoVrE+83z3cQBpimq7eECYRjdM0/ih1Vq+7+kRdSIdL9UBKEimB0RiVZBsGa8GCi
yJ4m+q6oZfZGV6VpHFIaP1NeXEBSnVNa0e6gu6lk7dU6gn7Bprhqtaa9JX5cm+JGjQaCdWDHpIcn
mBFoJ5WW64atHyCn4kAkAFL2WXxBhED0qEfs7wekY5zubOSzvr2uqDT9jyWOXjOrwS6trodXnUp/
NpYOnYxIur6SuEmc9RFWqMNgFWtpEEIipBK+pDOHVxoAfju0NRmBLURLG1QENk1Qjmc3c1uN3Qiy
UGYGV9LUI8WB+/eXlQg1hT7LJdkkvtXs/9MBVXe71a7Y9k7eBEyC59YKCvSJuxbCHx3to9qXw+bv
ccmxi2D/gQU+Fyq9CPtn+Dq7NzTzkqf+FTZtvd9HLc/vVmaVal/nSsVUOXZidX4OyAQ9xO64k1/y
v2QD52SGGnr04i5ykp41sR9Qj3zb5lgQCsYO8TvEOf/lALdbLvpMw97fI5PI76YV1MlqrwzKbI+T
l777YjH5CQAtNGhlHw2RNn5clg7Y2H8Wz7oQI8+GcEJRSe04ZjdxfN6n41lYXbYx/e92vr75FbmD
DvT0cHmg6knJrwVzdAen1Kpc7sIxfC6YZ75bg9ohnTTGDjYk8EhKVGxuh82qJ7/2bA6aeYg2FCss
dngR45lzVCrSR5qDJkFMetsXWnuMqawK0mDAzIDr5Vbea6mvUtOKa4l9zrqkFMFawIw03XdAqhuX
ah4/9QeSdV2ip0Mcuo91ubhicR8s9JY5AKEbPFJeYd2dT59wwT7jiZiobFaiUPcLAfKOHfeMoGm9
aOxdUuzUQFpquGEH0IVHU5gFY19HF6ezSA52Q8Ci11i+gTJO7tgGn42keR6cz5rGmZtMFAkxWqd4
fxnHY9pkFo/qxE9512Na3/WcbM5OAp2rZjjIqlfI7+sJPr2nQivIzsTgvo5mmArq59sVY3Vm8HJs
uh2N1t4vwTCaTF3BkP6yT074HQp4zaHuEZTLmg2p2r/PP/jz6+FRcP+XdAZu0CSzemsdunuE6TJn
Z8cO4g4Unb3Jy0jn/iSpwWEBSEg5BCN7JmBaO9HeeQQVfYgfVrRuT1ZJ7ammfGA91Pw+urB7cGKj
rMq/WwfW+dTVnceIFhNlLPWPxrVK6G5g4GMLJRU4a6m9+8Fj5oH5w7SYW6RVE9qMjQ1QAuSydCCo
m8rYg9ScAvsb9dG/EBs94TGCsXUI/SqNzlnxdXiWThBH2psTQgiZbvdhrAsOziwp6qkKwW4g0oyj
WYDywfd8RHT5IR3ic2h+ecS2YvZhbw9cDXuTHpvQG+wBtqb1IQ9rorz90UqUZ5ogLZv0bMeOpYVq
ChJIiykzVXBMnCh1XjBxiRJMqokLNFpZh9S1ovPRXLYVOgAsfSfRr11mAPbMZOUZH0gp614K9Im3
salLN1nTxmJF7YQR15ElE1L2rncBQXdyrNOpsIu44nFlofiALX/ksRvRPL0JHx4eOzy3czRUnHJU
wOsr7dSLoFIyf1AH+bbep9wFVD3A6g1G+F/VL4JlzgCg/1f6cwrFIfgABZicxlZtdIXHn3MclhM5
TFWb3orMGFOlzLKv2fgAd9ab7OLEgpGHNFteC6ptiqfCGyrtaKpUgoBoMOjq2yyFmyCbeN9h0rFf
j3KcmiF5nfqyCk6/bqyT0sH+xp03haRE2WXlPfwv9L20yYin8twckWb56tk5FUa8JA6uLhpWnsbl
cUka/SGWYe5GOVx2pQTBbystErEZN5NLf5lZyRU6BDEzD2y9aeOeAXu1he/15fsrfp+HoUPuUkAK
krdAZicA8CjnVLWul8eulB8BVlNePb8SwWvR+DBUKt60UEe8Ql8RM+NFRGfcSpIm4WcoaysQcJuf
7WPCVwdDb/ghC23cg2HU2OnFOMx9blO+4LLr7aF4svHHckb8MjTeB2ViYO9tySdtp1LQuUpnbldR
LAAAAnZBm/RN4Q/yZTACb40m/fu5rya2PD2uf+A571UFJDFREVGMaI3aQfk6WAtMWMrMMtvGtzhV
rIp5B/OE0W40QAmL48rO/w90KisJ7ZL4uxVe5jbOkmbvTvJtVwKv67sniXBqQ7xhKb22DqDR2Qql
kRa5B79C7aVTafSpVs9QIr4Nzx1YDlZOXGYvu09glROujXoXpqkvsqPtPTASORPZhzNtbSP6TDyB
rniqTcVZ7id2AmpQpAKSHi3LxeWEeUWVQFXGuFN436gvMCW1ZUS5tgo7EuP1wsWb8AsxJNMdzezs
Y/q1DcI6n3HO45vyBuD1p+dh8mwrUhdqjZjCAJ0I21f1k7AROXhPhZ7eu7aD1SpPEKMSZ/bbTbPu
9Q8gYPJB7l6xsvqY+BagSds5TPhZk19HcEQLZC+64unxpS7/fvui2wY8VXUZlEpqFWNO8HElVdE6
XSrOqX29dSmnJcF/dkRulr3nsC3Pz9sCnBgGAKyG9dZDv8T8/1IjwBs/M1kkLavaujp08PYP23BZ
eJr+eB6VNwOAO/PX0cPQPGRySb9ul1OMq433rczhgiHV1nSLrjTuX1XibdetP2R9QDf5gKo6QBBC
couJl9pJx8PXo9yUYcYPx77tZk2pk2ASUNcvzYq+x0vI2OPK9vxgS/hKEeB4ZYqfzjytFOKNDLUs
Io0onJdkzbCt+wftXZeMpWxGMLr0h1rD10h0r7BNbjxo6e2AbcP5CNWiB7sM7E7fX3yQnXN1titE
3E8ycAbHQ13ptvqlZlXELAXMa9phIco+IFe+cazKzqcunT7nrz4QZTsWRt1HVH1GNh47KMt4S4sV
EBAvTIExgEAAAAz3QZoVTeEP8mUwAiP/ZChA5OacjjnxkZ92tPd5cr/rtMhpbJeqRUYQdImeRcK/
nYwImOsBtVKC3O8sL1nMFl2SNhNKjbQvinPXHiJVIY2X/ww3Akvnj3dg9I2sdyb9q/TiOJ9Qs0Ei
Hf4tjDrVadaRvZcTHMeY70rfkF4NhzzutR1JkZAP5GLyaN+gZu8LLGU+GE9KGPIjG+AIHg3VPWw/
FEPQZubIGQ7VIVQWWEu9G7fiqdnD0SXSlRVSBk68ccbZoE5lVmXM2W8FK7OemaX9xg5JGynUmi6C
CpDo5e3tf4XZn6a1pnlODZD5BOeClYZI9iErD7VT34ZdUg++IJ4u9ou9dDmMXINoJFHtA1VkdoJW
+yOdPHFbugtXg/K3ocwHLvQgWvIc4/go1j7Agw9qaAoFlyvCoDpMLYty/fjgHufG7iwzW9nFRzpm
VrzM81ct9mrQvMfsipZHp2RKF+Ly9qszcRzpf7u2fUke/wFsw3ABTl4MwTX0OCbNtJn9M8Aut8Id
T9lYwsS8Cn9erSQgAYjB+5rkRQAGpH4P1DtIRMOgyB5GSrxVgYMcG43FTkncexnc7cdOJvoR9COl
F0gdQ4V3Df5RumjQybZ9nbCfOuPVelb0y+NJwjhUTNR+41SScBc5u/Nc873vCoKyo9E28AIZDZdh
pQ1M12Ak0rOuGAn7wyrFAlQQNZyMHfwkLN4XULzYJzxpHm2qZq9N5gGDACw6sWB605HkXCVyV1ce
9+fLIl0MDO33ArIhJiasnNmqZHdd3NWj1DuGBJ7GcL45/GkwpJl+UvY8jS59IEa1h1qLZ4ajpOID
RLbdkwa0Njk1aSuXhXGwEMvM8/KSXZIDdUznp0Bm7jMN6FyOhGEnvQcO4FQCKigKwK2D5DfmNaf3
yuDDeUGoYUh1yx1Z4j+lRQbgM4W+Dd6MUxPqw2SzNhffAo/gKVCZ7ZCJmxdecgFtFiRf+PdCkk3T
ktC4pJgsyohhdmKhd6zHnFY1W+x6sYeYaUB44v7YMBZIrytpUEhZqCbt5mpyjFDFoyirolY+J3Sh
a79QO2WV6/qR06i7394JhfEtQ+Mhh34qpJ2MQA2feT0zqULAd6dTLDKA1fEaF8lN1bdq3U6vfKYg
Az91icZodW8XbN8419Hi5lX8DqJN3Cpm4skC4i2sfihZGrOl+ONDvbSQUgmfLyRVwXZeTfUYyoTH
v4lSQkgoeUEnbubX/57ytYRmJJh4bgPyq3V9+US5K6owOBJ2ZHOcW12hrg0axmBYhtbmrofYBhfA
csKCPNirB8v1NAip2t7xqGw8Po8mxX8BPizun9ogy6ZC8I9kFbgWdnW0kG56FRQk8Gx1RYNrOVot
TqhmX0MDdGS1bqa3oJabhTuFwGzdV62DC3XB4b4MCXkLfZ97K0Ph1shVcEGqzgQh/MDhEOeTdug7
v4ZbdOqfjlxiZcS2pNm6o6tPPFJtmpsqPrdZ/THcsolnaMXPikeBfrIOG5xDNXjWn5ucjJyIf54g
XuDOkx+BnhEYV3DizGeXSw2SHTT3maI1MCBG9sNQIUimMIUCTP9GzyHAHpzY2smIRJhJnwX/0drg
IUw3m7i2GyPkZDv1nfrKiTUyTgqiqdCzaEPLjEk0tt3QypkZVl+NrhbzQUQosfswrDidjDDiad73
KSEIGiW1HV7usnbTrEoHT5jPzBVGXUtxTwv8LVLYLBkR1liUaSe12rWionqLrMObgzz4tVF0AIUH
rPp5MSAe6DY1HOMvpYLmNTNDNnwVVHvcwVoUE357+ZdQ9J3j0eohPvmD7Yy3lqCmLnhraapSWy4V
4WxXRRE+HV6r49epP+Ym2n738pzQmX26WXmlSsJGRcvoXx9lh7t/PND5k6ZAM1mxCZR4ryKYRQiY
S5QTKdFIQ3WcQZxN/jZo1z5CRzkj80Hfdd4xPM/msh/Jx97eNgBei2Byds7fzkqMbL0eaOC9ASvl
GQGIi169/0oNuLdRx9yitDcDQG+rA60XjFheXoXng6ddfvPH6awbntA/4D+x5weNVcVVA7dkWqsC
8PwNozTrv6b09n4axqAsuy98yzUbk7+wVe/1X8NIQq7SiX/XIeSznYoVAn1TuNwU20g0yV3DA27M
UARFtcRhJ4p25g/cml78dXaZk2E6vPLOkEXPwRc1kJsQc0XBv7RZqh1HsJ3oVAVMhxla8H2sIffd
qiNZDSwgYvKw7MIvlMCku7Iv5YheECX6lRZjt1sHqUmjj6wpJLiv7dZ5XWsy8nI5voa0K3hpHxfY
PHvVo69ZohT79mSDYcBGIHz0IedoisaZMobo4q+zxUGYONNA6jCE9qfEKBmxMHoX3z77nY6SCfVE
/A4IHg7F8kog/WdtaDgsgfbKx+FO35gejIujdPVPXncUo2iqgz/m8/ZecAqzcuLFmLp5jTuMRFRZ
BITu3OiU6F2rZCVdEc8tGK5oc0RplZ+yx9rR/rucb4KflLsOHwVgIzQYm7zrQk0m/fY+Sw7XtJGb
rVMa1Nd4OSuQxgeQCZD6a095l8Tg0tDohS1uEVpsvgYfXb/I5MFmgSs1hEDrIZlNMjiyaCzyN9tU
FffN5VFILkXtdXeGO9YDwMvEVPFICuH0qhZ0OYunfpz4uCOh/g9ZoulFrr69FWM2IggBGXPmIJLD
np5OZxB1LjHLUXk2I889YEJeVE4flFabq4EQltRgaK74j7IGMxbPyPdgj3Ivw3o5A9oBdyHjKW+6
RjwdD8f1mA4g+x7YI34TP3jYnpw+EwYlwqlvfaEH88gzeZ0D4zH/IIzROhxc8BcAPXhJ8u7pMAZy
C1Gq+ZT0STrQ30gtE4N61obqT5YSu2jobZI4q9L8HaavmppGgxjK2dRkOqu6DanAw7BTR8nsheb8
vq2cunMX3ADGQC9Hs7xfmhPh7bfiHm8hzWD1FQnmkrxIEt7bOxBskVyT293cdeMvk/xiIDCpcm87
iUSvhtJlVMyAx93K6YZfngaVXkogVx+I3vTi7nC2xc3iaGxcy5PvtgWfo14/34dNsawB2/M9uPyo
Ow6lanq/riLTFFl4AhtoWBn9KDKA+Gs3irCymnTvAR8wryofnnfdbI3/YhMwDk+o2kr5BKStMWWh
eFEUAb4Vbvjv+kCi7XDSzDLZHCK+rIO4YPkRd8mujFVhFhxriZfspoHfEojWjkdTSjNtShxg6q2S
l57RXgnDrAW+oRGIRnOwv54hQMrpctFJGwagNl8K+meJXQtAJSzegQ+aBvD8s+62J6lxMXy7O5Xp
9qbw5xWtAp5Uf/62wEIE1hg3JeRFwVxJlecvl0PRNCaeR9HrWDly98FX/HEuC5n0LR47g61hpLpy
SPAKDkvex5AeZTmXvnVvutzZM49U4Q9hxNfZ0flKGpoZr7k1HX5U3xoX+5UoKbAtt4c/I4MmQjO7
TQA3zriJcCwsnP8wZrXbw86hmFD3OlifFb+Em/6PE2JIGtIM8PggCyQs8j1oKy05XURgBDusVXI+
lHdtuRmXYQw2ZViP/6BtdFOmes4XJvaoKQwrEY+CybtDZlsSZVDLJMIbOWxa/Mk1J5eX+GEW63+S
stZYOnf6HLNg4XCxNzeAMBcFC4GETFdpttRASur2Jk8TZe6L1S+2gevzuBNTjG+la/5xIcx8sTiK
BW8Ifgy0i9BLyXbTWkIZ4dukpp+kmjc4olYrLob+gKRZU9aN6TCgxt3mRsBnaa2it69dZRQ/CjL4
Yn9115kl4nTHmE3s69HOi0k7NroXCWW6svwKOSpfFL+l41FPlP2NSselyypHN56mcI52oQ/7rjux
onhgYpIIDktyc3rfAUJ7X11uyHWgfRQeTSfxOmZ45O2g81KxJqChMj8ERSLiRZyh02qbB2cnd/hN
GhcxmGwDR3ac3JrHPNmaPFaAO3xjSSdjCDtfD27oPnrepslDVIZxA4kJGyFq9bliN9NDnW9j98rL
oNrSuDSbKJiYW0Lv+OBf7+4Jk5Fyb91xouaIJveulshF4x6VYGughV9nsCqkwqx25I83IZAFAiUn
josM2doUACtKSBK/P+KyToUImlXFop5bqName7wjAieU7UqeYUasKvbGqF++rqII6Ie8W6/BjKSH
+4uo3uXOA4EvxKQDkbVQQgWl0jppJw5sjoeTOiKY9dmqBD3ycqwPWtWqLoGEtw7+UHcFed3/1hVg
K8t3ERU6op/pL9dBwoujbXGvL3+QzyIfkCvYhSTL1IYZqV23ZGJOU5VBGMoqIB+eVwX+KojbWbuu
t9t40c66jXbIDTahFESXfGfTRBgiA58rYR0tI4XY1sIl9W7YFKS/CQweo/tnx/n2fFX3q3MlICrP
Ma/NhCI/pBN2VjiP5ZFkywU7ijTJszSOwPeIlkWYUi2/rDZLTtzdz3636PzSXrNjrVdr73EMXN5S
2ELXnHkMaipCOE7Jz/pKEg2LSczBmTaiwQAACzhBmjZN4Q/yZTACI//FE3XSY1Vch4mrMibEmWiO
lY80UEqb0n6yH5qEEd2GxWS+Trf0CBpKGZrYg4l+YkTq9DtOzvLQuZJSERi8Lx2ImE5UqylnmwKC
OmAyZJsTb16I5lT4kkCDX2Jsw9knc1BvNCmqsmZDqW6xtCbYi4J1tUp+a7jR2Bjw7fGqeStRa5eG
MonyRXDeu2dQWKfJtw56xoPDVPfaBBqoWStDL3EsNpxO9CHMj4OHZGLBYqa5Ob0SEHhGkreHZMSI
R9OwVQf3SZH2h3eXOIhlPFKhoRGNv3lzlSNLry4mUsLP2KXRkFbhU/tV2M6Hy4zAl9SyPhzTkbQ8
jqpST/6/eK3iNvlmR48Mir29tYzMIbe3RRkM1BB+bmKDXMrtEk7c32gFj1mUnOR3KOr/XbLBFdgg
2lIbRJcdsOzv7WHcbzZX1Hw0ZIekSr8DdCwD+eqizYNozWIl/jPBWeY7R3ea0NDOLEfIONg9DwGk
6BKWrVzqVq+3g/GshsjNTw95mLmIST6k8vDdpyjtnBMbSl0UAoxO3+tnCBc+CKVVh6lakHjG4195
mFanGcdoXFAe8TdCorFi/TpGC9U7SzBIbL1z4tXBzAACUZBXaFBxlDUtpqnoNFb9gqHJDHMelIoy
ko4AvyyYZM2l+PE/9hCOx4YasGECeoU8hcEsG3PRGxxXsoZQ78mkBncc8Pui7UM6dGTzxHGsy7d1
IPGFF4oCmmN85BHVJWE09vHZ3kJHYYBc+Ch8J+kZITur9gx59yQ/hhaVzBc/suxV0Yf//7UsF5JL
LR1AwF7+Eu2mX7Z2C0eA5YadMvWiRYeUdWgWtvxxBiT0hSc6f8fzeJWgupAcZ/+TrjiJ1BpMb9ft
MBntWiwfElWU0Ol7RJW+x2hQEqMWjRc/cgn/mxBuAJC7UZrIYp6mMjK0Wzze76MfZ4F5df+OUlFm
0iS5v6i3Wdl2okBE4oq238mohurfk4lcAIoxfOO/6cm2Zosbr7MyWl/l32fnsvtRKVcYY7H+YuI8
aTFgR/hmwhKTa2cZX2KAdIebJ3e9Y5ldgK82O4aXiUDAg0B6/5wOoXBV8wapDB91P/0/VxaIaKEJ
56Q6D5/pwZEgDAUOmdK+WBXSVJk/3KJgRGtCmHgMaEe4xdWGtKe0o0IOrDkDvyXd6b/xioQG9g4m
Vlqf/XFa2nEsrpn9brUEN8RyPp6vbOuVe24eAE6jsJq8mDp3dfDPO1Vl4phTbQHOMCn/gJbswbAY
6drwY0cvfwkiLv6nfbKlNJwnr8LjL+9EJ6eH51EEpNASH/H0F5nDyuhpPEJ+1L/NU3g1/CjcN77E
8jx5cls76jPqbuWuSh5p+WClm8l5W8oQd78qDcbLCUhvM5QMTkNpG3LzsHTI0lubS//uO6vqAUd9
ZJXPulcOkRuCFoN9luOuK9Ce57aLBOgjYq51Ncts2i38C3MmfZRR2/4O+V+IHppjwqJA4AWUBcNQ
eodrtjK8RUt7848uyqM00sj2vixz6aZR9kBQrNdvRqE2RQgbV1Q/awsj5abc3/MD3ud8x4oCN9oq
BoW/b9tfg/G48EtMbmqHW33rgU3yMX1uaUoxSt23RrpqchpCch66Gm4fxpL8o+Wy6EPMSoFUUCRU
0eUBhnN903HkJ/MAMnpZzPnyGgmVqbGFvCCdBhcuei5eeVg2BxXkzra8uZsMD/UumegXl2jFZFjp
jmSL1XzYzzSugl46bjQhXtAABLXY+Lfi28q/bxIn/0sRKC0pnqQ2ooLGabipu/wlFpwNh9BtSYkA
TeMxvD/B/aRmxJyy/TP90DWS5Mj2VNqiWUWb3rni+oW6Ba7dU3XdDEiHQNhWr3OCNfcFm3q5H6U0
LE61I9IitzqSgGQ21OFbvkGzmVFOCCdGBTvIkC05mUpvp+SsYEnj0Zwmupuo0ISwxrbaCNGGfpQ3
9nrBqTVISSFzC0iLFHxvH6taXEtwZ/2H32DJQWOZ/vNg6H7jiDmkTWn15NlLk8EskGY3TfyCyHo7
8OcmLGnpQu0D0vbvZhI+uZgmH5QNHFpBtu3yOyUb3EjnKq1tcWnLH0RezSOVen8eivlDK+NBoV8D
ZsaLk2V7xh2kFBOabYHGG1Vai5VP+zv9eKcP3nfbDKCsdgqo/gR7hBFNceCtjGg7Mgbam5uKdoMe
HDV9ttIrelCWPqx9bEBgXR7+9Kvn3Xm+d6G7TEI1D03+gAJec2TxkOZCSilL+2eXXeyZ/dDe3BB0
iLrP3mT6PntlQMGeA1BPIif0HeFKeoUTjH8v7ay2ND5kUSx28dyyDPgsPJWPllD9upTc22mSrbpW
V0kMK+F3p/cWb1TNnN3KVtSdYi84RdjcQteMrODv+PwDGDkjn/wAXlA+eZuNYYK7cSjRDqKtiQJ2
4/X0HOneFf/TjIJFUr49XGFwWXQqmIXuyE3KfPT00Z+0PJlcuDTaNh4t/TI9z+lsQtAiCjShNkQW
0z4V8hu8FLX4wI33OWqC+xxd33FzFzj+bO7oIE+IR48jL9f57xNnOzdIkmWfD9167/rIKr0E02V9
tQDNJJDWpDjeNeltNyL9QRiIWr5emMYwQSb8e83x35el83UKhaGq41RZGD/Wc2hlpf8PC0VE6nlB
YCgHrcKwMzHTS3r9nhRg+s16RMbr2/z3sa9I+T04yb0UimcRQVxrfqRenrRLdjIiriFeZka5t+CE
0pkAaop3FcbXy7HAD1J16ZTXAJoFWmA6Pxi4/+xX8x1mlEFVZJZTf+auw9N3Eov73aDIGTS/JUHT
l1dh4Hcbs9aGA7Yg4iwNFwWLb2VZLBOoqYETB1lioSqs9zNwdRwloaj4P6s0t6FynzLMd5q2KWU9
LPsWqPPTA7gedgHsWGqY9K1NbOTWqYJgM9IpmC4xnw7llz8iw8HDw6ClRziT1h1B81/ng9zxZaq4
ffruPWi3IdrlTVje6G8hTeba5QNzEh0UVewJF/ES9BGYTUXCB45vYZBARzh545dUiqejcBiwu8g6
Kbo9VnY7vNCrzShdRVytepjQvLxKqwStwjIm8nNLsac5zirLIlMNhQnN8dTjxmd3WkhMD0UTF3wx
hgcm1Nn9Xtp6/RoViHOqcX85bIrzFvrsXqK8k5qOBk7fENKy+1KdUTxkfdUvDPwQHerVZ1UIwiDm
knK+BQAl4Tf4+zzjYwqVdW8OJMDeku3pbUnho6Pq/7yl7SsANqdBM5tWXudV5i18XLyqikykpUQ0
8yfZR+n7kQs8peeIaVPi3HgB90/3xfwAV5LsYiMW242FHBpFH9ujWRyUVyGHqRmkmjDQMdQiynBE
6hwGgvfW064GaBYcm6OEtrBOeX3aAWlR+WRdA0YqHt5Ni7mATqIPIri50hBHVAX4KhsI0zAO1Gml
zhj0yv3iV44MFhnI4IFHM0oj5h4BwEMNjWe3HDDQesOaaVGYD879E8d9/iQxh3NNrYJUj7oeobrK
0tpqdoc4NRcG1PX+BIvCo7FUU+xW2K2FOFFcvKjCIjSB1ikSyQD+wRvzEpBTWyjHrKUEPeNc6OW7
dzz4TE/Y/o1JLWzh7xB4CnR9fwkKwy3EpSAGrnm6LKI9SXP8LDCKX1aG7QdSYugq7/0RNUFaeKEh
V+nevVfxSxAK13C7VroKXbyRIv2zndnYlqwrTzQ48BlJm9v1Pr6kWU9WLIM3HseoejPUEd87TMHg
udwMPQfh2a4t6HsJzfJxz5se/Ua+5yc8z5u6fNzbGNK9++yPbj7QyJDksa1inPQ9wv4EmrlU5mEL
BvbkzPItjDKhifiYHnLc1UyrtR1+NAlI1eLpK7UI3OHysCryjqvEnIXTfczpfYm/c22QAAAJxUGa
V03hD/JlMAIr/8N6J+jv+ll9TJb+7A77RFZV+ZsvwABjXSoxLISQKsPqZU+GD3574wH2f7QUnGeW
YDDw1uEJdpe2WECO/GQ5FhoaYLWffcQ62/wkbenNTf3BxvdBEZyp8xCYdm4JP9XJRenuay7Ie+1p
GHRhZUbclvRzFZojyiA6CnqkiDSV/xegA6gHSeFIgt6fEsnMPMucTvz6kjjCr9oBw48LihXVArD1
bLN6N9d4rSwNGXisS0LiMkwHbBV7BXbL5YHvwJKy817xRk2GO7dQ8eElfQBSb1Jj7REOExeyc8mB
Y55+RvWVUDBytaxw0QoCfelFM+CglFBpb8YX6O+5GmurGG5FB5Zn9t7iEVwK7VmFdtS/PRyYZhPQ
PZeiRaeJsCQGgqT/kKQ0vSy4+jF4D21RB2MRoGt/hU4XhGpSC8ic36ih89N3lJESkhB5hcRIcmxx
Ni91qBNc7jJIfBtEwM/IQNbdYSvkg3rbVlUAQgJDWggRxd1aTZilurAq84o+7ySstlBWgKavy0C/
yq7WCaSKuapVTDrY8HguUlNhdoj4RiHcFxrTZ8Sggnk2D5UINditNldfYnDZ2WRfjNpUUMHshAc7
ZUY13FsO3EI/AHgnR+kIsTT7gmEeeZ+A2renfr9n7cli/mLg9fa3HcjrOvI9Pyfsb6teIZLprxR+
USF/XEqUJbVbuDGvR/EfrsuAgWH+V3FYQfASHzek1V/68tD/Ro8Qn9mGVXwpFuqE3nixt65bFc+6
TvMJSlNJBEyAheueqT5qkjoH2jBwyOpMOeNZVBKr8YdmBK1q+lY17/1pYYqDucmx85BSF4o82P1O
sa2KwADosOC6/cZrDUfJGGBmKEvxYFovmAQGiM/fF5yGHnaiVv1g9Lp7jhL5/RM2Y4xE2+F4kSIF
AKqG6fsCt/LxhL2W8LpqqERgnB3FPzOoKLjxG/gnrBzB4WaMvk9vuwD+Q+GIICLqzfwVvF+bMsWQ
/k6IijmvhgxFBBfbw0uDC0JUcR0NL9gWWFTtobdEWAc09XZQ5gm2yT9O9AJ2jhCZ7pAAqzdOUWbV
ixUiDXOg+L1B1113TzLRBThEyWCguS0V24Tfnrc1M2yd9uLVixVOodKmyllJ10VDoYBj7y4s1wrp
qkgqiMOSAcQjGK7jJQWn1tjiOlOHNzBi7hmDC552Ccz0Cw4crpts/uZAySEe34GwWo8T6iQB8J1U
I/vs43UZKlJRy+DULkFPacH0mdBjunTJPgt6Wp3ryDuAXDsBM6kC3aLkXS/MqysHHi9OnoELMHWz
OE0gPhrvj6yeEtLDNq/R3T5eeU4u/Ym1b0HhJEcPUzOXq/UW1PmJCM++oDeXD6C7XFHfE+rcZi2z
oLCxrpti2t0154NlkvMsRjApMmCp+WJZCuRo55L1gBmi7Wd8uXLObFpApfegpqt1DzxsSmYgoPCL
QWlyOxV79+6ufAkMgiCo4W757WDm4xFMYYltIYBHctXACXB4wJB9HJwKxaQTTIwu+iRRfiJ0Ayc9
I29X8R1EGziuq2xDewerghu2ud4EdfRxdFDyf3cRPr6zlZoFotMfjtoQM4Mam8e3OktyEsIH4yEZ
SFAgzeOAF0cpVNn4PHtxdEr4QG0CJU2s26e8BCqaJEC4xLzWYYPtKhPjcjXobBBwWPDitzzqzber
aJAjcgJp84MRSMWZWbLpaDrm/Cq6QrOYjJzJlx01P9+vRjNUSO0el5oNzqSAOEz6feAq2JpFRkiZ
rwYYsgvA0a8XeqqE0A7CgBatFPDA1IV9OjyGSKij59mOvn7MDLypBLfd1go0hm5ZT+fvKKXJ3Qse
c8EOX1nSVYxcOauRwek1F1OZ7xxqydMT2YwYFxbEj/4oWZBUr5fc777W186Hd8U3RzJC0ECQsMni
Gi4tebjvt/pa8LUk9zSpDho8sMEGEE3A1+1lnng5AYEmlddSZL/92hml+iuVWnm+rmu+GpArZruK
Di6zhatHdnO4w4RJHo72gUDhGoXKbNMkvCXlFN+hAJ/rgiG3qtc2JUm5GCMjBXm80CK2v8+WTQKQ
Ydx9mCPNP+Pa8XqOFjX/HRCncg0oNlIy4WJYUxTxVtvOVVOhAH6aVth0TSRhEHXRWQTJT9emGa0X
BK24YJujsoriK6JQQvrtFKfm9JZHvihrXuk6zoZ1kEZb1IjskCJG0aRzkJ03Dbm5j746CB99+t0k
kw0fvtJwdD1tn7fbaHm2gm+87MuN0Cn5Y8OENIT+WG6rx2c0P7HC9VOyGv9KNQPW0gaKyuvOu2HR
dxbQWSFFwW4a90t4jI9Rf7cTFcXuSsVcsEnK5DHlp7k6Fq99Uh6qPmDS7hsr6MyUlhX/aBo4oq5M
E1z6ZQMSCYIdE2TWLFamXYqAVIXwXVruEnCkW83S7AYWRJnnA86qck4q+/el8WRxSbrJDHqwunOa
vRNzZyUM3MH9Ev2Y865ahA+ug1lWMI5Ihw3yvh8bZvLSwAx9rMABvG6eIuh+CEZn5VqVY+ujAq9K
0GhnEPgMTC2JHkcza3vFJPtR6mdQ4uwLDCuqahJsupIOekZfR5MsG5cjORAqaqBqKStimPqeQBuO
+RYYTfTZ2Ai8gyN2pnvhhkXAM+G8bdQCfB894Jdpb20lfUgJ55rdleWRsKC4l3ucff2urvlGbdS+
IehEjyNwW3MT3hNyAK/N8FM5224JpdrktKkzYDYuaNDbNto7eqGL9Ky+v2Yboiea2Oo1dmqHCCTa
w1Bdyd8XGoIFbhXbE+1WXcQ97fwYdRKy7pZ6hbwFHQiNZTpwJASkIHDe1qbjfDBk9OBQQMFIIXI9
ZdT+S0KwDGsf+q3LNPuZtWM5uxiGI3uUtkmtr75JxA4m8ZEsqTAG03hrcQ03n5GLEvd0YZ2ukFuK
3mZgI3atrgTK6tQ9hTubCqj3KuRHMksr2j5J/mBvu35LdjJHxXOi23XLEUIMGE2TuG5Uy7Kae0or
GS8SX++U2TPnXPn20GcC/Fa3Drevshjf1BFDDLvOXXTnemv9iKMjHBed4INQu8ZMStv7rVrTBLwr
XTTs5LVCTT5b4kIOjcDSrfnYiopZvE47hqWcaBogsON8S93xxyOER0z/WmXjFClui45kCBKMR7WE
b0umb2YXt3Roh+OvKmr/ESCBrdbKpLyk7sg4qbdbVA8jWx0EvCEAExBC4yfJ5qzVgY1DQmSu6DMk
/rG+A8TUEae7o42RFuR5Z4gMo+Ar28ViM0nQZJgLMKyho6DsyqX8R/060gnGY4vaaJpMaECmMit9
KHxJOWTBbncc34X+Zk9fWFEyGnjqtkJ5vyvnrGROqSGQKopp8ZPiZLynlFybBxqRAAAPgEGaeE3h
D/JlMAK/ydrtsPCpriNmhMQQd3YyFl2UtnkeQNlLgbla01N9XSh5Su0bYIen/yio/C1/+tLeCr3Q
nU4X13aVWTcI3Usyi/z/xr48vUaJhlKWjr6sFkr6SG/X3ZYzPRzvX4LjntwL9GLH92rLdZW6ipjz
o4yzmDuZzWLEUG8N0hIhIk/rVRiBWoV9GdOFOJNQ0tWCihSjAlsuDXnQITGe9zGcOs4ceEdXjnKR
Vh21jBMjhwV+lymzaXl9XAuB9a6Wz8I8G/77ObOGB5z8Lu60y/4c3Jm27J3YBuT9/JB7fCe3D3iW
EepQ/w8dxUDOPUPtAj9QzIkaYxg4b9bla/A9STpG3oukosx69SDMConu/noHxzouBt+8/aJVcEkJ
c78P0DPg+ELxbIDV2bYt+ulBMzvPxS/skyQYUkkuksCyZC0WskzICDjeW7o2vOW1uxihjWV4URmK
ut7LQ9pZkTSb66uaC/nw5I76Q/dRBwVD8iORxbBCnQUBa4zzk1lFkPRVWu+ZW6LgUZxcb5xJyVbr
8MXxvi6gCGCxRn1oRm35EUdhlSYnaPLFEv2NNYPNXP2hLpuSVjuYh/0j49EqA6UeOeBa2KufmJ6o
tgTc1MeWO17GIw1rGsXT6vDp75T0Fhdqkevm7I0HgQS1mVN/hS/WWe1czlTJ6YHQPbQY3oPuW4Ck
z0yoS4IPwe0+44VGEp10LJeC5pxPzTuwnmCDdVa3/ZO6yxWH8lNwiRiwQQ2UM6eVDqoqQMmUaPvn
0ttgJFy+bDM69v0oP7wNPty/22Bao+0/Ffd7IfaeilHcQXfmTnoeUq2eNSSuAc94dQVtf/bfzLxI
gN4jyUUi3L/4U0bP0VD1uGccgL7Ype8cq1lkeqC6xEI1HKfg52qB6zy+N7gOqyYk3CYKMfJwz37Z
dMf1aEjrWkeQlHm/4qU0n86x6UYW6GosLJP2sumQQJAxUzTshDKqfybGb7bfnP2C79KbOagM/ynb
uaTgmJeJbEAI4oGozK1wjYsek1tnV3sMgxGURL74rXPZz1xOvw83nFGmhFLXwhri9ngc9ek8j0Cn
tILtFF5KRTF/DVftLQkc9A/SgqXxe/c8Yo7G017oNv2+eUfZ/M9fqXx2H+0puIb1E7mwUtRKceyO
IFDpz1cp7Fl4uiil8iIhIricpg/JGgJ+/Hpa7Y5CW4iwkHhSCmZtv40lm4kXwk6YvMMT5tQJ5ZDs
ts7djm/ZVJe8alJGV6xKEJP4BY+kjx7+iPbtACtHnAs/O1uCedOJVXOWJKE9Lvrt7eKdvB1jGupw
fKyy7m/di7s6u9AG3tN/ZynjwEcgJgA9RJWJpKcfUcUzJrnP/4XbigSALn1H9Olk6A5u9qu+RwIs
RrXdPCFS77MZZPZ4Crdvp24tPsTAvMLQTif5JqfBLgfxI2FkpGnnLtnDjZIiCJmBpCnofCfPffWZ
qH/BblLgvP7GxDSuNPeffx3bHQkKDy0+ubJuzz4AUQaL0tdrB88bnkRDdGmHG5z11BLbcUlwhu7D
GWv05EU3Rt4itMJsk+ohvqKn+NcrR92iY8iX1XE0p2sayltm8d6G0vbqFmSmufshhQbZHUGBRbRR
HxZ86/jV5sa9dVDKRXTBz1nIhFL5iDn6gVvc69u/6gVe54Dtuieiv7PXAmofL/Dcozsldx14+IrB
wb+sKrH9aPNc0wpmepvkI1QyTDp9AOG/ymm/y3zGk4yTRnL8sqmbCVvi3hwIDl19GlE3xvMVXbMq
tCoec+GCAKz95v6b7ckiewrkKObWJh+8S4+rO1zSwkdyWCHcx2FHncRIIgCIEVH9Dr89P7HUXxeP
zvHiAMOQZNQafX3tVcegBqU92WeGFZuV4o2FL4yw14qLHJaA9GgSPJWLytNy920gecfK698KwXka
DsnmhJwOXWkD2sPoqTN6xG7UCfl7JOl05gz5K7qRMXGMMsMM4DBhwIeA+ilwm8NTq+iI9wy4Om26
yB/V6V8WBMAhKIytmDL9B1aCifQCu8uUChCJMvdJaQiap1qQf2P4yJE2n42YGqjX6itfPPq6ZKxs
to2H0uAN/TDZxY0aB7yD2oT5CJmxgDloeBEE7GQNiWjzboD9HB5oKnb4VDgdGrnNmfP+LmIRxV+B
7JHKwxefHX+JAsGr+l0QiHuQtdpoGAQCa6SiY6NrYkpF6/9mWvbQ12rHzqJsNUKlR+OuSpw+6kx+
dcXg6y1coV0e0G2gvqMDsuFaPyjB2MBmfIDk0uTYziLClX9lq0MFiKqj61xCfkw0VyBSBRiZqi4G
KQnCPHFyTtC0FxSCVcH242G1zWjyXAVlLAtn52ALp7XFJuQ5f0mMujY8q/iJ8YJyQJIPmht4ZBCw
Eh2qLO9iCKdVm4XKII9F9D5lL2JdREYxcYr8enJvLPonUnU+GSLZve5pjg3naL7xU0OenNQntlls
uCISdsPTirtwvlkrUeLSEeMJFLqga8/GKvn/hdQITYE0DNqoXWibhUFefKHXBimYo06Qokk5A+6n
tOviwY0cqWZws4+5ge/1sE92AnD1oeynXXju7xIjbaOIBHGHzmqPfT0O3odhyLhhLdBT1LFjVc8J
GZH7YAyNVm/CW53h0jM5yo6Dq5nymWFpUlnImK7rxcu+LrRxbeZondF8s/EG08HhuB2M5W2BoeU6
b1ToY22uw9g/AJvgusfMKEHlUuhN063M6YA5DHW9QM/DVf6dorIVjXFFdheR/VbwVYe9DP44ZCoI
kpLk9zvvs4PJhsUkYIK6XA8RVTyCmNM/R77/joJa8pnMQ0BdfUlPk6kdFV/P4G7HtK7ZSGetVuBF
GWDl0XGrrW/BH6LBv0K7UBgH/p984vu49qOU+8I8F2tqE6kDZHV6uWFMrCTAK/W7l9XUQnJn06Tb
0wEwFP4amxYcaymkEfUwL4tacegwy6iJOOZJm63t5uxoJfI5dZU6ecxxPu2zdOrvz6vcky7bb2HI
APQmGPw5QxXYqCumbp6Tj/lOVispf0jl6U4XrkjplURZmOukgZyUxre7XN2ifrh9+r8sCZ3DJoF4
pJPFyCAJRC4+WbAssxB8krNqOA1iZlpGxQoJKTdiK9cWsTDddQAiOwx1v5X8kdlNlsb0emv4xy+p
5qB/Bsjygq2pLkCAujIscsgvQBM7EYz/gNRLV3vewIDjX1/VUJI09kymkBbGngiwpnuA/wSv9+5w
SKYaFFU1zeVq6GXZc+PWdpUczOXs6PBiJCRqUoKlWirODUGBcdHkMgvDo/Tqs5p3kdFmMVRxIBuh
HYV8TbycEvDBrdMvFz5bGEDgemIqtxc1VrnO7bCjnM3+J/dCv77eajZ0xOGeByJnxg84xIlUdMRd
Ykd3Fm5vKK4N38F3s6Av21XHt2VnoVTcuyXcY+pH2CPHXIvVbOpYR3ILCVqeSkEwzfjpjvSrcrir
CIrw1txAJQSYwVF9QqljF3UbYUHWMrxkmZIS0w+v0JmUGNPYMm+a8CzSIF67GvOGbFLZx9X5vrGD
fKEtKCaWOgPfsjffr6djCgt5SRb2zrFPiZyXOYOTgc3GYdLJmObLXciYfJmIigHlgMyDWybDIvrN
CEJu//1XJlcl1HJPELPBxBws5TxB8RiNly7aFBMYeqms7HouNjIM7Kg+BwhHyh4nEJZ96NK3yJhp
YG0ojGXT9Ixzg3sMFub5NwpclnAnR8Hc+UyReKQqVzok4ep0qxtsCU5gAiChuLuMar4Mhoc8Xwmb
7BaB5+7Yj7Xgu5GMsc3pxFMHC8AgXGMgGpd8n/Y2yjtAJgWZJ3FTW0Bt28Z6B+34X5El9yHpeeUb
6vF9Auch9Oqm94o7UCBUxqjKfNanqLK6iaSrWLEh92j2ZIkN1cwK8iVPmundf4tTOUp1pVaJARLp
TZ6tsAYnWIBeDQ5y42bU7SOX/5kdwYl50Xm1PNWaekaVfYeZ0XcqIx1L+XkVrFFXSctWrW4Rl7pK
QtN/dmmJgO/ATPnyq3g1QeBwKHcKMaxdFrU/iV3EGRaFvk7gmJjCTHRV+kdq4iyQMrPcYiv8bHQM
I9WZpUx75k+FnhrlwCfTfrAveZuQpsm2JIu5hrzMgM2eGhmNw5hajjw2j9tp419O8MNxYpfKwUI9
/53VUCFRye5BAHF8+xxzs8MGRuEwTgw6pAEXzP40WkdmV46Zsnl7ssMNfPDzcK5hL03prr6yJbW9
PyY64PSk+zlNskOo6fYbBJS2cAJCvuUBIC3EU55WZC6Zzk28Y7MWx4xHIqGz91eqOM1D8G5fidC/
gKDDiK7fSLZyoC/yeoUF9MTri1mMAKp6U67yZGMCzsNGT/jCWw2pVm7GtpRwCaloKF4p0jDbk+H2
taidEM4TDre1SfiA63vQb4CgbCH0sSiyUiF3lVl3AuUqwo9Eea5b+wSknt01/avn4HG7oEJdujKC
lUa56IRLh1U6k9LQ2cg+BZCnQHhQkKyjpABytl3kGT5nCCpTl+kJqu7SIDMtQSkmkEM0FoePs6AP
8kffyK7ddW8+qjSaiRnw5PCCx+fu5+ciMJ3mZENtkbm5PJ2Hm5DMpJV1ePqMIVyfmc7ZV/7HeGJa
Zf4CO4T0jifttLhY/nJM0jvPz1O9so53VRH2ayYDg56TqdmDMTwi3dD2D2cuK8IKOY7uhpdsSHiJ
AffoYTXVh57EIDwB3+ROBKX+cRmiy5mkhOngjBGur4X892J7PR5dUXRkTH4J443ZKJCT2Kqdd8zX
WLJJYntHDzIojKnAvnTI+SqF3HVVyO1QRKoAq9qsKqJaNFBKqpik2ygOGFshHGXfuyhB3mZGyEJm
IP5a67b1r71M9naR8Rz8QRC/TO7xxxIlcZ2SseLQnjLi8yYWOclKoHXlvYJfSUGFN/WGe6QTPgSk
0E0eSQSPgskBQ+BHWQ3SBz8q0icKx3UqvfcaHOUZVA8jAo1iE+6KtWNTxUiHQaArWUUzvsHVefTJ
zaS4fcbc6tbOtK6lwQsenp+n8b9gzsT9RYvd9sUxrE3JEb9ZfW71wmwrRTz7SA4I+vChUnrBGFXp
tntAomiO6VphZMuiqSaHmRNhKkoFVbtFLLL0oyVp0LHggDbaXH35t4FoLCt+WDB1d2NOLVdzLaQk
gmL6ZJp+ETuGBtW/hWD6RwEFkgIuSKuYW1KxLG9bzeDM2cQxfQkKCCVodt69EEKYJ7QTV9vISxkK
oj3nVqWRlFcPNRm7cf6bkTdq73rOM1d1JbkqNEaBIr6daUSy4ZzRViPkW9g2yijuCKIsDxIGUG//
LyNc3s4IZOyNnomq0Pmj8zFjadmBixKAR1VViviZAAAL0UGamU3hD/JlMAJfvsyC+xopKd6IKoWC
yrtiXOuGLyHNbs9z5T5Pk9P8uAHzE+uyo55r78KisfNYVCyJReDfTto2UYLYNdvWCede65PUaOZL
BXBF6ulEkwOU721hyBQCckv1hsXPso0ROPsWycOVqYjArtfGM+5bZu3186U2Y7D/CBwP/tyVt50o
s0ztavBAK5A3h3OMTTsmL/c5ieGTetIjVxQG64aQ1N9dhMxXdXiXnt0Ooc8HGbqPJpHXNIw3WEir
msDDoLRAmELcIkj5xWhWEGNgQ++9aQ8CXFwAwL9tIjvzTuMv5l3MRO3EL+UXE+a0g0dzvr+0NKYi
ouuDqz+K+oS9vCbAVp8MRI4H/CKZCuFYoqwtivyWCA6YNU1O3iyYUU2CbHyR41IdS6w+w8t8LPf3
VgHNJSA8ijDRPr3zmkJJHR/yZxSfYCz1i0QPD0Enwls4GlWNL1oqwMhNbNs6LmylmRCEftF2sIhB
J/42JuJRgz1BAL9B3nahXjUd34vkBZ8oSm2Oqn3P3J39kUZGezG5+09hpOuJYCkF//B4nToaAgpz
7eVRNJhDjiZvILs5jD/U1C7Iorysm6j4wLfyQkvkFeixZKt0hHlDEUWJg0dG1j/rQRwPxIY9h5wL
JsIU21FLY4acS7ARx8ixtuhnh93IduzuUxuJfwslqZeUX2kEqTfiCBTV/KbNlpeqW8hsET0wS+H/
sqUpd/3NA7F60YXFgCNF6knElbiyd+Msfg7ORgMTBaJZlh3n8csi88WEe0zOUEHFR92dJ3d6d9zw
IgIJZMlWwY8SO36S7MK1uTu/c8aZZiPpn70dcP4Vc9/xCwwh3XGwmlvQX4KKXYx5YbVAfkjSERL3
AnaZuKiTEU9/siGQw837O4v9EF97Gx7YyKW6JfZoAlwcZqOeXrnjT1TvgJXfoZ6Ilig9imVPke9b
XSCvcLnr4maX2deDHCRfkIXfFkxNH2zFfMhRQHLThU+tN+yFWjIA73pI149qlv/3s574TrH5lXDd
XAK9kJCXcyRcJSv4NZQfVsQGGYHss12KHJ4xuxkTdW8txtm7rEJLld9OXfndtRSkSecoLoGBglfY
hU5UrACFGr3TCB4D3UOkYc1FYIZ0/U0ANZeYc+O4i5+V4YaZL8i9x+qjY125+aFOMDQRCFBpHkqn
3xfGd5Apnu3lZcmXKvRlEW4/+846Z3iip4u1NZkg1EDx5Wg22GRD/QKxVGS8QduZaRkSuEGFXOJ9
2HhCtrRK3b9VCzbNHrA2SMIYCveIPhkIA7BIeEdjhBvY48/G8inxqFiv8eKp8leFIXGF3wOfrAXb
p7ZA15mY7v4AiDcdHyOe13Z0CQWOLdlYWkQYtU+qNb1e6jPjE4v1cq5P7RN5bWWICSG0dvvOmbLY
o+tHxpHk6uSNNuoHxJPBpF97RlzDNScir+qWtVRYLfRpT+ZJ055Mwe1xh0uZke1aWGcgoNPqLuu6
67kb0M5jSDokB/e3VvFDq/HLeGWRQ33bcIDqe6M+UCIrJKj3l84d/H+WgiwAtu+raZJx6Odywf2V
j8vzW5DFnKNBb7o0ypxpFzv8qIPwZ6AIdZRxdnXUXx/Fc6GY2YbRiGa6XX1p/uzs7jW2UJhwSdgn
NRBMX/e+B2i7wSgQmJovurEJ6Se3NlsqvmC4i8478LgtM3cd9tQDalh7Jn3ZRVJCyjlW22/C3Gd8
TAcoU31cUe4SNbtEGPRqjvXFTunAUJnmx89bNHV7losBrd9LciFcEB+3j8/hAl+9ljpgNdRv3ast
dehzfhR+MwYhwTBTRKSqwORAxIwBTjQ7XCUMsv2AOWKdg9MdaBdorp0vsIPhxcMe+nArXLHHIs7l
k8GjbwsoNPsNtJpLd3RErjWWRSlANNw2dk+vuXRlLui4EtlrUvUuGxqm9JUEcSnBI9V+SPTfy+iY
H0sjHb/JXcs3RFY8rWrV+wB/LY79yi0zMo7J4TWHgY8Ai+s0GdKSyvLi27loaHltmonm/WKrW/Vw
vZ1LWdgGrsuNZOqSSqYrtKF2kpvLjOiEL6Ym4GdXBzeOJrsrV/p6CYZmRkh1z4eOHUbNg7wJ53Pj
zvocRi1/9xo8ZtlNtPX+ellEn+tp/mfJ1orJPOpncB/GXQ8axezQGCjEi7E4cHKmmleeJUW5+eGl
JeX84ezJDlaw42od6yfZ5kWvF1zax0kAfu91uGePdo1Kv8Camrs1GWhXZ4PMKnK6cwI7yRBx/PhG
YTo9k/xR0w6Yv//X56l6R67tto+LT82VK5L6Url4VC5y35q9PghlhAEXrmGNPldDh3oyxWkSMQYx
oBHE9alB5FxqfC+JU4SdE2B9BIHbrYpljzds1pY7PoTmLZYka0GZEklOMC6RrUULkKGcz937iZcy
JoOhGXAyldfODWcO6+VnJZFRkDDRrBx3FIew42hTbFsoX5xVHEQ5LdfwCTh2627fWcTCnH13Ika1
mP0/iUiBiwP34T5JF0f/5K7mX29jY/Z59wt8Mdm7UY0mF4m/naJFkpfM6WPi605HkMUgVoaphg66
Q793oqVI2m6uJ2in8b3hSr9Egjk8TWnw08R+uo6MzoUkNIZKiDWYmLR46vG7qVrQ8Wo0dyG9LoXt
b1IIXr64OkdiyrgfRGiDyk791xvfhGFDiBAanyTdctnHgbGJKl8UIAyz42FA1AzyEo3rfn4gwVhn
UT6gTTQhj2Hifnay3pBL0QLbvFmjxUyA0upW2FLWRonL1njcCYmieGT13dy4Bzy9daQGMavYC9VD
so8yyrc4ut9Q7harUFEnYvvIj345/Gpwp73B2yJBQvsvIOTDWzZIjyqLAKrHGC9PQZotshMODPYG
oZpS5sBB6wnfdtkyQP2Ujqmju3YYD/u4/PyCwsqGsq1sOF+nEpnuKGyeLwzEbFuUjndpSyEHLDrG
+ZFJSEqA20BvdOwbbRjPWDRdAgiMeFxyUCTB4A04rsjsBy9hkx/gpTEJyJlFIqkb4PmIE+wS+U9s
oRwzGBJOOHsX6HEgc6WSrD1BnHC5u6H5TsW3Y3eoiLIlXaZpooHJpWI84blDJBSrzQ7nU5jWCNW2
2OSSUzbOQyLSKHH4wwp7Jh11WA20clPRL2e9ky6wEHIOtSvCP99tb45OgUpwvFcy88KjP1YIAW32
JWqq8iDq4xAuzUi6YWYWMG4eXHBvC1mwZkwbp7YcGLF8Qxbce4WSbIJqWyCauNXqU88RnO7qLvEX
uMJhy5LohpbQbORxNCnSyJ5YPGXzck1XFYYqc9BA/uOekxYJUAuKUsco73DAEg10sjiVzziXvpjc
iVEFvJGDmp3XS4Axm46rZ3lTT7T5ufqLWg3C/sWtTTsQ5OMZmjO2JB0nomLbrpx7N3sJ50DurQQK
XNiDMY+pV1ASiCGv8u+7uVaiHNqAhQJEGuMKJIcl+G94VqEAsvPgJHKCxIx+1Ki9l8Xp5VAwJKZs
dpkenBQF8/ccEfDexE+WRnyXOv2bTazeG+nhnqdwY46ITlO/hw4b34IMxr2XZEgs2lPEYRvXUWxq
oq8id6ITHSwKPZxV2MaeIj3tb05UT67bIkKGSKnhLns7S00Wpr6hp3lv0cRK3aGYCIvRfKOHndP9
cF3LFfjhcVAV/9Sq9g30ja2HjHAlaL2Ev9SeU43eqjdCKCdvJ4t8GGB3g9It71h8Vh+oAJH06FjQ
r2qROdDJNnRXQJ1NaNJ0hpnpHg6kIaCe5MW+QbuRE1b2mXCi7W96qByWiHP/xuvy9uWpipiMFfqZ
eM7qzI9mMbB7SMyWpZ+MjAwrhtfKKGjKx+N6EfdHUAUEmiP5Njl+9E6dgZR2xjDJ9kpdIiikZyxj
16BQqEr5epFR5KnxL8MYhkKDP2fGer9xknuptKduVETw7x8LBWmnFC5VdLTCPZBAnWuLIFC3O5rf
QoTfiobTMjP7335KOF1tSWpZIN2td8X5trRl31I+aQauh3ixWy2pLFGnv1LbRZ00PK8/55xeu19R
E/aSbCrPVMZ8MqSolcaL9YYY/9i95Jx7WdVRvy1x+Gt6YI/b2F4AAAI4QZq6TeEP8mUwA/+Ld0Za
w3IiE0ZqFfH3KS35GmwE8p1C44BZNfJy3DNe2ruc+ZIx157kmlLCvYFOTLMFq+y373GunKc+rg+O
DC7FnubOWvNFk9kxTwWb0e4LckcAkNRP8F887bEIzDqLqNtiYPwcAqDwptAezhjfg1YQC2O2bGbA
VZXSn9T7j8agFnd+PO+biTFjBCcHslvBAA/31hhIdzHV2ZB+10R9cGz/rcl5mgP8LJ3PP5aGCi2y
bRNhgsjYeIH9Zot/DF7MUm1NcmVCTdOL27kRTpD0X+n3qiKQTwePQSep3R+xErnD+3OdsRFSLhaD
8fDce00TQLeUFxjyfVSHRZSZhZLk6v3YnEJ9l2/HSQMBOYn7ZpXvE4aCRZdqn6gJhEk1HfGgb1AT
+q2di1qND68ub/DajEL5xzWZXraU2aId0gElXAOe15K/Y2jAGlG5af2vkLM66MoTi+kkdX1EKB3I
XpElMqGEtjqPVjdAu6P5R/iUEESQFFaN1cgkvGO3ctP3Aw9MAajEDNdzexAVFrGrKUADBaNIqme7
Fi1NRmX7CbmFDRKl1eqWfOuHLHNEgKIP8Oz5HUqunm8aLCqwnp3S8gpHvwZ6p5foTbxxnd3k2mWx
TbQg8uudUuUDfKm8NhBimOqemYdKOuo5KmSYXKp/wL/kRW/Y1Sawnm1RejzTXXATdEii9VIpq/Kq
OnBW1Zm6Xo+OD7ZMWIwYiFdjdt4G10TmJBHNL9hzJCrL0XA+FY37sQAAGtxBmtxN4Q/yZTAFFRM3
s5F7GnEbt6EmvHMYnC6fLKWl1VMp+0hl+IUkF9z3FWxFwL3Vhg1m7WuR7bv+gEmk6qwYrhkRDOZB
VkM4kVK4G+R27Iih8brbFQ5ZAmDuO0EVHSUccDIuyWjyGKLVTxzuEGj5gOh9cAZEY1fRJelwPiTW
1dwUJlze9vlBV5ps4Ty0aC55oLQCXbAE+yOKHH9ADvppvcyGqsDaMcAYO3J6+0ARxW4WAXJrad3X
f3gJUkff3pGqdyYUXj6IuIqQVAcX+H5/i/Sy6Nt7u1vvbuu4vhDnTdXQzRuNaRkqqbqZpgWwyL03
xuRBwicRUVQFjL7o6HlwTUwVZetkD5PNFSrDIFhKVgLYEFbFqE6hbYFag3VotHG/VegcyxvZEx9q
QKqJMuVZLhqRJz9de5IoSehHKx7bSfr7XClVii3JMiEvAyhThcNJL7DHYVn/srFPXHJp85g60kX/
hkhSed50o47GpRxzV+ywil68EtXjt5dC6v18bwi/id85cwjZ4Q1thI85fo9qMhy2n2mn1/JAB5be
rsScVOKYeZqoTZ45YYPv8kvi3g02JJvyIE7uxqAGf0cvgzaw/JSWs84/EiV5vP4uKF54Y6tlIRcY
E+de1KlB737bXQhcxb6LrsVVfy9WQsWShoVsUUjjCmv0n4a0Oa6pYvHL/w9ELanhb+qftsfJtCDF
exROVY4UVRIas1TpwjbvHdTR9EEEhJB+DhVXX2lhh60/0s81G+Wt7Z/PNn7CE6IPa9zYniTf3gqh
utYSyvZi+W6n86YVI9bCLKXLW4Zo8JEsQ9OtiKQySC8IjP6fV3esbw2DjmaPa1o3vy1mBE4rGBgQ
sCC8fIfpNgM7l56f0YeSI0N+qO++qHSY0JF6jUEzt9lmpLyhfNSSdtFyWXrL3Dau/tJZ+ciUoemE
E1kJY6SlMUS7WVbFKLD77DY9S5w8k6wMLKyMHuZaSAgEgTCPfR02DTWq6UVywHkUNoUB2R8tqM9S
gcN2a8vj8OCc8quE5MFB2+EZERPnAr5NOM5E9KWUYOt7gihwl+iHsNDiExjAh/+gw1I1Ygb9UE+f
CIv7CdwVqidh8ZmvhgMI0rtfEfbk9qN+uloZz/NGiIBkzyscgoUX3+HcsIetEn7yZ/QVe4KxbHsO
+JWsnLAi33lGGLYSQKcisZrNN9MgDTryEQhyCsr3hH1MKhtRKXi487O91FppCw/M7yyO0OJgX5P/
7vS7RfXRFfSiaKEfAgZZcU27GadsT2bRUe5bOStWbXgioXFact3r4FMgnT3eTY6eMvFh5mQpYNmG
uRpwdEg81T5EoE5fTjdqpP+yXpGuO+trzVZbRwp4nnnSzo8OkqNRzoVGB3iD8NT+cBnUV4194gbW
mC2UxI3gVLQ/M5fVOr5q+I/CUa1DNGpGRITUhr2GrvyqP7udbUqDT/293eG3nV+oczcvs/bIfh5f
LZG/Qtd/km6dlVqy0vX0Mkfgn4AQnHK56EazXIQT+EdF/PKfwYFvV6PeWLZe5BgprGMFLktY1QZT
xdppeQ8aEWhbClrUhjVprWuvzQr0cTW4poR2iZSJbRSjGugai23Mu0cTS2tS2SW/xpyo9gDA6tFb
deuTtnx40WUkUi0tCpd8pWmsXaSjIw7qJj3UGywrQYuNg/hFsZ3eMr47p2gu4Hsp2Er0zMA/Q/dd
zC406PealSAPsY8McCgGQsK1jJqiLheNzUl1kP5z9I2HLL2lo1KM91idTrKPj4c8LafzK/r6/DT9
yfBE2WgpCWykdV/cdzdW/KIY4BXTFIsh8Y53Gz9mOx1s5xLGbz0vKWj1S75qLCae7ntqiNlGzVtI
QO1yUvItfAxP8lDbNzXqy4BHVMO4SKJJ3cRdmeaRJ0lNrt5yJc3HFNHscwsFA0dUYEOXOOv8VeiR
X4DsxoCUchkL7+vw1O3j3v4W5u3CR/ktCa5ObxJ43ZLBYVcKDsSgVrQBcWGRyQhuu3xjvS7FBmfk
zPnVidoMG1AeYdF6AiIcequkHWSPixfpR6k9N6O/x8coZNjhLK3eHE4PHuACHSIlgn98TPmGpd49
M5+HbbmDD9xx3lDRSwvVNdCKE9RcvmlFM70FcpSg485fFGw4cFZRjejHjhkxPR92p4J1+dB+ot1U
yZoiwjL6gc9kHTx92scMZSPhbX7vvPIg7BAmZqDILRbd3ERS3bm99cJREfPzOmGIepyc8zEY++wr
bIW2K+xhcUOPD8dryS1DyTSzcCnYeu8uZpDenX8N34foh8UGErxQdOdLdPTXdgfPLaIjha0z6TCP
WuZ6VO3YeplHaGzh3qnt4K8OlQt8uUA/A3ggevo41W5GSCZ5rIXN8ExG66PJ91HKPhasVpPCi2kJ
CuLplIgUQwX8QrdA/nQIu2+i2K6op3sLftphb+ND8GsSTtatm/T3vUQMrEJsa08gObFVwAyppwRj
HCRSMwrmgi8xJ6sEBq/VPUzrQiz0Q2gbvhOOYOd13+Yog1dbAmoTVbCAHrAAsPhfGkzJVB0d921E
bF9sVMPyp8qMa8cYz1tL2rmYC5vt4zX+q++oM9l/JO+b4xXROy1zZXZ3P3ar4chz83yipA4HzHtk
Zn8gRxfPieqX/uDIPFnJZNV8It9ZfO3xQuRBrEDRSj6VA0NKLIBaf6LHz+HEAFVeh866/aIoHbCF
6uDn61xlxKe1bZDlrSH1bvLhNa4uYDhEBcxsfEI9k0b9RMYNltSj8Wuy6O9Beisnfsn/0pJxlWB9
J9aAe8WNTz3cqXfu9JviZaYspMMDYui+G8Nk8DaCDJGZCSz/7wY0rRfJWnoiNlf8b7e+GMsVJm5T
emDIco3K7gzcxncx8yNtlvHTXb6SOkgOJs0lPkhC5Yhh8vZHda+1IJSk2UZLwMh3L6POJsPBmnc3
venEAx/aMT24yhSdec8/T5hzU950FYsK41fb9sf08ixfgwlKTJzp4DsRlStFS8Y6YPWA/NGyxI4M
jDfftHdqa/eOlsHcgRdAWD/c/QTMpT8/nx59npIsQILSHH0XH07we+eKOmuD93U27M4xnwQnKboR
otn8PiHdv1lj6t47mXtflP9Wl1pXwsnKueIvnScjx6Fdky/g/U2xmGNtt8swA/HJkgHDmN5TmgU4
qVJ/GkuJeR+ygzNmnwOxunlWOSSwhg1xjrWapVph7eGcExx3JZmFN9lA/ppapAUhsxms/zG9pxG5
ya9cTD/yTNE7lOYwPKTZGejpWl/zIFQoMrk97ftq4pQcAh/1o9g28kf1CYujeY7OAa/0oR1bOY8r
wBYZMpbqQhWH4zqmizK4m6QBKKYkO39EOoLnl4DzP8H+5A0jfvHqqeK9W9JPIpFRntfU8UZkToUq
iuEBWgTTYl8yr7VJPl6f8uh/QRTitjg8xDZAyMQkshCQZZ1c5s9nVjdDa4Ps9BOhvxSXJ1nptGm9
/QIdYrs8KfpTf16j+pcHemilSbmdsqWZc5vPYjmpHm7cvRm5aem1h8VBjciMVWc94/+fBrJheCBb
zMVz+JfcKjOuiTIF8V3edoQjM+8Uxjq+ekETkE9tcWzoMiE+9m62trAHSnRZrIDm/aYzGq2p7vlD
9UMUCiaXAh6MgDNuEOu3oILxIRc4v3Xq7l7ryH3h54AQHT+lDICaGamc1tYqYRJOaX70uXV4tXVZ
pmxIeEQbNtR8EJNErbx5GkjFkFC66YW0aBmf72BV8974x23nJjyL3pwgpHlZ/BKadde3SQ3+TUhL
uyeP5SzUwhMvZmvj6j8rbVTy31rsPJd7tuAo91088PtEm65ufqk9bz/rmRs2T3dHqzCuyTuElg/L
LudvpBCIOf6kYEVU9m9gWO/Q/kqkOmlcJBCQ5k2I4QPw9jQZdlIRVqP5QaS8ym6na0u45xU5JvbW
04rmDDZn0UxLRAP+lwF0sLtKZTXEYBo7iR/SG1lszpC6sRrADiX24IB31vwNpsq7C8VpSlDxnmy/
JcWkDi2C9qeLz/tdiDW3jP3ayADIgKXilMNq0r6yZkg9bODE2mBZUtnODByBu+XAJsRL7omUfPYP
zZWtBwGFK2lup4p5IRA5i4U0KLLZXImK8k9kkGZ7R46tN9uPgOnnwBl9rFST72L51dMTyfKKsIdO
vuIqiusrcodZ5/06nqAYUZwjCr5EEa6J//fXVAnJ2sFozjUAX32gmlZh/fx/J0IGo+44wNz7Hv3x
o8nD0PSYF1jLeffjPZOZtaOusZDY/srqezN/EiKP81dkS2IKAIIWFG8ckk5ELiAv5U034qDeb7Yv
1W7kGBsYI6hniBAYpXageeAdvNqa9gduwCyOeWwLvdE/gxImk+F0AuGQJXUflznlM5M1ZUQdsBEr
QqN+083c/ID2pjJa9vLXLZbHpV8MiAGiacQqdTJYEQIhk6LBxu26Ho3xqjktcdjkGsXDcgNFm9J4
FRRHtFeduqNucgLRs8GM5iaDNZDFvYLi3tC2eaAubzmvfXEf1w2p+f2mSRlFkPlQMRdehFaaPJLV
K2Gv/kweJYM7afslGfPtlqnU8e6qHFTrTJ8hFxI8GDMPgsjEM6GUkG3XAAvNV+9D/3qmq2+NWehO
n+/yZValN2KT6x1rfqBVt6HiAOHUSaaM5j07lmE3hgJzssM78wFPAcr+nATDdhsosTJTZf+ds7cG
gwBm6l/TDQfSL7mOBniy6xUpZrMp8c9UTttsL7hyixOFJH/6MG2wbnIVa3nCXWv77ypp2DWSVnW/
hezp3WPFjRMr+dNDEOSFw/qiX+usn42W6yDQ8kLabrFbgRMCl2uUkgua6yaI8uS7HcMw3ut9quoa
28cNJ4oOnWEHqIRPg/wgWm9uXbR+OZul3OcLDAzbCB3oQWw606ewMsj3T10vjnr6R+/HjGRUR9vz
JXnkpztUghmAuaB6pywf4dlCy1t895nKapwR9YOfxIuMvVA0E138dC4dyzGvTItL8GXtmP6RAsrY
KY3wrfQK5obL5rh+HHe1A7rNelt7kxSP5XTgjSEC2kQdPznArQlIfZNGi6/LFdAMBKn5I0DZI2u7
GACeBses0hzRoSNyzbqTFI7eG7VDeFOWnuGpxUNEKV7edLWe/TLThM6zmw65SbNDXNE3F3jtl8gh
QbDyd/LfDGUTb60vFtmxVj5O29y6QOP0FXu0AnMFEKStGg6x+sHoH715RR8VBkmqMt1pGOz/96bI
im8cgfJcGjC1ArR3YT563gGnZqo/rBZFcm8rSp2wcgeTvyz21Nqj2ymUeKm6Unrpkpf5yvGe4Dsn
rPwdagMMCdpwcP0Q0KEwnF7+KljnuhEEN+NbgNdtXTiiXHFuGARVHkx3cMmcKMqncK++Bhph4HQx
OK0tH6MJXsD/9JrLbIryscWmKMzdC/rjJkWp3c/E5Xm/SjJuCfSFjQSRik1OCN4ZAPTkjJ7kTNe/
I+crmakMuy8yd8mK8cufcyfsyDZVi3tJOROmQTbDcct8CfDXktobywpLd1/UOx20CUSonFRwiiOI
mZrNlBQ3EEYWjB/tSs6KJFUfs4//TmTUZu6he9lgZBH33KZyEeapu36ofmHSL/43hgZWpXYganw0
Fd3m4c/4Jh+5y2g+QFZC/JsDkjOnu1cWGsRJ1cG87mIFqkUxrnjFOVs63AjvPlxuBMBsQVvokncN
xVDZDf/GZNmZasOrIFCvPzOEwy2HV+uY9Wn12L3SqcKq9b4VTbxaTH18n1T+t6vpjKwkYoRSM0y+
2GqGOVyUo4FLXjENj49tQKTbR8c13ygq1lmvWgyaTK13LLpkdbnKFQRA3YiJVEWEvIFuFHJZrba7
aP2wLxoPE5U8EtjaNXwo9qczg3fUTlnEiZtXs/XrT9JxatvGqg7jIZ577rkXPVP6y6bzkuCCmQoi
ENpEKCvVK68cr2sDueG+5tpE2d/seX2bx/bsQqZ7BEDxWcIIVLSq2mrCRDTmqPTZGNxomWQOFElS
Dr+V2GdVyeQ+6gipNNuOyQbmFFm3ZzuQENeupdw5SFxpkqW/I9EyscauAo9nnNQ7MTol/xh7Fl4t
QM/g8D9Jn6UrNPlVjnQS9qKcSP1b6/wvWMPGsTaVEYkOcbTe/r+MjW+4GtEGhO6XqwsbWJ3FogN3
6tthJgIclL3rwW1PFiOXw9se5w9cGQOs8fHEIQZ1wovWG8664Kq99aT9/gZvvtRR/tN9uHAjffsc
YOjJHrLaGcxma8gGTBVP4fkLrpiYLX9t+J+FzExOWc83A/p+crAjqZezoiLyyXQEBGZVABWW0hGe
cmhHnal0DB4m7OnIE/wAp19WfTlPLF2rJHWoRSOXPVwZ06LGNXndGPTsYMkAA4+PMN0PmnyTyFTA
AbdoX49F1K55Hu+Bv9jAhXD69RhaWO6e05oGgA/uzhxqlIWeAAh4Eplsg+S1M6FnvY75HomAT5+x
b1kPS2V/iVeEJ5kMANwlBH3aJaTTpZ4aHUW0hkJg+5Sfydwms7hioLB959sCd91FT2TZ6p9n/DFl
DxC+LWa0bGKh0vY54x8DFLw83pdv8RIJSw/l01coCDTLQ0UH1TxsjrYNAKYRan7ieXB1MxIUE569
mvOKjjOfXA3fpz4QMC8BD7SeUm81oMq+gJYvVKpOhePfLXE2SY6QXB5jth7amahnpc6h+EbPQqzv
4LYX7xDX4ZBVAFJy9V6qWztVn7lfneV+vJmpNl3UbEQISSvkej7XCdbyUGkdCqaKK2Vco7xJkHAb
2y6svbAbfg3OpjzRhuogmqIPWHMA9ctnncHJA3ld7gVJmkUmabKK4KkJ87thjqySfXWPCuk/KA9p
glxdAN+D3mO67BgdhbuN7HEG3431ulNO6NjaNQxXj7xEGWwpIV2zWag89GosHQ+aTSQQSSiuthxA
Upfb+/iehD1k7UMaIzafGAZtVb1BjVOhFj/x43H7K7I1EayZgJJIYt7rmAV5zLhRHFoczZaCGdKE
LABg5UJF4ahtb2wkTFVYgeZYnCYePm6O5cocNUIz2SKMFeMnE9/n9CKnnYi2gjjRyfq9WFhL1Qfo
N19Y3VtiO4D5/UvRvgBOwrbpy0/gyg5kEcm3bfpMzdRf/m4otGOIAg2Q3/1bmG9SoMDm6MP4aaJm
D+F6wl0VZGPO6/Ey+fV0REsWApxEB5p9s8KjbGnNrIfUUX/Z0EBy5DdQDpxOhD3meJqErSuiIQ2n
DQE4xa2Ta5gZ9CXGJM4cDnkJyYTxjBNrCds5JmactPlf5t8811C/RtF/ph8r/8zQXj8+0P+MJ4RT
TbNBqfnKul+z+hxAPSXOI4jhzL7QGatU7J5Pih+DvtbNvpb8kNTdvi5NIFZJro9HQUQAHL+iFA0D
Cn1pqsvWBwZvm+CnP6RipiXG2xYJ2b+ScgL4Nq29hv8+aCwfpKo19vM4r57femPQbZjUr3PhOifM
+4AyMBG6ueOO7e+xd5GuuddyGoGuhuKTu1sZivUxndyh0UjNnaccgQOTIBE3cHpjwOdAm8D4XnCZ
7mTNT8BrDPNqpg8TunUHFslBlUbgcD6mCkhuzU8pTfJhOc+/y4cggUGRYdJL72bc9U3TGxB9u8wD
yyJUzlwbmuVBWg3lsMLPB9po4D5YMwVZ2cBhInDv7dtlGsqKc/xFtgds/2o/NgMwlJ3I6AdfWaWg
uzRmM0VQCZMPuz+xtp37M2wmYUpFekJuukeqCI1VLhINTk2nlLw+fsdQSKcM6mxuluq0UbmYOgsd
M+Pm8Os7NyYSX1wqnHp7X5cbR5GvKulydDVPIH+0+Nrm5bTjzlVWWdKPyv0jBO5CqZ3oIu6GRNzW
BOEaB8BN8dFtNUXDmZyB3EqFUs/UZIK1dB8gW3WieM8REvRgPaISM4/3On0oz1zP38SVNcl0xGj6
EalVkL0Cyg0WwdaJAQf3BPjTL/HPRP4LgzEO1D3vbKgmg5JUhzN6wzLTEgYvMitZAE+9Y8ItkXGF
u6s3AaI1eH2PQhxaX1EjTTcL3evLBOijEs5i3UFPpclZKOqi/Qek3uaxRtFIvRgm4KfpKQcYxkYl
FEldLAIeUP6UyTUEcLrjDNXVn6Qo4Ey4s9QruhvREmpJFdiXqc1oJYGFx7+JpEkn/Q0D9/z3rTFE
kkAykP9CfCYtf7E0vx31R80a4fVC3AaEW77SsmaC2vHyRnEt1Yo6rnDmU8GoYU0JU3u7G3U3I4Nj
ghqEzsaqx/SYlsO4loBwx1uPn8DVYRsL9IRb54U0farvCEM1NG5WoiwEBUNOFb1o7DBjdHc2ECHN
yMi/QQOInVgGnl1yAHG37Mc98ZGmWCSBRfMYcOyeQPGv4vYg6OfN3Do/fP1k/7J/3ZlNVWJXnUu+
c2TQwfDd8LNEG8OjX8cex50W4ukM8dAUd3p501LnPPKmAKmCO0LC5GtXxqJFJFYf5oIB7ai4V41Q
h+RHYaODp5fGtRxmKW2FtbtdDYVv1y0V/rDXfbJyq6g7AZVvZR9OyuI5OmWTEKkRw4SfVZ3QfGAB
B3pp2BioPI+eWi14etg0jfmef2JIGegekJ0S7aC3AKLJI3iDB2i9QC4BkHG05G3JXylagAKTXb7Q
RAHQKkEKwH9rNSNL2HsoL6oOF1SCbFkL1qxzc2EXY9Rxf0HJG4uZuPudzNa/07pwFdZWMK8YS+GY
mMrihXrKNOqderxicgSC09vnuTToRCaym1j7rq3vd/uVca4E2XT7MtpaABfKVeOmrjyfVbG470cd
9WYJNDaCZnp9Byg6DNy+2A1JnmZ01NoZB5nnj6eW0t3dJX2avSWl/pNIjFlp8kT6jApqX85WHQWN
+spZf5D+1z7Sj+1dfBiW/4ay8RVOXkWAVJf3Lz9leEQT5nl4+18Nf7zqEs7MAvynCIIRZln6lgHw
EyjdN4tBpN4sZErrwW3FwB38S03x7uBAeAI6cmGqlcpYpgWq5/Al5dtVLJFRfuFPYg6wQFOaDV/z
lexqDWRw8juD17dZe4Q/R4wPkpd/aMEKducTtmcw4fjM8ZPpPYOZixijzYqpUebt7Y/jXTjrGcHB
N+uYSqsys1gce8t9f4lYk38qhePZyA+91cNiCkbgKdhqDPJPtcVreZXwTufYzkfU968QR8BTg5FJ
0z+wnHc0yCvKASt7bWDKPu0finXzK5rYr34w6LvkcUO8Vf9RaF5CRYox8HEg9dl1DjFb56CoeGBn
/bxNbYtKhsBHRsgg2jeBlaJ4dnUrHhwhKpT9xkQCcYBcVicInAofhpwgWQEEgg+2fAECpu+Fs+3E
1mHrOgxY/T2nt//H8bkPoHCF9B4QHXrRB16i0eFDMIbaAbZtm2cgzDyHkHIeQh7vyH3TMe25hzCB
9N/dB+QPwvyP9/9oAAD+3+wD/+/v/sH9/9j+8/vD/9/v//P7rY0D893513bYadbWgaDben6BmPMA
baGYttAMw7ZmEMw/2gAAA3Qv0ALhAANIAxw9Ay1rimpLYQJZADYnYAxEpAID/QABA0aQHpnWgZjo
MuYswZgzBmLkG27YABmEOOCD3n/TkGYwzB6FtgH/+D//H9z+7/9AAP73/4A/s/t//j+wf/wfc+59
37f2j7T7X/qP/X7n3PtPuf+32/u/b+4+39v7n3H2//Z937r7X3Qf+/3AH/q/9f/X/1oAAAADD4ji
4OXD4HIcQfP5c+PJxceQ58nFy+HPhzMHIUzG95Zgc4f8TdljaeAhIG+AtxYEuzAbz/hjTv+H+0N0
CfP7fHx7VOIVKdAEiCPS4WPbTMrO3wrdLZ0C2rY7+toNP07QLYAeYPJ94HmA+6P3z7n2/tDigKAG
dnNp4KwQE96BbFt21IFhxdfNQgk1IdA7gQ3ACKAeErMXZXEJWAAeCRlYjDXBfpk7mlSC6z15pFln
ny2KLJbP3jQeQ1uXJ7CBaOTSk2FtvQNBDrnTg78AP7ufIfIB/Yh839K+b+lAAH0b0AS7q06oiQl6
UEgvgtsGJCn+S3pVTjy3/YP8e/JwqU6paqDw9LxnBuEVK2dODT7Ztn/bQLYCZBddH2wAf+w02IxW
mi00pti9Po9ORH+bbA04MxWyE0g05dWKPB+Q4fRgj0IaLd4URzObpuSDdhwe7g5s4R65dBwnALwc
IQZnNwf6cCF6j/f//3UBK3ZxAGRAGRmQDlAOAN0dS9CNAnj5QnB25LyRGIwU5DxZNvjkhB2tEJJN
KTzHJyOYlEZ0EinD5WNLjINjrDIN/m233bbfQ8wcgD0DMX/WtSk4cP3bAik5Ur0LJpSJS5i9B2z/
pmAA939Cv88zwE8YAP5Xs3jg6wHPE9cIO6R6eEjyK1PIPIBoNt6fbOg23bP+/97//f2v7QPugAHf
94/IvwwAD/OAf5wAAB8iAAA9cAAAevJ2sBWRQ0JxAIxWEHgAGd1bzw+h77srji8ryAD89/2JAQSk
AJwMRRNgigFEAIYjLTJZ69RQKIRsTr2xNiAAdkEViusv5nawZgzEHoAadoGn+QeEvn5cybyTRo0l
tG4APuPu/4wH//L/9X/6v+9tWxbFs6AGgAABwCEaj+33+/ABN3dwgFx2FwgwB9v8NFRALCCa/UqD
FLnBMfqwVRGDvCGkjWZBtEJCRBsHMf43lqxmDkPiocgzFtnIcw/4Zj233bMGY61LRYCYEbHIwAE0
A2PsciAH/bkAch2JsXYnHAbF2NRANiWgAlABQRfdyV+VQJcwf5snM/x20PdMwegchAMwchzByDkG
Ydt5DyDbMwbYGYAzHtoH/9/f/d/+AB/cf3/2/2/3/3v7f739oD+/+7+wP7n9j+3QNP0G2+/OuNA0
/QbZtu2+u+////+7+/+3///tACatgBtQCkQPWBLjw9mETVgA2NsYA69x0HheOo/yUBDaNAAA/6+E
C2O/bbtrT7bAHlqeulpGangA8U/PeLbbtmYsxz3PV/xs87o7UtkmAFsWzMgNkzx+MAAGn22AAAAG
n21bFsaBp1safoGnAAHsviA+b+b/sD+xj+x/2M4hGo//6//6ATdoAVtcVicNiBghHVCglyACxQcN
wSMSyNbhIGxSKEEeS6omUvICdC4TwxvQ62YSow6Ahh7oABtmYAzB7rtv/Wt2EIcr3Tbf81Rg2zY3
836ABSoB+xPF/D6mQMDB4xGtAwZeCA/mANjbEANjhoIAGnd/8hD/pmHbeQ/5qAZbegad/tp+naCB
/+H9gAD+8AAA5DmMA5D7sAZhoMuY/+vIf8QAAD+3+z+/+7+wAB/iFaF5B7uHunCFD3TjhQ/wzBgB
dtD/rtoAAAAAASYDtIBsQBsclALisIOAN0CHQHXyaEbHokBORqCewkbH46AmCRRaMw+g/5dt23kG
YgDQNBC/cKAOJfUbPbf7au8IBxwP1CeJ4wQE/gxnCglUH81+xnDfQPQB7P4kA9n/n/5U9mB8R+We
yAB/f//n94/s//39v9g//AAAAAAAOQ+hgHAhGpS9qkdpklhkNhkIHMoAFUhINXgf8gNi+E47QJ5D
UEYCOEATRQJcIxBChAtEBGRqCWYyHCA2JacghiIBAAA46Dr/zb6X6R839IP7u07IL9O07YlFA2Js
XMW2bbyENtDkH+OYMw/9SEOHgJfdq3LkxnoAB/15DtnIcwBtgbYHIdt20OQZh20Mw7Z9N/dwD2YH
swB82APmwOOA2MHhQ2MHhAAP7C+bAPmzY/X9ibHogFFI8JsfwmxA8KHhPpR82ACg7wSAACgACUtb
isQBsckAUjBwADYI0BmAA46WgyhmAgyH7p7qRZjSWbw1AF2wiyxgdEAIFZQBQ2zMHIX94HhKIAHh
LSARAC0wdf7K94AWigmAAWkgmiBRaOv9f8J17wmxfpPm/pB9P/d/pj5AfTH0307+6f3b6cAB82Pp
PpXzQAB/YPpfpf7D9J9L83whGo/97//8AS93cVikNhALhBaixApGFmpAH+PodoAI6DAUXY2OQAgj
wDoBPESOOAIQJHCdIDwpJFAjmJFAw9s+kbODMPIA5AG28hDkP/TkHIP8/CFD3X336HSWnkkp/P6B
bOnBp89cIO/aInyMSls7ODJkv/KAZMGAd2dmhyHkG2BtmYAD/tbWg6d+c799DzEAAAB9r7f2wPtB
/YAAAADwgAFpgDY2xNj9fDwvX+v+E68AfSfNPpQ+a+lPpfmyYAUSDhEEUAJAB4WigWkjY/HAAAAP
P9+eUeYJW1uKzAGxuEAuIHgAKBawPCgHCA4VAWkAnAoABBCKJ4BwgAJooEsADr/hCI4FBP5AHIAB
9r7qevqX1MPQSYoBDCL+8B2X7wOQ8hDkNbloIu2hWsPbOv+F8J17wnXg2zbADMAchDbPdMx/5KBL
mLbfd/QOQBtoH3QAH2gfdD7n2wchGo/9j//8AS1qkdqAThsMhsJiBYA1tw5ogtKA8JaICCEcczBK
gC0gE4GQJco8IEJGAJAASBygjkMhsXjgCCEcdgbFD3Tw0+a/sb5sfNfSA6460/25D0h7Vo3wvHaF
FQKIB17YoB17hAB4S0kbGoEvu2BlwAuYP+lbw+FKH/T/DkPIMxAHIPduQgH+b/DMXoXu9BF/67bg
Bds5DtoAf3f/p/d/Zx0BMAPCde2OHXg8KAB9J82B80fNGx9j8cBwoNjbG2J1/hQAAAAB3PXflP8B
LXOSgFxgFxAsAsNgCIQW0Gn5CigGgEExQDjmcI0ZYBYpsGNtvIKiZMyLY0G2rZ08NPANP/wAO/bN
DoGn1DEI0ETKEKJATgAosHIP8Q2zJpf8wZh/65hDYloo2Jsbr39h+lB839If2IPm/pPpfpfm/7F8
39IB8SAB9r7R9wf//9z///tAAP7QP7gAAANwOCEaj/////gBLWqS2kAuGwuIAuEFgAlUgK1YBRED
YxMACVDQEKACCEELHCCPqDgBHUSCCAWliCeYRaQLSASgQCUAABxwAH91+Qf2M+m+R+mH0h8j9O8L
sUiBBFCOveEAgCB/1zH7oG28g23Jpa0L6D/l9CrIXCiDsrhBe89D/65hAP8cYAT6OefefS+z/QPd
v+m2Zj2zbQDkPuwAAAAAf2D+7+zMP+XkO28gzCAch2wOQf2gA//P7v7f//+////v/vf2//4AHmPI
CXtDmtDiALjsMhBjQAYKA4UlgA5DQZeEYHHGZPlABJmNwOx7tmL3bbD/9/sB/Z/aH2wDv7/cA0Hv
7TiYAABMAOERwgAogGxg/yZjzFmP3QMx/9fdv8oAHIdsDkO27YAAHIPdfdv7n939gH2gAPu/bP/c
f/v9n9/////P/z/8P7v7f7D+0f3B/dmDbMxByH/pmHMe2AAZg21/sf54ADghGo/977/0gStqc1oA
ThsThAohAwA62pgg0yzgegZg44wjjdvgJcnQyWi1JHxPRIw2cgJFynHKOBl5BmDhS5jDDpr/+AP7
P7v7Qf3f+X9oPCeFDY3hOv7G2PsYLRB17Y3hOv7GrEQdlBbouy8xdl/SP5AIrJtmYMwccLmD3X/P
7rwgLSBxxBOhI4UHhAAOQ1qXbAAADbH9/9v97/8H9h/nDkG2AAZgzBtnIfdvQ8wf9PdPdsxe75g9
AzD/1DMYbbmD/8/sAAFQKCU25wgFw2FwgFwgwAfjqV3QVBcAavhetp+1H7NyjtNMx31+2tPtkOQb
ZmLkGgadp2nadp2ghyGtSbYAZh2zMXIOQ8hyaX0HkHIA/65i9223MWYuQf9ev9e694Xr4W1sT055
DEwANibE68BFAP+obZ/htgAB/YAB9z/2P/T7oMxgH+X0DkGYv+oBmD+0AAf2AP7wcCEalJ2wBWEA
2cBuKxAUxgQBYFDY4fq8jr+xrQsEMBIoqx14iiATgcQ8LaQCYIFEZDjgPCe64EX3UNszHmLMW2bY
HIQDkP/UA6/sYOvZg23kO25h/wzGHu/oPIOQ5j90rcoZi/w/z5i9192zDQJds23bfQ/+nu/+XAYZ
GQAigFpgouAQADhQdeB/+H9//+D+8f2j+9/f/f//f/392Ycx1qXJxf8v/XMGAs2zkHoPoe25i9D/
6+6e6+hAAAAAAAHKv1UAAA7wnJXY5JZQFIbCChKAD/B2Uyjp+r8A1sQ6j/wT/J9AfIepkVd023Me
28g2zbOQe77aSKUOQH0ofNvmvpXyA+R/umYg912zMfIaJB17hABsbwmYNt20OQbbbFthbQWzbfCi
tAHhfCUSAggAAAA/sQGYdt23MXoPIcwehbaGYwtWwAIioRLgDiEalKWuT2VwgFxWJwgUTgFtXTFK
BdD9fhoDhQWkAmhBLcYiiEWiAmDAEsxYooGxOFQRQDYvXti9e20PdtttnTtOAf2H5EA+RD6T5r6c
+R+nfIvpweF2L4UPCWiDjgKLBsfY1pAJAB4Tr+xevdf8J4XwtpA2JwoOveFtOBRQLRRsQiBHCAAD
/+H94AP7A/9j/3/9Pug5BtvIcwcgAMw/4+hBtu27b6B/1zHmGtS7b/m93DbaDLtu2bZ/e/s/t/vA
//w+KwXJgREFb+XDal9k7JFFsqFFgAnwHZ5RZXCAXDYQQZz/ALisxWIW/X4cAMpCANs4QoBxwvCs
/xDbNs+IfEPZj+7D5v5r6X6T5D+7fTD2f5cPph9L/YXIfQfQQzFyDbeQ5jzBtmYuQhyDbQ23kHoW
27byD/DjpSDGZPKFbFrUuYdsAD/+P7AAP7wAZjzDyD/AMwhtvIQrQKBMFRX6weurAjQBJxqWsAch
GpR9olNmAThsgEUYlAAoKqDoPj8OQFnH/7kocMj3TlxPCHInOTkeFiRNuQnw8gIomATsA4UFpgtF
AB819I/sXzX9jfSfI/TfTPpgB819KP7B3537beg6AAeF8IAeE93zFtoZg/w2MAWiDYuxMxch5D7r
yHMPoPIKBZmPkOYcwgAAf3gAAD0HbQzFtgAG2hyH/pmEA5DyDMX/TbQDbfdcx8IX0L0LkGYttzBy
HbP8Nt5CAB/mAAAA5AAACRjG6thcva/XrN1+y0SvaqfhdyTKC63vNPhmveMNSk04pkTgAVCNAdhA
dhk9lANiALjALhAqnAIAMYcD93kYLTBRFjwlFSH0nzb+7/TD+7/In93+n+QP7qAA5D6CABWYsx5i
2z3T/rtm2ByD/EOQ+7Zj5DyHkPIOQbb/mAAzDx0pBANjbGtNFEA68AB/aD+8D+0D+3+//8/s//n9
j/9H95///2/2n9n939wA4vgs5/E4cgBxKiBNBRQLPPwmoKFoKRe1aC8wjQkKBQQ4IRqP+/l98AEh
d3QCwEgPrvuhN6QOAQQgLRQS5B44IbjAWkAngPCBD4gdoIcAoURAtABKgDr5EED89bGnAGY9s5Dy
AMxBtoch23kIchANt4QvHSVKXZIf9v+/54OQZhrcvIfQCZS8KUMwcg2z3TMOYw07TrYD/bT/99O7
807/t1z/j/jyHjheQf9Q5Bh2OsP2POQAAfb+79wA+2B/d/Z/f/aA/uP7H/7/eD+/+wP/0P7/7n9h
/Z/YP7n9v9v2//Z9wAB5PvPK8nl8wBOue0OGxOGyOWwg0Af4se35omCaAOP35pfkgAvOnMxB7vmL
bMwBmLMG28hzAAbZyDbA4UuNqYt1kPMnFgfz8KLAhz/BJxmd25NHwox/E9e//ocN/Qn83EoJBAmo
BBoLBQnE5g+HQeDeEw+XQwSaAPMeQPIAB9oAD+0AP7gH9wA5DyAPQdt20ADkABwAAASRAZ77bkn/
fnD+qJfkySbD9GUo8ghBhBomB4+ztrr8ML87xgfjcqzHZEVQLFjR/0enf6PkVMpX1xdtXaUWpu/F
pWjJHT5B9MjgdfISMAIvGHU07zb3UQ7fOyg1gNar5j/B8Pu9zi42GRj4ESwe3bJKxgkA0wFnafnk
wURgDuyYzFsOrbKTnGzu7EtYliRKAF1arPhSGvhEE5ReByBNjkTiU9AHiQbf8BigHGc5r/REsQQu
5g1d0cerOjJAj2/5zPenpDRBMuYDikmiaHkKxL/O95kIESdW6C+2PV/lqCKFLFur91zZ1gFgXIdE
00YxKZWfUmhjJBFEhmKnxX5bllDhW0jhUc5WTj469PBCZaaHMB6kMy5bpIQD6yLbYwjubWBzjFe7
ikl2KHYCXGLi0iSu/mLOSpeQInBcdeTndu2OEQwZ57YeNK+EE92ZXpgkpNpiaAwz//OrEkd13npy
EVkFxOEDCCxk796HeAuchYi/5Q/+g4SHreE/F890qsMqGwKouPJzTm0wizgdGW281LRMRRbDIFh3
WvOPDJTLqHUzfo796hMxclHGZR4s3ow3JPOT7ZqEa16wFr7JPHTHBdsWhTQuhkLiizKBWuqZXEtO
JddKMQBzNvmVFluO1+BxMV+E+6Aek/n8wMn5UBTv7u08lLAuOgtHe+hX7ZN1HLgGnG0sE9R4xj/u
XgXz9U6Ho3oW4XkUa/0pZD3N73n+RCAx8SAe4M+FeZAe866FeQ4MR318CMylkfKHISl3JGATTf7E
/f3v7ASkOW4sWHLml7YwndryPZJxE7zuWR2fWeQiCSY7h4452LChEROM2J6BZ6sSB83Af0dCK4xO
oQbkys2ESUEKkeaTJUiy7jPQex7Nizaj45Hm9i6JbGQ7fe1GkH8hWutY7bNKDG+KVoWpunTlK+ou
Rly419+dqSCpMn6BvKZS+WSPkP0gDw6j1DI/ugpH14+RPQ3xctmblVfwyTSGJscuhZv6nEzceG49
RZ+f8gJcHFBMaUXh05LQLklAb1L8Eba+Gu+h/8GO/8rU6ESWrakGcu5jCIs3PvCSe4b4H+nX1r0q
4R9GoTxdYJ3eoR3r65h5STsYjebLem6TpT9dIwDWklaVcDfikzjl356ndPKHZrxUBymXSA/DqaxS
Iow9jbZ1wKvG/ChdYEZVtlhaBVrix+P+KpmF3eV2lZPJQYdADJNfbNMrJE+SliQhEAHONxZwY+Ub
nwf5hdfdVE52xVhadIFSJVaTAGU4GNE3Uf44kUIgFLj4P5gPascXuZJ5UmCksPS+mzNi4n+iTItd
W/Ct6laU2isfTJTWUTAwndj27m+lmbqfrnk9VCCLxrsqx46O9Shf1IduUdkCjP8WFGRu5GKSEZPY
o1SDC41P68jaAqY5ZYdyQTGw7uqSr27nAow7mjOiirss4yAhUdbNUrG33SwCcoH5OShqisafgMFN
rnkBqQBqLjaoURJHxw+Byj50FknV/JmUUMfJcyFiS4JlwwaY2ZAoPq+msVcz1rMLINbzNMCzWNJD
rDqXA1Re9k/1uvTIj12frtRjwjhALQcAAAtKQZr9PCH5MpgEV/af13Lvmu7YJDrVRGeG7UTTNA/y
Lwz9pV01Khq1uqEzyo65Ze554xpQcISB661sqT+xRKq+1tMNKoqu9Ty0Fa4Zn4Xa4ZqJxvXtlwQn
7lpN6bnQ/X1CclUqlz1ASJpzApnpeLVpUjeRYYJNaY2gbiU7tXuoPoI1fm2io5mGcN6T6/2t+Wre
Yv/y+ZTe4hFolPv1gopYae9fM/9f/AtoH+5nFJTH2II0/wf6fE+83plM4nMyLt6PvPdn562OVKF1
kaCG+Xem4LyfhqvEPBJrTzK1qxY1TeJg31rcLG6WWhV8TpD1WN8Ytio7BSWauhV5V+FeHlDQ/uXx
6877rZpy9RDzzXWIQtVaHS1TxqSQdEFi2Q0dtDF9uBv78ntgyL4n22ajpSfYSw4IERJWjRjLbr5c
ZCPJOzizcG5erihY9Gq1dHfCUVdQo7LyvcAw8AE1SFpB/IKxFr6K9wMJcFzZm2tRySh+2tfsGMwV
RQHKaRnDu16yt/TWG4m+wqrmARkAlKW3nJKLaQcKi0xrS9HoJY6NEzK5wo/N75DZldwLyxMPC9cK
wig8stN/GjXWDu5ZQ169lLpYrIbr/X5x+MNjAELYurlvjGQINJW+6OQqQF/V6gnvGU8vor0xiHeV
A9Dy3U53PIoTZNLVI8wvH+OOkcd5tCltwHj27ulB4b7ONHqUBzJTEE3P3g0Sh+oJIDBdtbNHSxxt
xrp/T7DHi9JSHhtYh4Aw977Yzz/lh+qHWMZHYohpWE2Lo/BYccpm6zSwVpEYCBkLaheUK6kSLgBh
1OhKrgOlLBmV+dMiCVQJyB9eA6+fR56DUGYl1r3FZYH11y8SNQMW42nY5sihroEGvdGWllp+lId0
yCRSruPlj62qOp9q290rXYNl5LM9c9bFDuHRe4/W8SMQAwvNiEgAF+zfZsqlviHkWsTic8rBCMqD
CxhX96qpmYHxmBRftEUucu2TKfyrXXULzgXI4kQ3pW0iZLqXkpJuT3QnsQXw70D4ThySGGkToIyA
3dwP7Po8VeGxhWEHRgOviga0+I1WegL6/tq6V+TfpxSniB35O1zlP8wRWCRELUhSjlINxoq6Qjfu
sU5Wxes1B85pmoiUzJsdfMlZs31jRllmA0pwJQ3Rz5sSOX7fNfyM3uUhsWdmY+yWGCmxUfMeA7oH
N2ggNs3kh4dP31FnDArUyeEKcpKGXoT+6Uu9bjqQD8huq1+9IS0pBn8mf5splhVYrosCZYboyuW9
qpM3DcKQQ2qDTpOtfJ8qJxpBZlaIlydvcIssEMvE/qgVMw32fkjRfhn0262H2QxwCdIEkKiO2+Ff
NgA3+WIiq6zIO9MGGbNvPiOLhC5xDXuO3bBlvyn+RL6KTc/PpK8cbEOzF+xp67gAO4IqA0VnFKIi
gMWCZ0IgWJ7aT4vEv3Hny6vvwK1JhFOFsCQkL2hzlwhTqdS1oxlnp+gFbUbBaKGzlcb2wZDqg2R1
L4paA+T/yPnu0L2faiU9IF7CVWujZLihWMWIBX7H+E1MNTF7G+uvkXO9oaURNjd357xk3cW8xGOs
0kAjE4s/2VDS/SKyq0S9tHVQZMQhbX/ZDvpPE5q1DaASmKPfA3b0rQS3GiHN2ZecN01DUJFw+E5o
z7GU+swtAE8iP6+a1SGf2ztF7mrZ04PFJqcnB3gOK2Iau28utDFWv7GhfV8QSrM70nw/fxxb0Lqc
v2aAreDzQMEvKoWXaiEKSxxScQxaCBrdyk0D8UXcekURa9p5y2xj0fBQpZpuPWpz8h70sz/ZuEpW
km9uwOO55tHzJtd5mRutgAQ5yaTwbZuZFhVNSM+vmQnEkq1zsZvtWarjEd7cf5RgNb2eDCvdLNXM
mb2gD3BPcM3SjxLl2eJbdHoDA3Ex6rbVoNaLXXInqGJvEe7hWS6aDRmx4VFbYbwVUaMX85lnD0xJ
hostiIYJNEAaVULfRHMvK8WNUofYqIWOqgMMjwNljLF5QHOW9n3ushN6Xq0r8Ieb263rJWGvyzcw
654yzIGLZSgf8WVd8K2gzBM1gnwA3rabLLpM9H31c/jsxOq4eLn59Oeybgb+rdJZrqtZF+/VU2U4
axN884cF4bEKK1PazSzLTBTBAYDkfGpUYFfz6mD9Pa6PhOgyTD7TDroMlMR04gcgC33/ye7MvPNE
kuQDbZSDhYZbwl2vvI1eKlRVLb6GFCsRG5RNPrrYwHPD5nSiigfGQ8KisYohtB6v1HlIA+lC19P3
Y6P1qJt4uTCntoBYQBwGMldm6ZnMJwnN24sE1zuxD8zgfmXiqsWNKmW/xNbaVjoC4kXepFYwQ3u1
i9CBT2e+QjHNYYcAmMdmC8GjLBbz1jCIDSh/dlxY4x3EnNFed2dCEr+55w+/lW6mga3ge/ZPrj06
tMiSUxSQ6YmXYgz19Uh/dlu46sYPhQuhswnGSdmjckM8M4eQR+/AtVdJdhNb4VWFscteyXssLe8u
rEiDlIP9QSVELtK788cM7/2TgXmSAH8v9Ea1k4/PTToC59agsYruPFu7xoqGQzvCVlvf8y6sqN3Z
X6HFphrQkZgdxtlDg7ojm8/a0IX+YUueg6i1u2YkYlTVIPXt3k03vIFZoG/9E2EiKGaZon803a/e
5PSO575VqjBotZs28o9ddnzT5q3+ZqTmJzWrgLJ+QoZxvD0MSBk7aAdYi2lReQqdHimO57oVSVHE
TqbklPU0PFpSpqoU7Qk/5Zlf94QIY2oEpQeaVLONb2krGq9FgGG11Q8Hj8MgKH8upWsfVdTWLvGw
WO6ia2LCG8KtS1RQVT4AnQ3Pj1se3sBgXB7g0aFCGhiuRoVHdpg4dfV4qXOJGH114mloFcxgPZvB
cgT3jqINDvBtB+NsLpBbEVsg2mMz0lS2jN/zNQfV4oXLnvLQR9fh5YxOwNrKT5ciSd32/A8PFlz+
4K+rfdz7DGX/wvRTxzTcQ8EtzqRiJaz48ZQrk1tvdRY7M+yHMy1VFuvbAMSTOnEjwXUiQJvp39JA
6OAHuwINZqZ1IEzODm+IRe3Ys/1K2DQt9sD94D02ddSJCCMF/GxoHgdr+wHRf3LmmHIILcDKbpJ2
tE0ki9PA/jWGh5fC7PH97zEVzvLC9fyWdrXh28XjCyU7r1MhLnyVp/FVip/rqbSPoMuW25shTx4o
wIn6/E+8+GQdhF0G5lBLRQNmWX4jhU4aiQUkIlKFPd+gdDIFnUcf1/qPoACCjax3+52faOZY1Pxm
ip2ztkByxgSwgMGXr1+ZlU+CvPR6LdoSDFJjsFjVpheZ3RkJeiO021v1v/atOfR/3mucAXNd/STQ
rzmDWwWu9Ya5BTO+v7fFFuhhMzQ17yqgDpJCv8lnPWvCM8vtW0t8Wm+Z9e41egd6SswEycY9TqwM
iYgmC8JpY+XEMvnh3/tfB2hbOmKXMZuyIDpwTUMsNBHDPNliKsvqsDc32B37NV3FtOCsZNpEoHmI
9sKH+IyEN+8FynqjnOMW0jiwYij7fEZLirJweGewKQ8vTdSbuPjS9dMuxZTgbxxcPWFq8wi7mT/z
nrSwA4gluhxOs3OX1pW4HMzaEsVGZzpUhegYOfLTQfMsfzVvo1R54ktm21GQ8N1EcuUBrwUTAXpV
ThtKrkgAfs9PDP6nhZ3rJ1I3fKrL57kQRkiy/5ug8SdYVxYKQnIEy9OutE0IydWHO+VYW6S8Siz1
EQSHZj55RZzjouJ7l9ybFmrRssdlHP70qoxqBtF8VWUf3dLAx0mofDK2Msb+De+rfrOgruXzJob3
0gHuN7uFx9x0t2lWeIJM+w2VJRvdHqFaqwWLsvVJPPExYCglJyAVdPGIChjh2GG1r7Bq1iOFYM4P
4S3/THD9JsmLDwAAEQ1Bmx5N4Q/yZTACI//YhqoaKJIWcpTPrYxJ1wu11kox3dIxTk+3fI/C5jzS
vP4OqhOCGBbYi4QuIvH+iifvvFU/PPIyFaGnsPw9Bh1nrbqVGcTIxYvoVfxzhmjeVGNGZYQkQUWM
8+oaZk8CEFmfr3dQTrt4A12XGSBdD5tU145rr/FAyZFtA4OPs41YCwlp6k6pSOqIlTk7LwunFH3D
4R0yd9KA7arAkQ+LARrU/8sRute247QRPNG5ZN77gP5g46lJO4q9UdUi/FjF7kBx2WnGdlf5rs8q
/V18wTqTe/C0lNYEY8FmxxK4Rx41+jGK2Mg7HmZxJ2n9bxMpIFidBQYEIET7nKDSo0ktQvxsWNcH
YNd8VyfRGcMCQkY6g0oJa/FEF1A6wSzFGkfxhaB0ai6MC6Bs3sAvtZOUQOv6oAObdrZsOf7u1y/2
z2WdGJeu3U+ErTPdEexi+pBV8laftaCDg1a8HWFwLQmrKPXBXhR8z9mFEUneIvUecicqww2CwtHh
Joe4VgxnRpEkOMit14GBdNzu+teAR8JGnj6t/z+HgqEnd7SjlyimZNqiA1OM7+pPK2goNneWyWFp
5nxkcfIhZXqWcdcyuLTIlk5aVQMlBsf6c+szDJSdwUUFH87pC8itg0HMLKndF6BDivhESag32FLu
Jv3cI0Nv/Rn5QXrbeozsyxUjRFERC+xiasBbFpokD94fBfKA+3gAWfG5zhAIhS1DkXqGStY6ii/R
18UyqypNzvBCEDhKv1ArtYzEAHEQvAriJ3+bCgwxBgi8qaps4UF8DsWnNmbjX2wWkXKSYLQmTazr
6t15noucxvUOooI2hIx+5tJO2BhdGE6R3g+g4eh3pD34VLb/8fcbyu5Vjs+uaeOoRxSeW/FzM8ao
HeE4STeuV6qjbZIwqJtxQdU/8W7Cmt4ScS18B+C5LlTbS37j/YSsofa7APCeL246xW4vT1U5lOsE
Uky+WXcdKFC8eXdqhET9emcwM6mD0T8q0IDJNMCz3EJyv8a0/4Uy7/wYfOaF8jrgYNRGrDBrpgPJ
6AI0Ryd+PS6FMgb3GMk2Wds+U5npVZ4Lj9VXDNwh4ehaUtbocDSgihkU+KUObdzB4oSMUm5ER4Om
ehoORbmxj7RBL5s8BgeT+9Ofc49EP8vScPK9i9RbnL83z+tk/bYW6y07SHBX8FB7IHYSD0p/lBff
5kPx61vffeZGa6MGV9zDVwXHtskCER7cFHJkURm0CC/97Au/8bPke+U+tgzvpfy2Kl7mdwUoQblx
k2jc8PCJcqCsiJQTOqltgJNhr1aJPOhRF8ellxNWR/PFEfFgtSfvziGkXLXa3jIte2hPcrUndNGE
kqkkfN9+S7EJNQp8pZ286Tb1pfcgSANs5mKUGYfhix+zTsX8Fx9HDCMEIUGyhoN2UVef6gJktuWx
vgQdFF/UtDLIwB2wsfxDjq+LsHbpzHE7PDzX6RTU7v/peap0aRpibLg7qvSIXxatT+gn2A7L8erg
5+Lmugf8be1tVWUsryD8XAxrsDWnnd4yhehs5Pieu3G4Fskwozgj35oFdMd76VEjR1uJmhPMqIRm
0OtV5U3ze9t0XjRb584mQyHzffMy1twIBysgd6pCrIbJa+VnOvBSKW53aJYgBvOpaVxle4JzOwVI
BGWZyUv2Js8dvTOpwDKJKYDC99HKf7snG7/JCw+IR620u+cMWFkVcy1ftaUScKjols5SMBhLcNCB
9CBufxH86OZbkpMag7vL5rkUm0TRP/fHicuLoaEQ9MS3u1z098Xgv0YI6qYB4Yrv6P39Q6IZdAfF
d/6cNtnMCRnLTyzs3Valnq+pLs1rhSjZbKgqB0HhKKKbC3meEeeXDnv/KPDYpMYxhpc6w/D7E8hF
jlNNPnQjdKZ5M3KtL2JJvPsUYkh2mqrpFleop79/fsSLLWcEPDpHovo1h6urwCeldefHIhbqoYwD
H6GhRTZxL9XiAeDQ6J7Aj7zAtJlVuBK1Ig2eucuTCN1iYjXjhexZT4S7tdCKjbrVm8oBnoSqMrQ+
7J7xFp1zXJnzAxIQMGLjTuhUe2HQI89SBokK6t0lvLID8spODmxT5cuZ5QkrDtLIgs+NgPigJbRl
IE7+JV28rfGfpVEoWqf+KJehDR5NEUaj7ihbXkEO0i8m7ru/pczhCXnH662cbx6iYG9U6+/XHjhK
H7z3C950TmLCyN6igm6dt4l2oUPUn7JZ5GXzTye5Z5AxIJpYCMXkiG1tgEmv7MRjBwATvBM+dEiv
Biwy348tK/7liSjLLEWH5fGSCwp0S280f1gAJR60WZLqkc/iTcRYWI4unPxq7WGd1sMUQjoP09rB
Q7H7ZYL6sS/p4ObxffUXe+xvBemJgr97WBYkZ7TwW9xG5HEGp+6jOBwvMiOydDfzr1+kMskWyI15
W9k7UZAiOZf2yAEf+6y5O+PotlM6Z1awBr56kKiw9NU7zuAwoe4Mwi7DDTm/b/5xDNNbbXG+NV/b
y7tWz9sOrihQ3J3c9/rr+nmTWw5sKnlzjpA+guzuI0KdRD4AxRn+RTnM+mN3w79Z01hjpXtikNLE
8jsoqp2Vw/l5mTSRumMBrn2GSOUvdeA+/hDHZ47Ux2Kf2+cRLurOZCVs0WZ0+JtJC+aD1syG5Qwf
nxeci9+kFJzj8KIA9Q9Ad3Vj+KVPZo32KqjunoSHei5cgvT31J0SlHkXFu5/i/W5b8wtqZQcfN9v
mHedWhIhwSJV6PoBzx37skjKzh7VctQDHTRre4uSXe35uAbun2p/uKosNaCgB11U+nvIyQd/UmDa
kNOhxqBxIZSlGSaFNuLJqS+zI3P8Ag+6Mu/qpnL6/dqRnRiWOOBek4JRGVL0M10gRRVj0QSmDzF1
ZGyPEoKcJHfYszhrBaeTMqQInNmzaza3d5gt6ytVCTPd3hQPKBHPiKWR40uiIENnr+ZgzosDB3GO
90fopBtJ9wNXIbncSUPYXqH38PAupX83Up4tM5eA336/mhzrHGgOyxykebjgCQ0MI6tIeKpnEysK
wILxeKryVFEIGuvChm1UUDdVSN1rQC0qz3L583B90VUNW0YGKF4niMKHAv95AXQBHBVz9/UiBb3M
q5MyyKHae10pASySfG9+rRlBf1p0fP7jqXys3NAEiccjWdUyFkIsa7lKJDUk0Vt73Pe/sb/4BcsM
oBdrr6vk6rV8GW9M2UwTJmRiUZ9i+jM4A9F6ZStno2Dtpt3VzqbqdcAnvF39y4Hw80QS6MCETDLb
cGpJJx16zwWEjFmeDPob/rSQmNxPLsKSo5Q0Y2wCmD/yphPTw+X4+t5xmRnAhO1RliYRBLtxmTfX
a6ktI3PrUCQ2h2G1eNKVtAI5TAoLDfEifre/t0gmfZP35vjz/yI4dGwHWlKVQrMoJX1p7P3/MFv1
BvhpQVfsIF1AV/uKJ/eP3NRFi8tD982sZMa4Jpt3qOweJuZO1vkP4/jsaRZ7g/u9GNOYF6ydErVS
aig3MxLkIF3za7lgdYSaqBGdYemJmZph924rBvRuLhaXBAM+Nf3AdBCvj1UTxC6s/oGcPoNHt3ip
E0SeU1yT4xTz3J4kTKOVgRG2OpvV8tGU8GVsHKLMgEYYtVf0Ddat8CiAEzE2FBz+yrJxCpesEOzQ
PvrLE1xHhZ2CG3MV/DZuvolky72ay/SgSCF8Xmr7G+xDm9kl04TAlYY2R+52kaW/7XxfbbrVLOGS
PJ8eAtiZdigiUrz3EsS/aft375LvATCXTCo8yQ5T5Y7WpzJ08sga41hyjevm0PlA2RUaLJ0TbPp1
SZ0a3F5/4x91g96DNCyjfmt7G3+Od7iw2r7SToR4w38rRXdbgXKt2v1wUbfx0S/PUGC9KK9yjP3X
6fqJnqIm1XRdbsJFaAIjk59ms/r4pfy21nBC9vBt49cykPckClv1e2l5r2V7Q1AxQa0R9VzFmzhO
QiJmDlR0zOd5yQ0p+3uglx65zMInI+VQlJt3mfhcUfBXzCxX/MmlomHE2VACLlqJb8hy/hqx3OFN
a+8p08fp1lV6/sb0BBPSDyfdw73tWguwY5ys+4yWg2qX9lnZYzQJHmkn/x2ZO4uPeFxaHBJsTxCV
CW1vLjpE2MbyHhZ8EVWUP5LzfEB5/hXcQaajoAokQAlE9AXSWWe//+wxi4RF6UBxNBCO1vgcq8ag
XZrVI6ZBq3Mt/BzH+vNBcsMAcY2Njo9nfov5hus88OZG283OgShpOuykEVIquzUQGbgJBUDqMUTA
Bz2YTXqDNGcJtRSQbF9lEqK1M/SD4PMyiYlDQc2al+cuGh7n0f3MBRjHWZ8/f5xrX57vEHGkdvdg
xiwvwFZRwxSc/RTNb1nj/3PtXPFl1H2i4dmb78aNMsivLIpM/JyiP160iIPVlLGZHfCKcIXHIs85
ghEwCh5BzqF4mjOIfrnqFFgaj7dU1dfupe2OD5XwcZfkY+RD30UlLROKPAakBPTcm1JDZaCLpgZL
p7FdD1BaG+JMlgjGo0grDs8cBf/UJGuN9kw+xT2T238+UD5vc9lW6ET6CV4ofnKdfySytJ4fXJ5k
a6GlaH71SmkMYlybMtpHUMz5tVBhIDF44K4tJxXYMACaPyliis1vSzJ9tUtTemUJUOEFQD9LwS5D
Lzc9SMu3KGEQbGp8Y/DBI10fS26S+sVdsBfekIsSjn661AM4VlcYHLwrZzRAzsSTozunnrV6x9TJ
gXKtQ7Esc9UTbzS3ZktWHaojs8f3I5iTZ2wozFvxE8ccsBdIMshdjtbz6jjKilO0nYpOUtIaZ9KY
YALQMDmSWBFuXJYTjIi+YAu8ZzG0ymACb17fy6IbU2Kt/wrz6KCk0DJsrIUVKgvgcGMRhrEgKoZ8
uaxUYsVddflffVWpLenWwhzedvysu3ARqB+nlr/uLt2aszTi5ZnWK4m9yNZqUjFi7sJCzawoRAXm
wqygZ+UrK38ZLx2sGq1sYLhDuKwa9C6pieQUvBl90J5kNqNxEWs04RXayWpCycm8VDPAA2hk/OZd
Mja3x38c042uU1P6xeku1R/vB/c3pj6OV+Yn37p+6NIeVFyMkmM6mxH9wULZfq1BxO9fVKjarm/t
pP3K7+VvroQ/zSLwGTCZq8UCBii/ju4bEFbbaP06QEp5KejZ3Js2ecwfh/SGuMsEqVBYzYrR2C/S
7XmBMd4iNwzF0BFQ8YJat4jl/WemN5h8blUzK2t3LVP0Nt7t+hJnio7oiYS6vGSpCNBIa4z+RkGR
VulGtFHy8yXPT/Wxc+dOLMeNre2WzpJurghacXQjKSsZ5ypLIXlMuFNbUtUbYeEQ6nehamune/KR
xPDn/1cVSWja/12EA3fEbjjU590LkR9z9i+SRlCJQLd4ypIOc5M9IdWHjqxQxwyHux5QV4lGXDBD
d3aNKEfREJQ/lli9bfIm+nt1Bj9f3OL62WqGr9zrRdS/Oz7CVW8jX3a5pISphGnhybdu3ahpRoMh
rOINWiuffr4mOPdrEEK2rn44lWc667JzXOTZaZ8vmS13u3d0CYZovD/2TUet35LnXnKpVd28BP/C
on1eJ8AU9+rMGVwC4HuYes0oWjRaWyNJonsB6VO8X8ujOnv3YpM3tMuRhqJ5xPs5V07gJlB6Hqii
4zS9FOC36Gghy4PXu2vV1uWYjVoBonVMtCvbt2dRv1IHeH4mALAWbmPxhm2YL1dam3zlh8qa3IDG
E4m9dsNs4+Wxe/LNDTvCEmdLGgJ/HtIZBQXGNa35Eplkk3T70JYmRk4K7vygSLO+jAWGICZQGES+
YRSV8CnbgVKgFNRwSRNn/Up3d8BOMPDwBEjVoASc7QEnATjTfhtLN4/OYpHylYAAABR/QZs/TeEP
8mUwAl+JVls42P3yXcegZfc6yTR4gXedFQ6uRPD+MuSF1pBj44TNcpi6HdQZTCYDBIRyb2WXsAkA
rLnaZDMz9QysQ1LXlN0+i3F8oSzmtBWpM36tQKNdRVAdOSolSv/SX4ATVuYUlj/OwE0Ievky11r6
RmDCUXaFrVgwYjuKYoGnTsiSHLzQf3XsrVAisVUj7QX9+uHaDxQco6uJt57APYo7ecwhplr7xV1s
Sh6aC+E2RFlIuI6Uis/e1sFnbXQfs7gKmS19XUFkITDjvennhL9jJrBM9XQqImNUA/2NNVH1T8y8
9MC4GVbHPs2suQIXD+2iD12rPS6S6FPHRLt+BXCH6hPXkRIrZeSPkAHztFvzEv+jwI3DoF4T3pdl
QlVHWiTWtQfuC+MkgfW58IFPl2nSILYrlh7u7mLev1LeRwK7uksHAq7UKPkCKzcJgTqxEw5hCvMW
RZNEF/G26VwDXBJIB3kiCzk69P/pR4amXYnqqVdmRn9nUG9n8euhej1eXNd/bzJsSpq9XA2PNio8
0c7qOkRemHOOjzzlPhmjlyHlGvzcDe9m1eg2+rqaLWwfdMADj6KFQFKciuoxOj7CFnJnVg5RTHlT
ehoi1H9xbEUGR1MkEEOP1iakewTabRXfw5gspJeBs4JU39E37naY66PciTieI1dUpBJOSn17D/C0
t37DVhpcuo9NrxEoCSKi6YWfe1QJMyBf3gW91VXndBvBbxxet0cA9zjSeQvquwl/8ukw0MXQFVCP
RaxTHj944SQj1xCinwckOfRKluRYenZ4gSYXDnPkerpgGecn5hvbn+Smk20R8yyq4tB7iqDFqXeL
uOEsPe8tNDh7p/YwXiXRk2PbqyyqhSRnJkSnPcpuIcWHX1F0qHR3xmy4Pmt1lKJQMAqKXIW9QVQH
hKYxWvQ9loNRk+VRerXXaTgqH/a2VgxlPCUB7NPOhbJdW07dH/WTURIHajfJNPdKQyhSNf3ETRh1
QIqvavyixPupwLpbQvhTin2Gz6Kn0ewN+v5ExWEU8JeYJrLr2aBjtWpGcQQd8+m1apAIOOuI/Grs
pQqv46c0/invuQ+0GKkSeJf/8znYsbkxzc26qcKg6Zspz6vUCPdtgsBDN7S1zyEFW5wGUjWASm4x
Tl5VYWCh1oWMIfMkD52R/8vBoChcdL1Mrj/NP5cgE86ldQmqjP6Y7GIiFM0ZmyLVdOm1ke8OGK9g
4VjbZlWRBlgB7ZNRqTFXTdqDGVL16ZHtMGtH7PJhDIyIbxx40YG78ajWeQeBpf3o+VOkeoEB8T9D
2kJVp900EKH/Fyck/FoJRypialponx5QqpgWAXY5UTQS3J0G9vdD1pDdfkSZ695yDR0v8dq7J/Iz
PWmH4Okj7v0D3ixmDAeMousYEBeOnRZGYmcu/GyEoK8YeyoYKuYVOLDJCzkqiZnsfgzcNWKTJtm/
RpJ3xw9NlyW3Nea14UNE+QWbrM1Pn5ZKRAR0l4wwv1m9EJ6Ur2HfmqZJKL68UTOfE1arXDKupe2P
F6m7rb+1wMHgYJ5LG+HdiNGrfya5etBKIm23d29YeIKyCmC5YPPg741MTBwLhnB/dotDTwDvHMVv
NqXQQ3NYUkpU73ZAh+GDCs0JeRrZ6ZDCizjQhS5jj0I6LNFmgbaqjFGhSG+ez2FtRQF2yBAbxlHn
bqpqQ50T3dJwfCqnDZyU1yP/itKqJ2k1MifqqvJs2aivPxvtKEptAuXOHII3wp/d+yUGtDJl/GO5
RaV2SBSa/6jPlIF68jZnsb8WR6Ta0wHyj+fvRuC1Z4uxgrazV1rAq8YDy8szsKdZk9R3hxZxj4s2
OGMxmEl2MT/IwKEyD4/28yfS5/VORNHpEgp5S+zgF1t5Bu/eCMM36wSPsSV60dTuRcxn2C45ZZdA
xCaGN72U5BKUqFOpexi0Nnqt7dZlWH7Ak+LH48LfI6nziLxdw+gMzkG80/uWT8IAC7aQXTAQXX/9
JuLYBOZNyM65D68jq6/+LiyJLq6jNeT6Ci1PH38vsnjh2mXKbbW5Z2lA17yF8gL44mBd1cL0PH7i
a2JDFEj+VqYN2A2x9F9By4zo3RbfWtF+H0QYgnq9jiB8ki3J+oGJIIRncv9GlNV8Qgjv+hP9DDKS
Imx8Kd14DUBdx3XQ/8LsskW4967UCgdmKFn/nSFxoChvNTugNudSCYq6LtDa7IlXFONb8fxtJfFp
7t8OT7ujLhQmnGAc6sDsUTazM4GnRaQpXpep2sQrU5qkeNMwJBUwQBXof/37hmzq+LDol+SgwQKh
Cva7ZbCkq1O0Cp9mKm2QMRCXRhWimRO5DSfBZy4VKhNCQ1oKLkDIXiBtViSETJUWpjcyHMfLrDPZ
urN6yM0+96MfsnC0QZ7xbtlJUJQqDCB13AphGhCMt0N/uWMAdfrDEiePA5fBTiySABB1r35MBEFV
1gummVi/ciA8eJwcyfsWKXqafGxEpkYxxPbkafu5hcDkmuiW/40EAoe8+jpgVdrgLMTK4xMdgiqi
1HsdWn9LXAE7Jvg78qAXLuBwtju0e5hun7dOrvHDwcC2YPzGF+ZcYrWXumCMoK5JmelC1X6KODnD
dcDi5hZ0BNaESi7RO+zVVC+Ggo4eGs64GVrZtf5grBOoORz0Gquvt5yXthjn5Qg5Lx6uc5Uhb14D
ImtN5e71ooyoMKtkaSmHMr4pjp3l7rykdXZQVe6BJk7JD27wo23nlpGe9MvabiFbHSPTETTS4Ss5
U6+spR0iv7ZsyQTJNqqbosCJg/VpAu1NjJiPNo7kkcubTcSD3nl2dGwdbd42KQdyRluAGdK2CciR
dRdmkyLQbwsdj1Mri0SWHr53ag5VmtnhNox0wPVjUUXCvu1JyaKToXCiOEn8HRG6GXWLdm8NxJzp
1IuUPZAl4DwSw0Arv/BbIUpAwsuQPDqO1KOJ+AnvHRfKa0wW6UaQpg+h+3iKqimdpV9CRInCJmGr
/5zgNcep3h7DlHdapZF2isCMFpSgupLEObqDPqfbncu2IBkhwywJFE0wo2k5FR99sevKvO8yWnd9
45ihCNhdI19/EwmSlVOlvsdWtiVKt+t3O1w1CXd1lk2UWgr4+ho47c6zNGEeG46SdxmZQMEb7jV3
w0ZAhaa0gVMQL/mk0JzzubPqOZzwrbyKz9NKzxUv1DUE05FxSgE7gIQnH1TRE3koAFIoTyuXRUac
p7OzOiSJhz4EuwjxO6/mkkDdtGkBZ279IYGEDGQgQYn6ureVo/mODDG1bwogJvxx4MnsOHipQ/yH
bdEej9We+OCccaKc/wCqJwuVH+ckdVX3Ibh52XkyRGbcmrFdCkvZOEYrk86k3pIecSHeivqdMEnt
xulR0wu0PzQg5yVk0AZjl4HfkwXT0gw9LFJf45a6noiB7f4q0Py5imWVEI8AAcx7Q9PK6ZDu7yde
r48OXGU2ikgFPW6Y0ATclgrtlf8MA39AhgGT4Q3AiObDgxQVs5Nnno/Qu5Y2RA0FPhGpeWkD3ThB
cJcoSDJfyx/apjFXx8ffjawbSt0J+8eMu/MKxErfM5cP8jz3qTzJfW4rqCAN7kJywsBX4daAbD7M
0U80l6HUVwoYvMrdsuWa3gVXshr82I7IBGS9HjQ1EVxgIjJ7oRdDBhd1+uJEtGxt576yhiQ2YENq
gzkZ1jfooSv9ckDLh3Eolnm1h7jeyp7IyOfGYenm2PWvtgKUu9FK+ubd9+8/XdapsI5+eWm/tQPH
RezE3y8CfuQ58sI7Y3wTUsNWPoNOLu3YP7uMCBBc8CxZVadSMDNOqkMds+kbauwkQjb5XrWVTCdB
zrrbcCxn6IxrvVDiuWTyUbz668jqINDPZDxFalEIyI2ifdVeOsMcIe2PPSnTQgmu7PpYj0y7uQVi
zaACenu2zDsGqrhxtVgtDUv+pl9HL96/caP2tPgeOGuYkV0m57FhQwWVakjGuzeqsv1PcK1jWkMv
y+cYbZhU6bCM9J2h4rSXv7yKr+rkzAnglAx1hPM54fah76QbQMiOwua/VrpZswgrcGzqNky7g6Mi
+MTZR8uMqMyv1dsI/qHcI+XX5beH+G+uCvSD4lmPXfRlL8ID0d/lasD+cgqb65AdrA5Zam8bizUo
dpDJHNI43DM2DK/z6oms5hD+yOk9phQ9QumYcjZqFC5kfDeD0h/TKq9+IrFt0Vt3x9Ps4yOHxjIS
vRVF80EThbU226OwJAfTciQJXnPOb9ziI78U0ExLGEcjcwPPl2JWdTIvRisZ6cfqvfqDrotKNHVb
ISRbLD5ePBSJgt5QEnAXIpmZvNe14fCAUNZ5867rvjXARgB1X+eOi/fdwOIFphGINo6vu4r2z5YY
8m83OOdOi1iKox4t7zwx59TxrGhv3dDSNENhaSxbNM2PZ374uTWL5hHrOkCS29MA9oLKtJhqvpSH
qaAoCG15/qi1Bj2Fbcd1vz8/llJVdPfV3Nhbb2Xl/rvJMwYPTYQjHgNWCsqx35cVElKSdJgDVoWI
mtG+ZZYkhYxYrIWCGv9SZWXqIBiRrY8hAvlGne3YZuRaXYu9K/Ze0T/hkhmO6EXtgzqNaXhIxR9M
OHOhVK7ADsfgBLfv1V7/KFa1fDpvD8n5w3tCNdeWfnkPWwq+ycQ+k/Y9rt3xuTNh4GwTsjWCcWwA
OcJgJmO5Z2LndRDYgBmp6jrryQMS7En2QcVrCDhrZ3tXPoLC7dUHvdL+gFuLcoBcHdjcp4UBp5+D
DU/epr5+gvdJs889eAAgBCBZvpOfO1sLDLtvJNNC2V5Zi7Lniomnk5NYSNK6ZQ40u6mIUKcaTZj2
YTWOsrD/jbrOfCDNAuNEeknY6g1QXQ+VBPZYLodCczF8Ikz46+CVyzm5UpmO/fexNyayIRgcdfhv
u3isocCKs+x5sZLfnX8H8MAz/Yjag1e8wro7IQlVv4LiliFQq+6xb5f0GY8LvJkI5KXV/CuGUxbW
eiEgCMYuYHNekEDqyIxemQ24QXKJb6VKy1UGTcDTAaXEgQO/X/jvA+WWzfb37uUjxXhJ3egnwbDo
Rro1cUG6ErLHpXjwmCiemjqVhMwUqy5kBoS5Z/d141yt9ESCOSdZFP+LLC1gPukfdAqmZtP431c2
4Qa33JX6mo0gGAbRg/S/4MgFMMvXl+aR+SFA+t2QkODGzVekJFcYzvsI1KyRJfaYuU8c6fEJYMVU
4VOp7D2ehr7fnG/xva5HIBU2uwcncDjmegGt8DFICJoRS5a7d1e7IP8JthVCvr1oRo7ecnZjRKyx
1yrJO5tgUBJKJTk5Db4X3F9GAIwsVSkDjusTMDvmcgNIpRJUJU6Hs6VDQfZLVMI7vwnxLdGPcuEt
3ZW1eXoxCPB+/m/i6OyVIJuqr8pX5SFazxjDn9lWlzcP2b9SNxXLkoWr5dTLw8om2HyPaaGAvHUU
1eGN4b9J52OJBXRDQZCAT2c9sE7oLv8+A2tiOabPgN+xHTt4ZDsi0IxOaMxS818UaPCWk8CKHl0K
nyp1prvW1MCXvx+o1Vou06dXXGweL8UrREnrldfZfd77LutVip4qzMnzYyd1vmW6VXIw6TrJkXHZ
Y1srIyoH9jvtg+UNpQgoD/gochMLcXSOMFeDDvxwl/3KxPh4yIeelsrOMjhbOU984l28TwGf8ZaP
Q/867GRwmh9AkYmSzYPpRj7+r/BGOGQ7PfZO4GY7Glm1Kgd1sUj5U/2T9GCINoHnlxzpjnXSQIKG
iKCkKk5OFEKuBOBaeWskI0Zh0Z98vrAdifQkGpm37pjCIXvxCllJlFkbWpGfw3vh1uOei+zqrz7d
bdmTbxBZ/rjFMcxBlvAKUmp+mM0qa52WJxeuKUDVvfRMi+4kPsrT3CcUD8QR81g7hpYWmphJUdbO
+Ir0svSAUuMaXiPW1MiU73NVzjKEx76LC7BVQOeHZAHcpE1mQ0/ArnH5MxukT6bxRzJsIF+MKpKs
cMq602j9JfanBTHCMBnuBx5Ob6koXuWre6Ksv5MeCJFz9TgKzdWAM4L4F1EmTVZlfyRaatI0WYPU
K3+ceM6O56bJIlwbbMv7C5izIrvUTziL7PdCIt56c1BPJncJI96gwSDjD4GUXmK9ObhYonjUl24T
2J3KD6fDEIItpgGa57Ib3vV2FsuLR4wOvFqo9C9ab94ql5o2UWyciMbeAf8bVx6XqC4xqVY5wTWg
4yR7qHpALtCUcA3OQtQSufBVVD0CsPSVJduUt2gguF01E4wnK7Ilf4ygpGehidSCgAPlQIS1iohT
/k47/4GgNQYWhMUuFNucWHsS0XobSfCpr3i7PwwvgFbuwG0zpppmUedbeptjtYQfCOGLZauiGkPo
Q29TGCLI89nNkzIXab0podkFbPuoBeYPbVyK+Wkz/HzmRRenWpnhU2pb7uoyYccMEaOQGLUMyQih
K/kiLQwoZYmBBcIOxdNwW1/rSWUr5fI/mpzQMYj3i/WUGFv3kL9joExUroN5pBEfos1MBE5lbf6w
r8w/keX5SfEDkksgkURZ+i018ZOAVEzpCjLlCFsBa2RJC5f3OZOlsXlUq7jLx86jqb9XqxUo5Iy+
PPMa9S9pfM8VDQWC3/58+QfMqt3Bg2Lc3DSWX67Zo8cGyVl8pMO70kfHCal6DbZO8kA+fZJDLeUm
C/g80CEHenBW9iQqlnLoEqchMnIZKx2EjQIHKrFQAcv4fA1X8xItJPXZiiX6SyQvmPhnGdrbLNg1
XXxZuH4THyOVNu8n7DQiDqAU6aOdkezBQ3tA4Xqowh5qZI8AW0im0aTlC3dZeL2oO7vsLJUEx2Kq
AVWk+06Z89G0ADYiWIiQySLaDeHiY0oqFouIoGnhCquf0zUEXWxz1oTzm3LYvT+JlQfNVC812Q1E
7aVDqj6ZDDf5xSLFeyx1xsp3hzv3EU9rc6HI1rbMvGUucHq1XK+kkR+Av4oaJee2Ldp8QNVTySwY
hta3RZGaSY7yrL1aPT5c8qqGQzjWB+6AAtsNpGPfSta07j0nphAPC+Lv+B457+jzmTH8JPfsAAAC
gEGbQE3hD/JlMAIj/60goeCb14ydlS4mqaT4SKHd+tvUulrdJn/ALo59Lq7CsFZCQ6itRN/WaY30
AY8Lrim96/+RCOjPJuFay+n7OD1NDnZQBkjfTGb1FPWTy4rnvFicWef4Bk87iqll4TgurGXQo6NC
WZgRMD7YAEs+jjq7WEYDA4gGRCfEQDirkcP2dFs//rtWXs1ldBNcDDrze9iwAwQFtqwmmO6BTLyI
JQFs6d2d23Hnrlug/RfCarFOZkJqqOhMjysKtyhrpipIc7p3jDJ5Tp3tOhnarc0zvI08A0gM9gUw
2op9lJ6y8uM63C7JrZh/YjAR3ihxhifF5FtiCUbElGFc30shSzlr/wkScgT2f4HVzdlv1ehYtGWW
jFwiN/Rxv2Fx1zF/eawqIVBbyoPt3wLnVyLvrD89OcSR6vVfWX1LR+vQH9piK29lRDvMQ3OMbZl8
RSSFu9+I6/JsofvhVuJ0XjYGxeWMkT90Set/b5dJg5rTY7/g36u5N4mZiT0rj+p4rAiaMPGMTmQ6
UyqgjZJQyrWgk7hYR64sCdTpveWICDBOpPBqg5xAl7tYaxAbyg6/dZqctv3YOSXCIo43zSBUbitl
Ykw7klIWbn0d6Dkt4EoXIlwo2dn9+gVPC+/2PUsaNUrSPyaLXWOLkFIWW318jyz0hpTWzShChR+6
KRGjsAFUpB5G+uKSQysADUxP6ycFtDbMdXi1Uec8G2/16ox0zz3wifZ//BDSnQQ5HvRh70rY4OXG
UGmqF2PnVE7ajOeHFS9e7bYLgZbzoaST2vDKgpLGU/57j7bXWdVdt42qA6Pij5jjb6ATIBexcNpB
PWOKldcCyh2U4Tu2yIcAAA2zQZthTeEP8mUwAiv/x8Wa/gvgxDUG1cdXBqpid7JvHI6yvyhtFylR
dWBTAtuasYOMkWgH/Yg2xtHYwXSMXvaJgLBLmL6FhJF59Q3drauStjjB7avi6YJAV01fLBkyC24y
rxTQtELJIQIKe32zdBKNU5ahHalKaT6dnPeGK/nHLddBQp9frx2ZWMWtiM7vAY9gulP0Z6gn1RFd
eDa3ytaL4eIz1vFjYntEAejQ5ixUh3er59YJ32uYG2KhprHc/wCYcTV12m3w8gfyo6ApHos9IIgK
spT3czy/VKdm7ywUu4a+u1MqFGCheKIDgTvAgtk2Om/cGLsxf0NwSDJEr5fsG0XKwGw6mlQX+7SO
ExEr8ch8FCGt7U4RcVwtYo3q22RfSq5+oMm3rl2bHuhYK/HMwtRuE8EpdR7YvZm0KFDwjKLSa3db
VlMyZ4VcBK1koExGfMof8gCHiCx1K2LkZLd/WMBZRGosV/HUBJ8j6NJJ5QRJ8Q8/jswFsRhI0QJX
KUSxOBtI/4VVhk5VupByJtmYBDFttoT45T6wQgfTf68SePTK6Uqvlee0IHVXjIYqQQvivblDqyCE
7nMJuWnHaLeZbaArEwbQ6lM/DprfOdnTqbrP3wfrDWjPGJLSJNhA2AKg1HpPvdLJo7yUZ1UCM+df
+2+U93zmvdDsAEQpzwTs8/rIcJQ9w3TxpzwcwMv27hFkFmgkw+rkzjp1l6Hl8KsyjAoE3NmNU5rs
bbNmQxs5RMYDhtuQdq0WXzMGBRTblXldxFU8tfZk9Tddd4HWFQdqHm0Az49S9gjo9LqOQiOMpTAt
cTDV3ileShTqoJ0kjnf5hvuy31AYEsC9NrnFynYH1wW4dGQwkA/stEbp4kaRscE9Akm7KXi0x0tb
hvOqN/6ul/YNEuG2F2Iy50jpmXG6WuSq3pDGHInCrGTRoU04jSerSArcVMiUaslm44CGZ9eco5wL
fyak3n/kQfCP8niHe83W4vqWUnwHsRkcG4BKJHfzaFgn67nDR43AXpEsPDTk79bWCuk2yc8AQbgi
RWXSYpzof0n+NlQXmb24TJQFkP4p68nxQTxXBDafuj8WyxqVNb+dTWv7v4CRpMJjA9mJ/c/SuAhy
ah1wMp8GqOi2C9pcZY+o1OfmTut+1i6ce+cVk+OIv9+LrTYrFVNbZkasyUOmNRkU/p+5wrIzR9td
mWYaxheErYBsPqcZ7veOB3Cwub6Hx/0qEb1grksjue979VZe74vTemyknxEAPbcO6qkLE6fnnYFy
JVpxJ4E1JhUaALh1B9PthyKqNs2NpTjh/WKeGrp1a0ZugBxRp+ZA8d2jTZBXMHnnXArVuKyhHDd+
YZEfNFKUJatmQnSodOnYmBMXz9meIeM2eFBjtjxIfZwfWSnVfUV0EdDIGzyeEa+n1DzTxUGgvxSX
LIrIFC20pmWy6Ywqlr6rgIxb1kDlLeR9mByjpT1ydlUXXCrb+t6omqcmPbBxYQV3C/kuYDzWUESg
4Tfy7TKkyekPhUj7/TQaXmHSztm7ZJdcGuXl5dBPGozHQ9x+Q55zFHDmDjHs78CIQID2/9Me1zqd
A0Tl2KgehI2Ri3yTdiFYLkN44MFYZXycAyN1Bn59ccLBPkeMipkYZg6poWO8mMZ/6xfsbuRBEdhA
RNWR8CYTX52y8dS/L/tCveKKU7DCZLXVKzXHkg+oqubAFAcrHrivVpy+kwV96brCPzmsKp0qcpxf
idkWkUH3OBdMl3iCndCYlJABK+ba2TkcQNCPqFP3WikRJna0SQz3mI9lKAdp+XnkpZkdEfINdD56
Kdi8RVOfmK6vFHV8EVdNR8zuDCJnsJpw8tHSgo0eU6zOu+rK0UtOcD54PjNw1XoJ8bQAzpzQmikQ
azRypGLD4UJFm8XP5SIjOn8aExhX/igmRaSznqX27xXQt1FbM4/waeDv8R/qUF0dZ0Vp0a/k64AP
oIMxHv541n+5Gl2BgYUzJo49/xDAznuCLofuBBRFX54L/xC3G1uasFXACb1q6mB0Cww55VMKWMD3
L7tgGEicf+ApUIVJdFNbpY4qQrAh5uwykumHNM7tjp7jjViVt/9XKlMz8fTKljQo7vnvwbXvMoft
S5T5l+z2JHpN+sj+4J9ZWHNza3UTHiVlZtrBuaZmz7+x4beGJ5TWmXS/4YGWeY8tqjUSX9TwR3tT
LuHul3RoiByKEsITy02oNxBtA7jF5/+sdszg+vvlCQlul2CrSSQ2E6CVvYO8Bf5W53m3P4IwuxWG
Ba6NwPqCkb1i61dB4shrpB9w46CfQrRxP0eJoqBmMKyttHY7lK7RVEq4ikeaaIm3lNNet3NVziZe
p+UQ+gFCzjnN37xJzlf+Ab38/OIjTfAAOlo8g1LUNmhkEBzdkfC25oHfxFUolWDDJV4bEua2OjYa
poAcV8MFVhSbOz4P0WMVfOEG5oGdfEBMJ8rDtVtW7WZrW1h8NRoC5C9wWsmmIA2naH9ULumsNKFR
Q1R3/5FC8h3YKQHJwLVwZJ9asp0qiGTiaSqwEERpe0Seqoj6qjUATY1ldKRFjipBirPshkr66D2U
Htc/7XJRabycSz9mAKgwwnfCSw3+jj35QdR3hWTDUP1RMpo8K01b0RXR8zAClp1djKOoPtEKqxar
QPmskFWCPqs/RQ6Ycnafa0lPV42mmtfySxeVetpO1uUCQDncl10pCFA3jaBW7ngxtfh9z/bB4NFy
zmo6O6PAttVUHQyLMhiDQPSHCjLbSXksTliALVVQX2+l+1ptTQflqznar4ApkiJFjvE5tCbgk42H
n44A+YJJn7bYKPeuvYSXqhkeQW8KGVCv2H4Y0vhKmtoGsipqAlzWtvx3BbJotIABx1fPfID9nACj
V9WK+vGXpq+wLXtIfl9+1GywA5HXCskLUuqlbJ03LrTUdDMmF9oXwCkKuC5HL8eIrNyxoa0/Mmim
QWD4lIpXh/go8qBOSfMEQjuqlXAeWE90DZLwlsU0H3yUvcNr4CZkoY64SSV3S9f4luNcVdsnguLg
5fchNlXNPhcXguYvFRvEs1XK+s73Tp+01YjCYCC1g5lDgtKhYQZGTjOEkkEiDILAjSyI0IVv7FwL
CW6mtDv9ozpcSsk680q8svVIHiOgMDOKMBBs3Q2EQGBQyxcXuVDnZp7QGR8n9FHupaRJN+GJYxsd
nUYOHiwWEeGSDWGvENqK9g7PoNmnqzzZHqrI3+pU/RI60I46KM4i12MReyaedrm3amgGm5wU8dWS
w0xLWvYbMEKC/6wf3oAHQIA4+ozt6TKkkxlT6nXKxa9SKe0D+/qyYqMHaPHATLtDwcJp/sJynxDe
s8yCKipac2E0LFqQdZ1TIN9YknZWmSgdS9jLpJhBDEFrnPSNtJnOmb1FBBNEpPF5ZIST1HeTiRfK
mkT25w0fDPgumEdpsd4sQw3ar67Hi7JE5dHE5HltuU3Xzzf0Ais+oMKb8P0tv4/lfZ9GmhJCo9z+
YgUyhMm2nHcUpQPDgAEawSOhwacBqJGMHzQQ0C3fA/4BmAXwCJAJJTehejRN0s8bXQ+BaKYpcjwc
sKNPaq9Q2XGZ/t/EdqIowTtJVuXdqSHGivFk9g5nQK/N3VbXYoeR0G0spuuVahv2mKTPfzuO+zoT
fuXcQIMoO7UAdKVc3WCtIKYMFjcwkpc+PpwfgTNT5I7vWj0a0aMCIh7WXFKkk7tDLZi2djStbWDM
rEEA9TsiEjOQKJXCKu9m/3RzkY6qF451c0/XVMfdHSZ2pfMCm3LsQFztgK+wbWkLeW/KT0SjyEqH
zaUIEFNoKZh1FlEOOLGG3bl4fCNsvI5CxfMUKXldnAMCDH/81M5Hp37+FMvzrwZuSrAS31ELYC54
In4fWGTT6MILAXx0rVS9Hjh4AxGDjx1kQyIBWoIplMeLxjT81nBCgeJj/5Wde0+ohhjDVTApfYL/
clFycrK3H3bmuk3NDoyja6dn6PNOCwUzCslEefcYzUS+ghsL0tMBw/xeM18v9+jXmS1oRUs8ehFM
owLl+4L5u7D7Qryj7iPAfKTZhdzrW4nxQzUaLG7LI/NcXkRmEcld03Oy+O2oygztq1Zg22XYpVkX
2gCLhjvmlHAlbuYE3JAExOmSnHhruwmIMqNd1RZgc/I7FrEY/pKRJYoCXQ3GdklQZ4wNc26M1WR9
uZ3dbqlbh/5DVEcC76R1d+jWbo59E9jbwNFvkujQDSUrG+JPDAP/0Lk20QHhAHWoi1Ik4si6wqbY
cV12QASbrhQYfq2OOS/X/caSGrSJ4/bVRwMYt6xOvwuvp80AYHOA8UnC4GjngXWc/M2tpbuZjAiw
s5bULVWcuIuuyeRXHZEggktT9MHz0duugdQj63vM1k6pnsv24iH3NPF2EW6725uHhbMlEAlwEySS
K5H64FbgDXys5sX9JwJgwNaxAwEdOKIIkKDq/gAML0jiVmhGeFTh8AypZ8/MuIKE+qHya2mAzgd5
qAzijEFJB8iTUmr+lEmPrfXaJCgKo9PoEmPUBv0M55XbTmU+8RBxDPM9cNangOvgkQsfKvpLRNjJ
Bso2AHN4UoBlWwFlf/py8zyylHpEOFShNc0efcQ2N8R5qyB+WJzZIBRTY3mIrF5dh765+TnSDTdN
5Qci6XVJ92J22XgC2j983tAR9ruOAo5rpMbT95hLOgE1WJxk6FvhaOBdbgHghqgwAAAOD0Gbg03h
D/JlMAUVExX/30oqw2hWYMfm/zTgO8SighUl565MPJ7kkKFXgSBICgCFEBf1L/SENp/cnxWFNXh0
bUAAOKbC7qRj+jhNcon4j6e84OZH72JUJCyQRrw5PsracnX9UJ4ygSV4SvLyhzGSdLMnbfFK4kfo
6aNR6UziQw09PFtY5YgURaeLB4EqdajVoBSQcZwudHGZiQwXwmHBaOLCZf6OsZ6WHnaa3ODjXKBf
O7oEhhnKLjBrbSZctsYncZ5FFHm8KqTwgGKKnedfpRRWSQTyw9UTcjrFyEjPa1ob+Ojfjmh3AgqR
S4FaxyGtrHPO1OxKtVr3fLsAOa6GHymWIwsJ6CFuoIGh1TbwsTKnUwR0XG0o9eBguPMmTgwkwfOV
77fypKoiOz4qt7ai3i8NFWEUUlWiNujYGaIW9ssY7cQ9c1uRitS+q/BrH5ovGc2FlLbPCEqdaSSV
zpCHr8TuZ2409zRwgSMDLfSlIGGXqXcUayOvGqpL9Tc/POujJXpASzPj5NnWGJBzwAS7mzd8/9l8
b+tI+3V4NXrsUWmTSM6DQwXWBgNXXcoSQDpz3/bc7q1pPX748XW6ri8jf4C5fTndO1UK27TkXkTy
JY3ASJGDd9Y4Q3pmsvpmtx8LlIjKLvKUtBGYHUgOY6cvxn9N8hgyjvlldul/aRnooUYDJlXo0n25
L3jd6cy1V/E2J5JPxthNOA0u+mthDoexGzavy/4d46twaqoKEchOy5yfbWr6gL0A8+ThMFq4DI8w
R9PlXOeOYVJJxbhmhDJzKpTZMwmphFgWc5SzKwUpC5naL0DBIgVk/9qb8JAuOe90fyO8IPLOg26F
Tm2sLGH1gRbFYzmOk1TVlRK5Lga3vHT/Qp3JGyU+9vdPAgIg+9ZvF4IQPM6UW7MnetLOtkfFC8ol
PmxIQILxuczNC4KAc7wJuSOmNKsVzRY+AZMC7ugPVE4fzOHhWQ3MYigfzPNilF+qhfkmykmckYNg
usLLtY4iSviBaqUCCnreUV9v3OrpxKg7Ip7h/i2/f+CCwHILH3t9WWGrE/nafoGvnU/KRFD+voNE
Ll32lyme7EuB+1JocYTbl2obkHxqlJnPn/z2TUj2csXw/X2FStI1ZuJYePbbmKL+7mpYb8hLtR2+
IkJ+/chO/QbPMBoW5D5jRGLKgPpJ4g5yiYm1wxOiByChAhmQQGEY+tfwWwm8wKwLsCLu+ij/Z1Bw
B8dDP8SZxadFJ58bxaf1LDn3y5+aYnRb6oX9F6h23Mfd2CqbrVfeoXMguBTOvm4h9Hg6A9GrZfsN
yrC5L20dcjKA/dmJULxJiIU/Hd5FdQC+8Ocgd3WGAuyC4LQAmLLJiQ59vFm3P0rpKYzyD9TCSe+4
k70IRuLTPzJi9UU1rPxRlK2KKDx0cmS0dU85y0stqCbNIXhASwFgViOQIA3HlFrkLustEHxBCzkZ
sS2B095tLhgpLl4e+i77Q+V0rO5o3iH056Eb6glzn9WMwfS8PzKQix3dQOP2hREmLNayzfZRfbNl
fBQz/466aJ5XdF6mdm4lEcOj4nEPNoVE3fQRYwFr6YMV2WFYCuAXI+rVL31Q9Vxkaar4eXWqssMD
RDNLHWjzFhJSrZAIIukc5nYOANhJveqUwIsHVP93VM1kd+vogjR0WOHytIinA0xSgg2iGnogA9O+
tvH5uk3gYS0u/vQcCQELPCnJGNa501ZbHXFSb7Indq3p9dGVbCMBhwy67/LsEqfGcXGuLDdfx39N
ntDkgwcK9my1cQFJGngxYs/4fXB/QaFdD2N9SbPtR9qbK+7kWp3q/xSZ08T0OAST3zkW8t3DTYfy
MTwOEdg9ld/YBBvMxi9BqsLwNJSRL3Y512F9s6iq4EgHdC9SLexdv+fHJCR2sG6aVhV6yfSTEN71
WVb9U05Abc4RLCKoP0ga/sIFI48P8P4a0ic8EngG4w9nOkuKulJmshFgth1j/nmd7isJXAj2Y78Q
UH01vmnd9ri00CgkPPW6bH/VPoWfOsF+nTxqiet9l9dL6uFNwUY1OoSzF7bjBtSMzkSkrAfAiu56
ZcZQKZjLmj/RNLiFrPvb9CraktpkaDvhwKvQmFWvw9zcjfcCbxO9kp1vimJ5nTlTfBRTjWVRsCbC
7ndl+FtCRU6+ztd+wXvuVBkmo9Ri+pOVuYKsSqrnw7xdqvczIN3rq4/qm+2nGNzQlFG6uqiz0TMA
kCwPumDC5eN7NKyzmriRloLLaIODkFky/18kqqlVwmmy+ogVEqsp0l07bbI8aXeenGMfFPXNePMT
ZlMXDWUFWgAUly0Xfigf+hK4li5husEYsiiL1kToaKum8GsLIoeATMoj0dOuWfhPw+ZtTfQPlsOH
bpGd4+k2PhsKYAhHZBmkhVnb0N4V7QN27f2eI9iFlT2pfw7pHwgj/7oqGUJkdxMnDBXtuJkgqNXB
i+hNXLhx8vDWv2M4UYaiQ7HhpwIFxvtRlkDRbdcqtUUKkC/10ZhtHk1kLLB7EwL7tqqOB0k6yvBm
KslyBtjfJ1FOucMXWcj2BZGkubENpXyhNoGUIbvfVw10pK3MLYAaCNIZF5IYPLGSixg6BEVKS8gw
6PQNcogUL6Y5TxriJ4dEUuVodQGzVSt9XEcFfN6KUGFDpZRspe4QbM19Et0bXnE4lM58gUqx8m7D
DaicShVQ8s7ODdhlE5VXxx1UAfc6KpH5siVfQiVU5mr114ApExrUYyCd5I7iFbnCi2PWSIAKiTNZ
3gg/uAhjhi/yYXuL1Ia7jhdGJ9HZBSgzPuuE9ZeM1VeLlVkC4QwFFp9/CvuioDZIoW6P+SwSPiv3
AW9JTp3MRKufSlHPjBzlcf1Osrob17xIoW1hDjKBkHou+zA9Rj7foQed5uYnsiL6ki6L4U08cLZf
G3UsNQbtl6augjC1EnrWKU1gX9RNmTpiyPWZhTY1DWAa5ExaFwUBkV0bAgPPtXL+lipF6aikSig7
oLbfT2cKITRwTzL8XyoBWW7SrTl8aKYPXZrmYYa79Y83rPl5VT8O39b/Ae62DBr1f7j5ehAcKKdC
Uox1G/UxMmJ6ao4ReHZyGYEwJgC5ZJKd1B1V63PtacxLvxLyjoCzqSH4+SURkWgNAMysQB/CDx/L
7NFeLyCV0GaL2GETaBNVz1C0VT3y4b0m7o7rTg7KGe5j5+D6hbqcCyn6HmKw2soevu2BPrmUjzoP
7BYMP9dCO/Wh4a65vl7vbI5Plub13YbGTk42DznblZKiTdTh16HL1ObIyUcxfv2R/qvkLeMm5ZDb
6/yScizJDtJkk5BZYhVB1ulvjtCG8skr4ELMn5HY/2ZaFDaGyUl/UFSbvTjXuzBxwh0yKBSqKPbc
szLz/Hb0SE3bfnUyJtoFwna58ex0V6vYXw2r0uUEq4Psa2G4jAnxcy3yoTGd7JIrW3W/tvM2ImXs
LBz1fqNwjaLyQVylpt8lYywLWfGUrzkTyIwM63/qGJAfz0Gq5UqmAQhMDnMAuqyawtUTb22154YN
6hjhpwIkANQU4JzBnE51+yWSALBjd+UbEtCEY+Y3TTEa7/zCHku9e8gi425Ddm2ywXZ4nPHL/ae3
AaW1p8dJJapZ8/6HZ732ve8E0BFSkTwPr6/j2zsjbZVPbVqOxWX2l1P3Yw22P6iji4xsEh0TtBDk
RIko6fDhBeSsBURIFVA9ImSpHao1eZ9bM/uUdRlQwWMLv81oI2XBTiEjzVit5KMQgKvqkwurpNcR
ugsFMw4nefthSkrLuyyydXJdLu7e1r1JGIGjZYifqIJTglNFODnhFlBwvABQAe1pPJsjz/95qw2O
6345wOYRykkpcwdNzHncQQY5IyZtkkQ0vNFeg0Glb0UMM1KW570hsnSPWBu0TWN+Dg5kPjZiY9Vp
j2cU6PjFAPOIH7lkc4KC/p1GjHYHof/lQEYOBpT6QDf5pv77mfMGf9wajl6wIt2pZ53vjhcQYU/n
v+FXUyHaUju7XzhE4Nw7QYYSCG+KVdU5Mf+0Sn7jeMIEzcWlDsuP18xC1mUjHYvAJw62lApV95Z9
zuNDKaeD/T7MLqfRYZxin4+wEaWaeOacUQH4pNnlukZS4Qq5DfBgOCdOcqHZGt8td8NXfuc1HGLi
+aMb13YwB3me2jquvhW3fOuA/nzjvqdWvSEQxBRsnJcM1II5SluGO4BGXH9LEr0t4MyO8DZTfqlA
tCxGXfPpiHeNEY+pt6uysTVJilCTrcM0a8GJ3qGgM9MKgcLVCHhbsCenyEDgN+vpaG2IbqxQypiJ
K3SgJy2ZamWXCTGNK5fywKq0wDr/OZNwNmLoIfg6VoLssVsRxJhqMBeH2Y4xhyVkVm7mdrb+LZis
i0/JrQFfY2DyWgyOGlzs0q0rCAZG1IKC/5BeFKmi43rZkukhBtjlYWSwbjuJ45iOkZ2hfW1Cpdy7
wmOTb5zzVQ/yti08kcIqo2FlR6huV8gyhJ1pEQqCTtxYf4aRba3x311jMyCcnRyrfUQzR87au5fh
06mtau/C9Cgm7xd1BJ47Wn2RY+rBZXRwRu58FbXGHztzqzDdrMV1DkBPQGVCEoO+hOjWp64ZTf4k
I5f1SsTr1MmNXmFPOXAxe2gqhu+F1ODvycpAWdsCpzDLx19Yw/RQzMQxOoS3MUwD1Xcd4USgqrNC
nkb5CnrEHsLFLXqCNTry9M76Y54EkE/f95AsxGG7UzCMZ6OS+81cCzFqdY0dr5X/JgYrcfiYD+Nc
pAHH04PvRJLNfWLN/lOZSChUsNS6XgNcbrQThdP/m2CHtP2/FMqaw6naUYrPlaZDZiK+hC2FONG7
ZHNHAAAApgGfom5Ff+rv3E08ZA+qaYRZiT3Xa8UUhr2fi2oLI8IQvclhNldD3aiqk0BEHv6hF452
Mc9Ql4M2HbHYL31BoR8c+DjMxOH8syb6R8IZMAwwCjZLLNMa7Jh9nF9HWF+S02LDanUW+HaTf5ZO
1AjSWpSNlnPo4dL0jEbb7xRNT4zBYGfJ29f+d35hhfumiIS77QenoX8zi3LjEDbI67INtbr6fYqw
jOAAABbsQZukPCH5MpgF/5hgzTSxpVp1JoGgkxSwUtN6eB0KGUYydW0H09DB+/tIOg5OsKXXA4xm
EZt059IC/DGpGlrMzALjJqD+Oq85t3DCTrr1+2OzavrphI3MUIQE2HdWHflWzZyOV6bfLJwZrmJ+
QGUxuONF6MwZOafgTVNdrFI1qL4PHPT+dPloRPf2ALtMJOYttemREPXjyguB/8l3NTL4WZHFgDVo
n79Oku2R72GerveIgLGNAPjxaonsO9lDrPrCfVsSBs1/+B9xscU1AQB9s+76qlCQOgnKIG3jHceC
u62T0LxyRnJwo7u2GnZ4jTbofSXJOM8uu5P5hCOyMAHvlFmYy2MDWQY7mCzw4Z2GjSJTU6UiXb4g
BuTj5Cn2PKo4Mle6vKP9CG4syljAWtbVLJ8ZP2C5QJ87n4zNQM/3f1hyi8+mUISBn3t7d4Ss/zBe
idcr1oqLpgadV4veMtQh/5qRUXg+mfOurubmEX6Qe1DWBXbiVOUu6opGFU+xzBJvZNG/TK3Zu3jL
laDQGpA/Q9jkj5LOba6LVt/TqqNAQRKEkOk7dNx4IvgFHBhTOr5Gk6JBhtisXmyKp4XxrLT4ugSc
cUuOFY6QdmckrWpZHVVEm9Jh4sTwgDnWD8xDAwOlEpmgHVUeS9DSLBhIAeDSJsqadHKQgL+rmxoY
ZDhMXA5VcBTWlK4FrHs4W/h7TYtJGlJqQDUDms/FPwekbnsPv7zhZSHR6ws4L/AEuCWwMW5mnjsa
ABVe3zN3Y+S0LRPPd0Vla2EegdzIjZlgxzoZFtZr/GrCeCJrJoTtPH7RwGirePJIfV3ZwYSpsb+X
fHlGb/TvkyvlvT3AwCmIpDGcsbgphyvlar2yUVbT0HW6/BeC2Ns9W80HoRUGPMT1QBKoWOzuE4iC
OKGEK7Qrw6T3/VaAq5bJG0lUlzYdqyuL9Z/9tA00x2CF1ZsbyzDKrGRVITGeaIZz5kyRXrzmhTXx
HYq0NZg1Ht5B9adHNkgk1eAe2ra9alL9E63hM2iiosVW6MqNpckNkZJjkMWOIyQd3Y7mRCj14MV9
Dttv412UXo6xiI83jc9OYuD8UQAna8k81xa8lNH79kMnXgEohWPbl4VTpikSp2tYo1CRO9aV0cu0
3YXeWUOPLx9Hv6qbuW7coMboIIhSFA3n2N2z3sRxVVZS8b+6HEpMX69MUWh5bUTSADNILt0+bKDC
MWJg0Yskg9YcMr6C/e0wh0iz21y5kde1b2ZVu0ZphxbWPlun2Sx/uU71oYfYnAXGDWqcllGvqveY
oNiYM+KyVSWj1dAxvyzM/KlgaKnOsyptjmhYfBwMLc21LG04irPNBgt+R8GhL3lpIMw7lH3j+Di5
vdHe2vL5Lix5tgGmGfB2Cx5+2r1woNTUk7y4zZgB5Hnm7TK0AfavweaeVirLxNAp78Oep8BgvzSa
ZsQYZxAUBQuMiimhZ1kMpUYLivLGDgKTPINNKPdnIBXVPAdSatGftdYRvaZBnZ9MRbXLkYC7uTww
RhOG4uha6FXKMQDyzl6q1NMm41WfC9lKYID6TlrUWbb0wHAnWJKrkGymyOkSWbV3OkozVqIQSYNv
uMFOyzoF0Wx3HlPnWyoDArYp3QN3QOyaNXtEBmIEulSoQBDKgzYhik0pWvKAesU+mP4waPVLLNaV
xan8fjXMVV1ir4Q6dAvmdd+iV1VXXCo9HsM1OQ5sdfChK2T4O+PsjBLZUxCyfITpadjCtG0rq+Sm
UX1AF16b1t5tYvKxAEiKXKvlAJitKKKXOx18QYEyrFw9Tr0Le3j1o7PzuNO2cH4KTj3lgDm0Y3nY
G/kcaMnD6WgPZl5ZWI0M+q2oUe/i+IsnPTL+UqfCLGi+4ZpMPcf71mTc6Rqkd9yG5tHugALInn1J
IkH4uLahtDzhZJ22rpPj4HJqxeyqXzUcyzYOUo6NVehR6q+xpvfFP6FAaKL/cMWH2DBIX9bfPg9D
UVbUyqdI3qNvtDFKuIsAATY+RnFAJS7VK/64e32wQJmU/S73WthH9cDGiJpEZJT/ZsNGyW+CP9sC
X5byfNjSQtFwqn93jOET6G80zK/oO9GR0pDyAI0ymOkzmYtTDfnxhnV5XDsGcNCJ8tdYrhSxLdU0
HXXdJQwscp/FE9CJVGmUP8bEtNdPNQwrIObsvtNlgk9714ObBz0d+iewOQyCKIQLCPItn3CtveDO
lZbeHzLRDbMW6P8RA7ehwzBmClth7YmVMhCNzpniycIWbBPUEzEMpnqzFSyGrA1Py8RZbooo0qTp
sUF8QCAEsE6B2LALqwBoLeLmh+c+L9AnQKybmVtzIlETcI+yx+VJZjXpFb4s6OOM5v5jqI0L1Kh9
io2O/JPgydiuf4M5tYzT1c7Aq6oSj47NBfj5ZH1wNnagBumXhXCZbBaH+3a2XEzqD0euHeVvwe33
bGu88sJbkLp13nyvFsJIjjfkx9bgSaV7IudRqWmz42wQBazkwCyZfR0i3B+SyxHz86nANgoXC1ro
thWZ5yTivzv8afC+BC0P33n4gWsOSSJuRlHDx7mYI3YHkmfDtS3jIPXCWnqHUNVIKb9f0wO6m+6V
ixkxOdUwvpqT2G4e/hJ59Eh9bPl8w8jMjNMNbWGgUmwlC0DxxZcB/O/jDaCAihW97SDGUK28Ca0s
lfoxrJyKWtPjdY1QV1Efi0Kq9OrFCYdqsGLDe934xlIrueQgIHLdNAJDdqsGbATYrcR5n+Jb+A2x
P2dp8ZAsDIQDSp7UGcDWy0BJWhc4+RjKOb7Uxt6aqPYHDEzm/zmlBJmlCijm9F2FGHOGfoQkIesp
G5UXRUg9D+cgO9xNPhOAah23C7F8lqM9ISXux3rTDRdggZBgxMJf8jp9CwMOm2Hk5324Sy4aBQ4P
XpSbrQxvcIT8IJhiGcKvCWeH2vDGRe5mNqcwRw34PZqQSFwik8cR9dafFYBlqwC4eZx4CscCbexi
lmbYUBQJ6uBTeVK1Da1ecR9lqXF0Y7HrNj2orkgDd4RZup9q7k96mLe5HDDAqNaKCb7XC7wkgn23
23u/rxg5rE6BSHPS2OwS/NUalBVUagHipqV2CUE83OQJejGjwXmQW3KmdjIRL9glmLlw512gvnoY
p52LbZJw6ArjBEX79zPbV36XPiU9BmXHvQSrz1ThcAY6rjB/989WgU0CSuNlQP+8BA4ib/THJved
1fVlg7SkuKZcYpWmurb5QIzDPCPVENbZySbE8P1HG7Y0Hhbg7h5NjC5rl0oxLPiuz9AXTSBHrWmA
y5Ike7XxB69WgPM+RpMWmrqK2FGRrmcBg3NQZioyJ81dnBxANRpiNDnEnyr17IFQnQLGBfvl3O9a
YimV9QwI0cRdtQkp5kDC1QT9YoqbshAsLewaRLMSlVhnuo+LrWaGRmA6ubZaxlyfP7V288xBqMJ4
5BhV0FUg0F7GAl7kRdzjnsNgGLqSfZdsWzCBaWR8YPMO6qN6B8Aa/1I/RfEiVnX+n5XL/2Ton9Or
sA+uE0gojM33sPBSnPIcBXIf6ryeQfZZ8WwqytHyta2xdt8pvxPzfpUpiqCnpi1JuLMu1W/BOlOM
DeDs+ctvS8FNO0Ovvh4gbAVtHzgUvREa0Ijod8mC0qaEep5tpls8Llc0MiRyssOrlmGrP00uNhTH
NzqOiLArohUdzGbOCVaM5tYjzLyhb1YP5apY9NPhq10I4Sw/9xIodZ/E857GP8MjCIbcUasxhh1M
YMpVWWIYWbzET3DVWF3FM4pmNZkW/+yqczfAcYRG2n/PEcSGerjYR+sCBz39/GZ5dR1U8lXxRx18
gUCs1sYmMExDpGyRUMfE3oSmtV8IMCq3oeoI+r9PYa93fa2Aebm1ju/Q3IUBpi323pnhAZPIvOnw
C14T2N51NB1TRUBUgbH2uSVK6emcxRMKtIM87nZ0PN/VhwWrZBGHWl2FRYELTTM/sFcrWyw9jcdx
Vl6wB+HMU2M3wJYQQGfky7/RFlCevW2kgTR1kHY2wEu+vBmcDvyVCs/SpFg3vLB4sVwDR64ztUMg
610qypDG0D9D73viTTxffIicB2e+3N+r8IYNSVMp3/hsCZoYwlzVtPjOLqbnrUKOVkhd+mx3ssph
RBrvATBS0FpeETEf67WNDk7x3fMO5hl+AWZiBy5euERMLQeGCYk1xRNwR8s95QGl9ibAI8cMyU08
ZudE/yBQRYT/QW3UOB6fkPQgJW7dYN8fRn7bmhxtiSKKHh2GKkd9vE+Dr4tsZYcb/W/ZyLWIItXC
08tqDS4i/UYkMwbHrJwXqoy2fuuoxyJ82actjTclivHNU0uvFJzWjLy8U2wVZUmH4cPSm+p5OKTH
hMAYkP8lKl7SvPB37dzOYZxfb7JHo8JIbpzoxXmddcrhjZcYNOeZi5wEuX6rjCvkV73R1wNrL2Eq
KZCqrzn32+1LaMqLr8XwTTLgHmwQP0ZbWfLi1OuFJ0DdvkcCrWTS01LTOoElqO+Un9q00Fko8q1V
YtDGFeGbAFmJ34X79ILC5MPnpuzrOhy2FlpKKWYO0T/QfZ/TMWHvaJQXuJMK9/HzODcyvEX13BDG
tvMt5Y2NDHGgYowIHaZFpJ30iM05Q7xLItiJC09TOwFQkJvWjt34eLKG73KLGE3/mLO8VhFXIPkd
tNCLI9aRTeWx7ZdMxre1Yw5vgbIX0KzYehHFAxZNCINZU4GfcB79w5wfz0uPHgAfGzENSuzlYw5S
5VlSPKm42AehhYo42+G/CNfbDfZH0iJIoM7ub3Uq8hZ8NEVjEl1GjWJ9ui2gCLcbtPtRI5rO+fws
hIPulka41hIaZ59jGpgvcFM7j+TSKhHfMjFhneVE03PvmhZgz9kpoxzeRNLNmjJpL0qSPZ3sjLCT
vYK5Tr9DDVvHRJCOCP4lk9BK31lmXlaPJ3IYj0WonFCJaCVuwQExlrVZzZlJlMuqtmQQjkuBuxpa
jX8NgJohqx/IljjcsxjTaQOv+nBXnMRYd/yRk8uyZ8YePrtXg2/QZWtBXQCOcvff9IddaGzhUpm7
qGbkd4UdOKUEuquVR7AAxKst3vqeFPcRsVT7unIsj2J6e0aNtjthpcBM99KPjUaXLre6nweSEth/
rxWM3K8ZZd7bJeVwoWAQ+sbYVV/nhIQ6y7pC9HPev7GzjWDU7JTp68I/wPZK0zxbqfla0HhkS7WU
164HN7pm8tsvOeI1A17aGxAepl2m0i71GkphngjOKzqA35ysNr9gg+H6bK1n7Ht2mQzugOnawP/j
XcuciZnriv+Lleluu/fApDXCM9mQYz4NqxifT/PE/PlBwCvHhr39nwHMvpXHpQ9cUo4k3rUSMIfn
7t2l5i1mRzW3VW123QBq1wrPeXHvXo1HqDXzaKI2DvZEzfuw2oxFft4yFM37UrquLkgeQL/wi/2v
4qXkxu0rlpsQukra82MFlVdn+RqYY4p5BdiEsT6kF39idVlpA41lomMwaAtV+YxMrtFQZyGPfJV2
zaefJCZezbSzmF63m5BOrAVqnIXVQyXx4+bm7Ofam5+5OW6RLjRWmwI1muQInd54HokWgO5t+pw8
4Y42kM2M2np/eZpkqfX9DHTQ6TZrX5xirid4Drnkrbqo3YUeiZL9HAYrpr8ftHE4v0W2DIqzRdxF
39tI3TsShd2AaTFhteGOTWFmOflU2FAZLeECCLyLQCRz21fGOUEXClLe1McUPWiLyUsjNYC1HERt
3D+SoYJvW2bioPDjKGgYbUxfxjF4MqZ1rLurEBwI4lNfx9rnomIQ3JSGv+vjWH29A3RkHmWirmWr
gD33O5oApgYPO5zvIMIHtAWLBW+d0zO7ZKa3gPmDfJfBNDfOkzdwKDT4r22Crj1Xfb07YUy/sRp2
4D3m5nbXTeH/WDwSIqYRbiiMi9GHGWe+RTIGRrWIZjKaCoVmM7U/rR59dbUXfZ5z4pEbDGofBmtN
LPVPM8dSis6Uy9bDv8Gm4QunjCXcNdoLKE0UZ9mfua0z4ddhX9NpRp1Vn9mnQCWoxLT72FE/WU3d
urVfZopRcahdbQxOaZOKxg9BeBVfLcqg9FddhfRLZplp6Hl4LZcf/Ip92e56TujXV4N02cGpOpka
cYiBtaRWlOGA9WZVX450W30IaooZYDhkJNtETpcOSIOSmxhu7h/SKtJfPDfKWwsAz4EUemlswBBD
OZzdVnwEPKPkrF4lzqyrZ7lNnPguSKsGJVv7bLfbf+idAneyXfxOF/U4m8BviPpGNgs6CjSz2Nmn
GasdhzfdK/cjVCta3lwAaZ+lFlBS5SdAoT15KB9VpcaIsbKR2+/DZ4uNqYprCLLlQoEpcMAiUaZB
Gmyem/ZAc4MjuUvleDSIeTRZJaB1gRDkQGH7me+zfUCqk8XWtgmFM/3lUfy6twHUqHM1Shd5qr7s
QI8/MtfjGIfgXo1QYlOXjNyf9g4v4aIWQbgd8Q4KWY+gtp6vJ2COfBL/2KCP0CKfU0gu9J/L/2tq
fEegVMorc8vU42mpYRYRElzUaVKl+x+d59BXdynK0+qKMejZGrTv7sjO75wgWSN/1RNBYMk9HbWK
01EstDc2E79AuDSTKbe25BvzXQYCBhcVIYl9cbRppMcHkySycK1nN9bV5FMUBTR2V+ugZh8xrkNi
wWDoo4ALuOW1rZ5eG+p+H2pPt+41YOzdCN8ACi3JzH6RHgpuI7jBvBMSmIwHS04ZsFUOIh/lXbO7
0e0xvv3mLZh2BtKC3vyPfaWWCuLBVbMz/Uyt69jo5DSQU7hVwS69IFEEassugf0aYSjgimrUjlIz
Bb0Ozfu00bcRpQuFvgQd5mkwRGBdmK2VDY7emqWH+qEwwqRhQ2/8II0iEqXM8lsYpspMKYm/dT2g
2j6kseB+F0RlJEnc0to8hqec+7dWlS1KvJCJKvNfLeHJ5eR70wLvpuR9hbKrGHPO307Iu99CGjAF
JwwC+m7AtB1n896CKFaF+dIOUcyOYvAY4t7YmgCwvUmXDsiF0tI7QDZ7aqgOdO2mw1Mi37OHlsHq
A6x8k7HO9u1jVUicB/1U9GQOEfC6kbP4GzXXhHBKMyH/kAWem0wsuexkfrSHB0/ugRZTpvnqc+Aw
oTL1yPA/ceYPMTULIDDXcoo0uu32n+LMEignHWcCaphVElNACk4h14ZtTM/b9thrY+vriMITui66
XCSYVZODuJstZXA1WBt+F3idgNQv3GXK7YkY8UAcUAcdZth+eOs+jOw5zLwVR2nxV4NCSon3z3Hp
EB67SAUj7q4MVFDdjGYbqc40uWdEjiW9aclCaU3NP3+ZXF5vlgO67FosdoWzrUFbTPtrwIqU5k7g
nyG7epWnHnH5WG8qbDcJ9koCJQNrg2GrT/JwLLz9RAp6Czs8wYkQKcZXveGHodDY18/M7T4T8WbP
Cl5/vGF19eLG1Dz1/vOcJGkRDMPv6HcNUr/JRozwcS44G6qKhCNoU6cDhjePedte9mYxb6atF10B
fojHHogY47JUHduadV8Mxe+1ZEgBoGP0bKnu17NxsRBcz6OaVwzm+lMGgSrwa32YtCqFORmmu7TN
F5QenbgqW6HQi2j4cyjHn4SOoUbSATkBqhFTpAu6uXhJDW3XI1lcLxmSKVWGFHcuHeC8MyS0fi5g
DkLosgioIsgRkVrFhOSUxUrCmrDctR+AcEfgk2vYIkBHHDVFJmvLPzXlSVLeIP6D1nbcf+Xo/NDl
1/epwxmT9/B+q22zvh0F+PbcZ4aXrxOLWQn5m8zRAL4Dj3cOJt71rLN+6EC3ZwdKi2IlgTwOVInZ
M4VwSQbrlK+LOSkbrUADqbkhJ1nWiRFgW6Vx5hen0+6lKtNwxXGD6Q0lL8Ny7GOjEbsscj6+J0Q+
7HQjAAAMzUGbxU3hD/JlMAL/QBRpd/5KTP7N24mMz2DdAGRPhEbhLKDRIyuSd6Y5TckDeoT2ZQe5
qlk+denm6zWNxcAv6gTUoodLTCuJP7JArj1+T+JYH+66Phd27XTH3kMAWDaLddHLzgu+qSQyYznA
pPAnS4VXfwT0ntMRwvvlpj6p1h5/1KF6IiDU1CKKTVHo+T+kHZheGxv/3IkGiG5Q7O78Opi+vT8b
/UUOPiL/ztU924UKXy/m0kux/ydT/3GSqEk+bNM0UY+YWZfkqqq6hKNTeN9fZedTL/lLgGERo8fm
3QFJhVDRyyJeX/KHjmwTp0X5lHBHRZqRMmcxV/CoI5QJpPlRUrCtarsbyehOxNMBwa3cPzaAHcYY
iHrCp2sTdNSEjYxBr0v6xLzfhfY8z1fm0A82tDecyv8bEmOnfajDQiDh6qIcFDYXzGyYNAJV3S8f
iCAbXrkTG7vjMUkuJb2C0R7brWvqkbhTTFp/hSARfxGzBEjj0FY1wJjsGoLyerGKOes2P4XiT7qz
aKCcLDmIrMMCOXG2F+c9jLHvSLH3K7Y30XTpZSmi4ipa1S8FZ/FodLkCj7bp6K0BdHmBKl5v6lwR
9O/jqBTtbcPXarv/WFbs6osOd+/mdF9txzqGI7L0bBC29gDeQtFfzPr3lz8i4hgITjxlTV9mt15+
77HJeupUIDf96J0pcouMu+AblkmQ2W1hyrQbK1rNnpl2K8a93umeTWW0GV6RkCMONWTWvWYZjnw6
Ak4C+q4zm7/iZedHsCfrOW+pNE4avJOExY51bwmh7BRtukqQTGbY099vc0AmwQtG9FeTNfafIiCe
jrHhrT+/sH78ZTzxQlVtXt2HahlLTvMcEA/Rg+dVh6pYXr7hk4w/fYm7PuLw/fIZSyOUmBItOMQU
LyDZia5FlyluisxU3nuAUGXK8ofPfYueYYDX7adXLftKJW6vnrKyDaI3cbbPgnM3AwxRhYf8ky3W
AO/bsP49/nfG0p49FOwYelmUJ0vIDAxeUFrpUEXeZ2viyMeIamHLfa6dIEfSyGfOr9yXnJm5Zqyp
OGD1ZQdsqPu4/6dw7ZXc+R2Sk+JWB9sz6eT1Ttn/3O6JhpBj1JAIIpb9PZy1hC7DB8tbnSypJ/xk
D0tTDi/xZnW0e74MEQhyOvusUBADlBMLsdzFQT2O7tq6rdKdhW+8TGOHTVrHkdfj1TWSEd2wpeiN
7aOMpMwcBLRoSPg0PQZ475xEreH4sPymDc+NdTJT9UQeSS4ZW+VrHxvnh7Il05TpnFPm0Am8THZE
CGnEXWIDhN29/ppy9UT1ndYkX4imlLfdMaKiWk0568rJa2CHCyKuhnaHc5Juz8sOzYppPYNI3UTg
gxjF8bK/N2MkSvM2zXmTqtyGhNExcXiuEBEV1vsZbWuIDS881nxH5Vzei15X5B9A37CdBJZHBL+W
mJP5PxYURSFFDzwc784m1P5/KuqGuzCx1sLrCTlI7tpP3qcQvXMsoRIZoTmNsuF4OW+/iV/y3dD6
8aSUp+klfjzXo2UEk5MGd9a1PybRFjAsRe8jg3mn15e5XhyIQuO6ivEV6qrKKlBQ1DVo8UOHWB9W
3LtZlOjyQLTHrKXyaNLczW6tEx1+DodmwivXJwkS0KZ4gYRe5NQW7ROqJYB9PcAE0rZAQ1K6LH+g
MF1Wy44cbUsdYa6tNc1h3paYaKpCIf8bH5X0svfy5uKy22behMWEX7em1jXpV0quLPqitMCh3Jk1
IZglAW9M1iueiplaTI/kqvErqJNmU5NGIemM0eSCAFl3dPXnfLnFr1DXHoTdz7fsZJCPnB1o0Iag
M1dW6GhcbYzKZyBjrvYS+3MCgX3rclk7P20xjCrh/fwubfwUQ1pij44VXz1FnuSHVIJt4863mMoW
zj1JgkOFIP92KHkFhRaksGb4tBlFiJYUzG4Vx9Pvo5YWEKmTxALSeIhrz457hRjWBCkYlkDCQ7Yg
La7zNOIMOgPl4P5xiwukTRRmGyF5sXC/1LKpTykPAM1zhe7BbXVJ2K5fyw8MXtt3izh06R1x97q5
35TZzyCK0KERHnlcgMd+XPyOs14bU+A7KoHfhbnnaNNiyJnB8WYtlUiT/KE0ow8wgkSTfn/ABVxn
g/dvk6wweDDxiLUNubjTHq4Nh2kYb8XSx7IIiItVQMuKosFanBDJg/JTR/U7qoiiXsOChIbRnbxF
vUZkFvbLXofRnJmn3n3AlM4eH33CMqxjR4HdpJaxNMcPMQMjkGSsaRoRNsTPrcZdMSgC3l3jOrRs
8v2EoveZaF9CB3un53QeWLYVFqi/69tEMQU7X0ThsLvQGxBd/Gf7s6SI2UsWia4N/YOtfYBNLuQ6
wNz5P6/dMysxdi3oS9oCoLTv6BjJlE/zNHsFWIRgaOp2btwpZ0tEpcA6IGv6WDyexDk5ErVFCwlb
rDo/yJ6IiPrm/YWfMHvVoDvJNFytfuxq7TmOYVq3uM0HVEAJ5+5P211ks5q5qVh3rTaB1TwUOtL5
AQYq8j2IkxMfyhAxYP1edUP03YefpL4EzeFJRFRhKaE0f8OF6ysptsJTWGFQ+qrwrRPmKiNe+Um6
90FmlnTqJ2Xo9pglBHj90uvrMjXrpFScY26Deu+/UN1UsV3eK4bs5sL6vOXevg5c/T/TbJGBgvEc
Bkc2Fi+iy+E+Bsl+0oEzZwpBbI89KkWD+BCBtKqIw96HRj7SIOC0Y67it2gyRb53LKfiO8wsUJI6
cceymERNmaxSipTg4PTVsyESPw/qPMqYpYDZh7lMNQ51EP6Iw9QMuswSz3uWUmt8uFxyQ1n+l0p8
s18TjSWJX7j7prIpWPgJ2SXfXSVRuQzzVMY6iTZRMnPqEDrGnAzlUCG4JgfyMaQt5Dwk9U9dhZEQ
J8W6vyGgROrZVn41rJXsxDLSs+SKROiZGbM0M0IDX4wt+z4N7fAy1rWcrjnm5jFotr5iZxqyunvF
eVlNKw57ijjC1RlSD346slL92r6i7Ot/jl82IT0qKTQGF9TwXX0an4wxr64nA2cEzZYcVlQRbD0j
hE+XIj6r8kTmTU5nFpUDmcxpUHLKKfHfB8cTBPbeoDMNfupAAG+EPX/gX1N3yjkv0+8BR5g7JPai
tOtbbNCes5dd5oSbxcqbC6um47UorIJVjMvKau8t7kJ9O8QsJuN6dHPC8tS/h0rrIcdEWNfiGf38
VXohhiwRrdhIAANa+hrGqhNi+m/ToRu4bTA+kh6H1kdG0oJe6sfyhlZuB3myK7c8jnOE9WI2yIn3
B4BOoLaI5Eh8zsbTSRL4+esIuLUyH66l0Sh2X+T/6CpbRqBYn7CDxRwlku5UaAMexgAkh13L+sXd
KXbvZgEu6A6JsNmah/y4NGLhlN5MtK+4e9wjOT4rdavvbUGUaxf/8OwtnlGSZRiu7Oml6rYME/aN
chSdNIaosrR5obO/wRSMhBQQSwtMj4nMmLzleSCluDQs5HG8y4L8oXr0Qs3aabnQHzgIjOzx4M/N
fI0mrlMg+cS4JOxoI+4h6kBTq0k/r6s48pAknKbQ0PtEqWSHJ7tNF+RpHxPCDr2VpXzK0AONChDt
N0bmfv60U/BsPD7JzG2f3iKKEfPosAkAAkhtYJRDno1lGK6xuoco39EAhhpX0sw2yW8swqipAYyc
NZbw+xdl0CDjrNCGYUJ613sIS5AJRSRKgaBDET6Pw33DTVC8Xxj1zJlJsoEcc3nWbcYz/KV+qYQL
n9dula11pHZlAxCGtgicJeKr/zDFx8M2uTAcyXoxKifsVQ3LIMMIA+I7bk+yVH8o8zb8Of54REub
EJzeDRLh0NRA8NgLUg1FkKRVX1ib2Qi4Nil+zoGUjoxIeXOmivVAgvA86q/l2L0pd2jlkIzb3o2x
oYkaxCvOrjpr+/4xEffd04ZYYjGnZcinoczaQgKfUYxEHl2aSotFi+qIkjG2KwQLtPhOYE+/8B6a
vRNJBwgFmhwiJIi/tSsG3pGEipanc7tl39BpRdtpVAhTR3Rh+xFzWPGkyU313QGmXdDf8XXN3IKg
ZInRiprJSc7xCFoI2rmCzVArlY9hg3aUIyVFzickMytxy9v7gVoIFpnNMz5dwlWhGdPqe5GSQibw
igE8DzGFs9I9ceSEj6pAIi6DU3IdoNMEBkIG10AxsUwQODdbjGj8JhCWB1B7iodTcpohYBHb3vQ+
SWYh2Qgnc1N8egyQx7aEMKmLUn44QAJwxUCB4REqDp24AWJBA3fR6VyUvVu04+Fbmn7Cs8wqlQBB
Eq1Ymu0P3v5vN+tvekZ1C8/Gwe7leZjR+TWMYrPf15t+tXc/xJqsrpJ97jK1ZPPKLZe/F6mWEaBX
cZCOlSd6V/UsYGFLoTyWGxFKQtZxfuUIIsBDw7kheRhx5fchGo//ff/4ASt3kthcIMDoJOK2oAXR
Q+XyaMml5F/UiKYtsEJWLI+HOqk8hgLQgEgIoqBsTjoMmlzDtnIQ5DoNsgGY+QT1mDQLZ0DQJwE5
mgW2AadoAafmDMHIcmMwUGTwEAGmaPNOUf+hMrP8Q2z0PkPIAzBmH/rWhfQOOl/6UCXkJMAJ+X9R
wcErg4nKhrEBgwCIAT8CVDT4Dhk9gD0H9AAedA+Rf3T+6APZPZfEPifyz/ugey9mA9loIW1oGg9c
d+f7BoOnWx35p/9v9v9oACeANEElkANBANiANjcwBsIMHQf4VXNHK2ouAHIw4Y/K7mePb6EGY+Qb
Ztlsaf+utvbeQgE9OXU5yHbA/xJvJdZCJIxBKfx9dBbX/fTgCaTWcwUAAAAGiQO0PJ5nleQA+9AP
uPuAH9oA/v//P7wB9r7j7b/1f+/2v/T3bMG2AAAAAAAAByEaj//5/+yhKWqTWcBOGyAUQgYEaBBs
GoAI0AcKAgCAQ3AKK3FFAorEEvIHjAhwix17kNBw9syeXYuxvQAzFtj6f6cPpvkAfS/NgGIde/7+
LShBrAP808+sPAaf+etsA2MGxyYAdf2P4W04HhOv2kCiwZi2z/NmD/rQRf84VoX0LjjOELyHMG2g
+6+393/1/9gBmDkGY8wbaG2baAAAAHu/oO2h6B/jmD3XbeQegcgzB7r/h/1zFyDbPQ8xZhzD6B7v
/h/gAByHMYchAAAATAobKBLG5LOApECDGBBH+4YdpFcLfQADIgeBY6cSFfn/9sx5hzFtuYtt5ByE
Af+wfa+0SCfr382CHypJo3wkFoqB/IHIcxgAadp2nf7aDbG2Zh5DyDbOQchzBmDMAehbZ7vbP/b/
a2u/OuAAD4kD2R+X/E/7PxAHUUAAAe7wIRqP//HtaIEnbJFaQE4rGBRCBgCA9nvQhYDhZVBsIMsc
c6mQLKIMokOGdhI/Bb0hk3KEYcPMe25i4Qvof/Tr/hNj7G2KAeE68HXuv/SfNh9K4UgBx0gB4Twm
Yds/6+h5BFbP+35zTg07/bQNAtsLatjrnQNP/P9+f76d1x37bXIcx+7bZ/1oNhBhcw0GXAaP+f/p
/iQKXbAfevOHk84/t/uf3P7gAAAHoO2cg5B7tyDMX+bkGgadbenWzbGn6f/v+ctoPz3XeYg20ADk
Poe27aAAABdYFBZAPJbE4rGAXIBxCBgH+K2BeogADJGbBnIPJywIV8j9OH+x/sAHIa2Z7ryAgUuA
l9BB/f/d/aH9z+3+y2+u9OC2QzHyHMG2Zi93zAHHRB1zbId+aCAPL5Q+4AD+/+x/+//v9v9oB/f/
Z/Y/v/uf2f2/3OwHIRqP//ff+IElbHHaAC5LE4QIIQMAqQDCg1BAJYCBaAOFgE+b9fI0KFpSCUjy
QT+Y/hjhdfaQKIBx0Gx/C+hZgtrQP+vu/IQDbdt23MPIf7f7h/Y/v//AHIPdPqIBx0xEALYyAKo0
d+6B3/bNsW33910GnaDbHfnCCtrGWIYmAF+4ngoL92tg4/udM/eZ/RCwnmfUf49kY2/APL5QAB9r
7j+z+7+/+9//f3//z//AA/u/t//PQg/z+64AUNt/6Zg5DmHkAe7ccLtnIQAADbMwAAAAOj9Lw3QA
DzgT8kAzksQBsThsYBcViA4hAwD+TBMPICvg+4vuf/1GBMrLfbfatq2wAOQe6Jcw5jwEu28hAAD3
cAD+7+8NszDmLMeYNsS9RZOBo/6TuPw3MHoYZiDMXIOQnkAPIeUAGY/+noOY/Qcxf9cx5jDMYAAf
9AzGG2/9QzB6HkwutTCHIRqP///3+AElanNZwC4rIDAAIZAIsDjhcw4BKId241wsomyURldaJfVk
pPl8PAy/5+QZj5B6BmL3bkHIeQv7w/u//vtfd+3/6faD7v2vuH9v93IPQP83+NpgJQAeE6/4Xwgb
ZWpcw7ZtgZjrcv+b3TMGTC5OLgBcx8gzFmD3fMHIfQ9s44X0DMftNhYIaxRZ2FBqDMff+fzeby+Q
+9B5R5fKAf9OQ7ZmPkGYNsDkAAAAAAAAAB7p/0zH6DyDAy5gyYX/D3XMX+Icg9B7K4UVvi7KAPfB
2X78AAACgkgGItjcVDALisQOLA/XDCrcAO6c3f9j/vtDXmOKrTniANP0DT7a0DQLY7/tnQLatkAf
b+59vw7r18/dz114V3vHr9+3qKL5X0E5436vq1+eUAHmABp4aAHfls6dp+ghoAAGgaDoOnBp2naD
/2tj/twhGo//8//4ASltcVoktiBhCJOu1AQFACEAGx6KkE+sbAiCQTgSCPeNQS+LHICW8gYMD85/
2DT9sDY/hf9uH+FANihsbwnX8w8h5DyH+wAAZh/6e77ZtnIf8AAMx8h5Btu2ByH/DwtogJAB1/hQ
WiDYxBFDjoLTB4SiYHXtjUQDjiNjde46jYmxbQBx2BRCKLQTgQNi9f/L/ZPiT2fsviB8QezAAPZf
E+zPiPZ/E/lnxAAD4g9l/sW31313+eIIF1x+c/P6eHXAaDM4u/Ouuu7Ztu29P0/QAAAAAnAHQQK5
bI4rG47EDnHsCgCIO87NGp5/O8w87zA8s4nEEnATiDYdZwtAD87bWn2zbNs6AD+0DkPunoXIcw7Z
mMP+nIA/6Zh2zkPu+28h5D7ryAP/wB/cf3AAPtgadp9s2yFs2xoAAGggAAAZhDkPIA5BmKtGcCEa
j/33v/4BOW2RWNw2UAyOxOEFrPoK0hfNARQHltUZ1hkMdl+ZOD4NkyW4ukoZcmM/z5h93zBmENtz
GHX+Q5hAOQ8hDMWxw8KAD5rQLZ/z6DmHbAC2eugDQQ+4H2wzByHMHoW2+vfvOSOHSN7NoGnd/cdF
bfHEzOLIIuFi2YnIAuESTE+zRWxZgg/2DQQANBtnTwPZg/LD/u/lnxP+yHsj8s+IB+Weyez/La1K
GBsrVgf4eh8KWty8gAOQbbyD/D0LMPIdt5AAAAAAA/vAAJyR2KUWMA2ZwgFw2IHAH+gDNuTfwwGv
87K9lQTwAD+7vw/pvpx+W+z+JC2gC2AtjTrY0G2rb0DT/++gBbFthp2nBp+gB/37+65/O9/xvKKe
6pG15lqahsbHIQaaY5w6CyYH/tNMNx1NfDAfc6QfcH2n27a0ENPC2NOtkADTgAAAAAAAAtIHIRqU
naZVZJHZAKJAGBqBApAUU9voBMoLEWQjczI9+5mRwMYgYxGtwIhy2j+hP4MYTADv7v2gmZizFmJ8
h839K+a+R/uw+lfNB9N9MH07+7/TH5b+XB8S/L35cD31uirIXvLeF+c/7f9gD8514LSBaILRB4Ui
gFog7K7JJLXWYuy7dWQELsn8L/e/hfhh/vwPyIAB8Q0HT9Otv/a2rbAAC2QDrv/bTgC27Y/72zoH
/eohZj9BoAuYPQ/8PQOELmHMG28h/6bb/hyDkGYuQZgzCAAAAAAMwAKBMCwTkqsTls0kB4Af6EFb
AgGr+cGn/CnB0wwyNPtvrrQQtnQLbD+w/v/t//B/Z//ADv3QAtr/fwvX9iB4QA69wgA8LRYCIAcc
R1/wnhaIBRQCIAWiDYwdftIGxySAEwAJAQTQDhAWgAkAHX/pD6UPm/m/kA/up9OHzQPmz+wn9i/s
H0r+xj+w8CEalJW9yWRyWNwgQRgQCyQhSgRAPoYFRrQpKjy8n5t5DgdH/KSsYbJ+iIlZ/msaBKxv
QqCL7ptnIds/z+75hzHyDMf/XbNtDkOYA23Y/hOvB1/r4AD+wf2f2v7j7n2gHIOQ+h7ZtvhQ2KGx
NiB7tmLkOYNszDx0vfnHEddd//9uubZA/9f/QP/T7oP7/7QAH/9/c//v/9/Z/f/eAOQZjzHyEOQ7
ZmMADbP+n+PIK1Lk4vun+XMX+f0HkPoG2+g+6h7tmP/qGY8xAAAAAAB/6gAoAABMlededlcdhA4i
AoA/wIoUIgA7j3vMDfzhjl/+f3/2v7T///uB/f//AfbfcB/aH9h//ANO6665/20DMPu3CFDbcxh/
19A23kIege6ehf4/9P8f8228hAA07QbaAP+9saeH2gH939//+/v/v/vf/n/7/Y//v739v9394chz
AAAAAAAHIcmFASgA4CEalO3dx2ORANyAQH+BALoAsL/GBo2le4SVuDtL7uScGi5cfaBWjMxZh2wP
ddszFaYPC7F2PaIOvbZ/l/w2z3XkIZg5DmLbMxhpwafbAafbZMACYAbHosG2htu27ZmHkP/UOQgG
YNszBtmYA9B/yZiDMIZjzF/15BmPkHIMxhsQkgAdf8LsUD7n/qH/u/9D7f3f/T7ofcD7X3Pt/dfb
8LsXwtEI2J1+iweFAA6/mDjpcw5g5BmMP8MxcgzDmPMfHGe7B/jx0u2ehchoIvIdszEGY8x/SfSP
m39g+b+kAA/sPzQAGFVgZ55yAef8/ygHt+G8ACBzEAACckiKctkcNjkIGcgCEQAB/ihNFBP5bBp1
8F9RDTgz6/7gAdOx3lCCNEA/tP7vt/d+4/sH2g/9gf++Y9tzHtvIOQ/nvz353/v+dAOyuyPedl9k
9k26K0gEwItAHHEUVA8Lsbr5/c/vP7H9mnBp+naBbNt21bIAGnaDoOg9/W33/benadoOnaBbFsdd
22FsaAFt+z/7oAez9kAKwgX////7/8f3hYJ/sA///wkgPv/v/vw+8+8ff+cqAAchGpR93clicIDc
oEAKGgisCIa+FgQAgiCARwHKCfljnBOxIIgyBDyB8ICEjgBBEghwDMWgAigH+XAS+7B/uH+HIQD/
H/HkHoXoHIfd+EZtm2+6cgD0LMe2AHumYNsrVhACCCEEIEAmgHoYbbtn+NblJlKTYXMf/XAy5OLm
H0PJ5SENlAMIQ2e75jDkIbbtgZjAAzGH/TkGYw5CAbaAfbfbH3APtf+4+19oH9j+z+3+1/a/vP9w
DQA0ELZ0DTtP0DTtP0Hvy27a0GZRBbIaCAW3oH2/tH3PuvtgAAA5HtfweuD2n8Y/jet/B/G9d7X8
QB/f/b/eP7AH9o/u/uf3f3f3f3/2P7P7n96QsQCszltDjsLhA7jAgAaAAGvoPCeEtKRRIPCEEA8L
17jgNiB7/bA2wA+59r7T+5/b/d/d/e/uH/6H+T/D0DA2YGX/Ptm27btm2ch5BtnIOQegf4f9fQP+
uYA5D6HmAOQByEADkOY9s2zMe25i2z3bbcx8hAAB/e/tH9of3//x/f/af/39r+zMOYuQ7ZtvIA2z
kAZg21/Z/YP7f7n/4P79zlcrl7wAfcfdH3Q+39ofdB9z7j7YOCEalM21xWhyWJwgIROIDA9gBoAA
t7WOrOlcn4QlkslgYZaIT4n3kjChE4pPbiNhmTi0CX/PQBcx+6Zg5BmDkHumYgDkPIeQBmLbcxH9
o/vB+PdRbreTWLssjXETmzSYl9lh2R7/srwtEgtIHHUEwIJARk8tBSiVGHk2UTsFreHtn+cP8Nt/
w9A5B6DyDMX+HoXCl/6f58x8gzBmLMGYwf2P7z+4f2v7n93/5/+P7P7v7P7P7wP7z//f/5/+f2f3
7YAZj20ADbeQZg2zkPIeQZg2zMe2f48h20AANtzD/b/Z/Y/v/v/uAADOA+Ht+uB7Qe17ft/3f//9
r+z+7+wAT7jpDioIBs7lsIGcgEAP8KFEJSxPigOq78wih0mJPQIOA6p43Ver/h7XycQ+1/6PuNr5
/ntp0C2NA/OafbHCi0/Qe/NPtq2rZAPQvdNtzBmD3TbMwch2zkHIADkIZgzBmLkG2e6cgzCP7f7A
B/d/ef+4Pt/dfcPth/7fcB9w+2H/r922LbDTtAtjvz/a29B64/7gAADc3+t672/aAHreu9YB7YAH
kPOBwCEalS2sA2yRWKRsUDOeCz+fY25gHFKJ0IAorY4QS35vnXHWdH3eXu86W3zAtrTy//7jgF53
thdOwOOgXbsNKGNK2uLp4W3oPutaQ/dMwf9P8Q5DmHbQ9C9AD/r/m9A/y5MZQZfQ+Qe7ZgzDyENs
DMO2hyD3Tbfdsx8g23bdsAANDS+lOydLC6mL0r80+l+a+kinpnqXqP9hn5r+wz80m0htnIeQch5D
mDbeQchzDyHkG2ZjzAAcgzDtvu2Yds9B5D+H+R/3/++f79/vAPkH0x9P8gB/djd7/s1r2a2/Zxt+
zjb621nRWdGF6VXhVSVVJVY2hRaFFoUVnQ5o5oJkLELXixKzmjmj/r+tp6x/X+cWIWIUIEIJKwga
yuOxyWwyIA2EBQJhqMCBGzAHVW4tSqD6kE9wqfgfU7/Bp7v8InnQLZj7TvP2iO+uJ/hTYeEgkGnr
6n+jjLa0AADTgP++fln+UPifiR7M9k/2HxPyP076cDQLNM6KFMLK9+RSK/CLj4P8h+HP++f7zGv9
4VqT3/vCzQ0ub77sjsjUhf6aO42C3koXmoXmoVPsoPswPswPkparzWoXsbasbasbTorOjC+jC+iq
8KryqptqotBiFCNHNH/XBzCa/l4Zuc2i0WAOYHE4ceXByAMHAAAC1UGb503hD/JlMAUVE1+XOZaP
JqqppZuW2sMsS/MBNvK6vFJK2IGY9IByEtWqRy1rzDNGMahDMNLCgKbf/QklWdkLI6+cg2XSjeeq
+NEDJ4baQJMRywxIwqvBk//HJC125LTsyQkWziVNZ0RchtRvhLm4ETaqMi8lVwNbfgZI7HHVP6LN
D3VXHFMXFTiWfNrPP3PbwvlpnkwHqnr3agcFzhizJGhS6cq/FhZZ/jb3J0GD+Xlr+wZmsYP7qXsS
lBP1qWVb3tKUVg5thJMcIPPX5Syvjod6IjcLoksWkIvQZdKJWJ3mnb654XvpsjdE9mBGoggMI/MQ
dOrJ0sHOcte7My8sI1Dzw2GS0f04SewcWhxgMRuSA/OZNcnSg7aWO9n/5wDkvM/hwezOIfQUJo//
eR0M/ltfZQGqUjfp4mzGRgwHYlS+wEuSpUbvAHMyj0LWDxPO7QD3NbqC1NxvukPdKgBYMUnJI9Ia
ThPevDCDOq9RPGYymAUlTIEEQjKGhgIUgmQmwM8QyY/jLd03X+fuO7EW9oI/vtdlLNeCHCOce8zY
NqT5Wa411BHLuadEFOhrIoVcAWAsc7bBS1lOvawcbQjN6wusnuiGjNf7brhYbiNafWyOOloFj11d
D7KqslcU5IXqGRbw/wDbjKAaYcCbOWm3mN5q+x1RrHuRYcaQq+UePaHGOd23Btyc6LikmgGUWyh4
nmPU+0whEqRdl+pQ4rCYLkIHquOoik3z4JH/KEG7decZL3gwtwD+Zmcsvb0VQv6vZDeKwLoffhI3
qJbY288vBZjblaTMS0U53mYaefBxzBM/mdOR666EG1a6j19T8k7egPxlDQayl5JR32+S3U0BS33X
CKZ/Pt2PuRzop/2RC6JpA77gcrHsVvA4OaFDzShLYg73PbCHVSTPEBnntPJ75p/rHMIg8PyQ+WjW
fe2CPy8oKraiY3gD2I0qkpisf/ES1ryvAAAAiAGeBm5Ef9Cho6M1sec9eE8EwSlkMT1bceHieb4C
pT0fJfml8/tL+WNgBeWFC+XHpzL1Q48FcKxACacXjLV6j3S2eG0boqSu+dtrR0KTA6DdUKCcU+Sw
+WBHFV9zHNAOKa1kNKFsKuamj1jmmgS5rjikzS9uPDeDZ2jfWBe7v59Ij/BMsxNn3pcAAAs1QZoI
PCH5MpgE3zmygZbraR8VK4x5tSppy/bp57Ob596AUeegmiyEW0lgrYyYIjdbR7V/Ihc7USglgpd1
wnt49wNVjwhDi7W18hxjzXBDyIsJOQhVw2ECvNBplX90SSybOJhmWFZ4LG2U0IYLP/Rubtq6kPy8
WLhzRn+5RSyljjPAwHnT9YnsIsSe2LMjR2OhRy74nhutzF4TC41SKW0r+NBF0h8Tm2KphXcA/HIK
cNxPO3mnNIF2H2qof3/9Um2l+kzXxpdvMjAKM8+HFDHvikJTGry1cslPgpEYWLg19W4uandHJDms
HRnpoBUxs+qfsJSRNe9Ed+pv1+180FCYOk/wcLva0nT+oK99B9VmVqE317EidQrcyaGgkqcwxhoH
UaHlY17dr9v5UWtLaqChARZgFJl9RmW2OTwPGGXl/SrlBXQA0MHFX9zkCUb6hEo6tk/c1zGA4w3A
Xgxr9oHuRp7wz34kqrd0OpNJQ6cZvBCYEFwG0DrCte4ORiiSjWyuxUzL088bBTUC8hhHgwZDQHax
hegGn1RrOgj0Teacb7KfXYvpIAQmOvNbJ/HVlFqclkKeY35aWBrcFTeXFXttQzvvXSbnZd0zUb0Q
C0QA+0G8GCIiITXjdLslISOyPTDJiBSp7gFGF2Q/oNimazxBNOH9zn/602Edw9/U2O3MzVMr9Mtp
sScWezW7NR9DR0n8uFDlSIPTsbC1dmWRIY5lWyo2HFigQqTvAO3hxE+deCi+WOLG6Gh/g+i+0yFr
KgzFcJ0cSvKAAuEsGFps1hpJ1QLXjvLSDgwtG8axmpTl9xEqI2ZLdLeFue6b95a9W+mxFTwQfvdh
jK6zskyCN+T0gvY4CpMvHRn5VEUP93exmsq3qmdfo94PT/ig5rEsbChgYyyjOKlgLb1YNmmwGLe0
fuOOfsBZggHK9orfXPoes7Tj+khE8wu7VXZlrHzg1JOYJeL85h+P/NdlQilfA0rQUomGwak9EkZE
v69NLhKEsIgltc6xEo2MiywZlvEuQpRe4WfMMnIF2DVVfOqrAOri+Huso5U6l1gIRGXburE/Us0T
K/BYaZQGk6Yp2zsZYjHuA17HSgii8EmAK3hMbV2tRvjVypGX1cFHcY0Z0FDCX+rrDfnXq2GGx8rq
5Tnr7nRDLDSgWY159vAaNyh15HXh5abdYRZrUiDwUoA3gSPvN4Ze/MgvmBnGlJRhRNuvyuIfrb7x
fcj/LSCfDCRZ4/BipueUjN1h0WojcVSbzMS+oKwNgZPr1pdT7w6FHkwnOts/v/KiF1lZrmBIs86Q
ArWRf9DwraAeTbf9MbfL0QsS80fgyy8TyBR/JmTQcddLs42Lk7iXrynH5YiYCKvjbJYVykgV8LK6
f7MJXFQ9wKK0Eu3dmD66D7ChlNjCx179elgxKb4rUfv6/l2Of4pyI8zfLtadfEExMQRtDaet9wu3
S5Pl00IZ0HSKtTVKuRWwZ8oJey73bpcqoJ1VEIqxbTtBJVP/wiekVpKFl3c1zPlmYcCN1rEAvGg7
hUcyXIHQiorLR42JaPO60GTtvjUaVVxPd/UUVdoOoC1paq+qXNDnh7gJYTNwOyK6tt9Zy29rD3xu
MYdrEjrvQHEMFBwI5wS3FTLLrc1FCxmANZQcBZ+Dv+iFc+Kk4Qf+2nUYrX0qdmIxTjqePpPGmvTf
oP7AHGy8wmG2fk+SVPKPZEW8YieUC3wj2AlMbsWjo2fnHtwMKHWLUtfBru5bUIyUsp5aSzgYHwlL
iWhVKklWHNMIGraHbryaXXcCmZFghR7ENJpLgwSiCX+04Szcpv8PbP3A/jwNkoef3Pl9a5ZVVFCz
5fIojxDGusOaqMP/ke63HtbpB649NQRb/44dVenaBb2doVwGuMyAmSehuU+1l42CSia0DZxeq5h7
Dh4bL2HOv8PN+qIZ3SAKeHhDVUmDk6Bv2+pXLSyp8QUmwC/zkv0iGqDo649aCQtadMK187QkAuN/
8o7FKDK7KACv/vbfGovgGrolxrgME6kWSEmf7ZzFiAbQvw2K2K6sNUYKNG8hiKIdWmxqZ5CvNb+O
sy/5sWgNVPc2Sy4pGhgq9srvdn676K6PK6gl6gNWFFlSMLxT6VgaehOnd9WuMUcBj4vSTeEmWyG1
kph29StEPcnXRGn+8djV8h6Oa9Uhi+uOEhLBjFyOth78BWyFRMyI6eclshTgNBYo0Y9+uh6nM6QS
/dAbsz4cN+93RA+08IprsuqmGEoXL/9zYFnZlt0eI07br3en8ZckjfpZ2p9wbA17vxmuIROgqqfJ
IpKsgQKzfFnXI8facQ9NeVb994V2YMExtHsrJzCgmgPlR6Z0iGSEtJ9Dj/R6wBNA/XmQxuD9aNDv
mHG5STyJnpsVKPqZC4k5a5HcYSKiJK3j4idJ8M650XsQfpuU60QfB+8BmjJjALcjRjXjpNYuZ9EP
r46FuF9MWW5JR6E2LTV2ieFZ+RNDEZyhFBXw/HJg8UW1xmOq7KtACXyotkHrg24pUCJ176Bpwyi6
feUzOSZj85ybE2ZrJiZAkUK04wTAizy9UYSm2Gqd6YmI33Alguu5jnW3rdWzG7b/RriIlCPtSS8H
OW+p9ghdaglrfMYx8UIauIA6Q8FELrKqQJUQD9aQgnVJAaD12CJkZrhpGCInBRb227Opw0fCCrMi
iF2Io0BOAPZ0kSBnCQkFIEUxlT8s76joXlt9RlEtg/kvVcIOVwVMyNbSd33v9Wd5WzNh0NFxJ+Yp
nzTdOHeIbzdPE7ovFO51Dow/4DvdE92rESAp6tOYOf2kkSatcy/eji67QHuYQXBdS5ZbX1ip661Q
AcBapI552slNTXLcdYCzb/5JUu6GX04Ea6fW+pBAiSdlDPXyvBuj5REIHYMJBEeVchoPHmZWyXyC
HwyMX5EWvTrJ9pstnepLnc7yBMswc1mCQziV6Cgom4EPNx8Y19h2MbPcv0CYYUKgWxLryYNUgxZE
/elIs7cHw2zpdHMXBu6Lq60vtx14Z5clMpm6hu9CpPxLif7FEe2NdkhzF9QOr9atPxvKcBmxcyE7
YNpnrzCKwYZu06eQO737LH8H2Gzk7+jLi/vtnIdnr9SkfvfS/E3EotVjwuva0RYLbI8FE+zUs39C
VvaMbQ50V5rtB6CPKf2qr0LS+3AqGExDktUm5LPZuiVpZRSARLT41Dn+PAKTNx2thHexY3gjC+hc
qsk6E66fNrugBiiKElcvPgDKdyL88WfyhYUxYmmNc9YgqqMTXmpzmMUh8cLpyVSVmbgs6gsubHD/
2+0eStbWcyap8CKcGt0T5t9nnEvVAAVk0O4QdYkNGUhfmeqjG1NWMDg0+q2aZs3ugRYSkl0ijJ0v
wtbeAkgqz+yltw+fXlWWRiaxlX+0wgKEEs3q+768pSImxh5KfL87UqJ5+DFnTtf7fuIyEsKwJ0J9
wZE+MVAO+HwscO0uV2yB6ZyiQzKpcd+4HVenjkyIksoxfCUJAULHSKxnjOu1GzCGM+HnUHUPPk+s
Hm1Xl61VwYaZf0EMZ3Xex1qNHtLSRm8qFssnljwb5gwCwMQC7bQRCaC1Dj8Mrwi+vt2/LjB62o5J
PKl62P7DNA+QefmPsPvaDEbJTdq1wRTd6wJdDNoBOdhD8qzPuycxTRQDRvt2S4muatTPFsEntCqt
i/nZdIFXTOSB9DPZ7KDgyLPrvyrgmEGKe+VtUuGclxHaLhLctTtR03jbJTGIh9bmB+WR6lz8RaGV
JWf83wPj8+wfcOAgpSYJ/i9LsPg/anG+J7daHInCt/xEQ+9mS4WeNGHO83MYK2o5kt0w6uUXnpN1
n2IVNUw5V508Vy2SCacY6gAAEqtBmilN4Q/yZTACI//EW+LitnjKlqHVlSsjYEHlcn7m9cIkHRNS
un0N8xrtno3nPJ/1qonSPirJkRkc7JL35y4vnkdqHDabROppJE7Z6xLLRxs/U5qaTThgQKFP72tD
+dFMOyu9FFcgZ8dWTOiC73cNaufmc3gzw5DfnH2WEAdT+16gKpH7s8+LlsHLOM9fw+mPayc13JeC
6LDe6VlVPe6/ozKf9r+kudI8vQu5Z0Qbl45iINbV4rzLrLmw+EB6lK3Rn1AkwIp+4p03X7+5fW3K
HYHICHDONn1b2QbAqRIrL/nn/0XE2UV/bGRzXlHrG/0Ct9G96/bUIjmI28QwQ8FC4AO0ihQrsiD6
mEumN+qqRO4ZdtUdcUAtj6hJLGwkiH97uFi9Q0S9HmZ+Q5+LjzDhGmSJtCKWCPjcE23L4Utyj3Cp
C4W2dEz2BLfkqFrwKZx14geuC/sS6y8/3E21bGL8+RM0aIw3LgMG00zvcxx67HmF+UsTBz8VIvE/
pxYGuf9TNirepPkYNKUneNUmnSCJB6smAyofUTaXEj5Is6wFOerVaajEtpSnQ8NP6NxVWI/zb0dW
WmtYviG0+gUwl5z6E5TK8QSsHpHU7OfvgpfP2R5xoe7zzSmZdud57a8P6HQO85OpsS1INkSPIjcU
Vg7E4uFPIptzieyFRgP9tMCzCY745bI6tYPoAkCkEqwza8SeIvwEMu1YCRa/vAsg/Lwz9VRrdQo5
L0ipXbkGvqFdyZ7Wqs/DeQSiaTt2oMnue7UmQ1BDP216YtWnUfrTWN9cIEdzLBPrQtByJvyrceAe
yvFefofQj2Pi1o/xZN8RCjGCz2KvOX1aW7Vbwn36bqmRw8GEuKyKOq5yCebpxrK6YBY4ndR1mzvs
6vGCKfAME8GHuNzOPjETOsgh3hu8+pd3+sftAz5ImP/r90Hg7HkTozOTT5m6x2yQeUOcmYKNJI3M
gcEFR+kyII5QIhUCMK8LXOqn2ucWEe41WOL8ZsSUzTbG7HuS4vyjwN0oakoro4oOtSLEI7MmPYjY
03tpxLAlyDnbFNqMGd7Qv8N070himN1KNXYi34pNOgBwaEVKwan8jCFy1b91eJMnf9FfcjhlD7bR
qePZHvbuYJguocwG5J/O+vcZbCZqZ1rK/tLf71bB199L2beOtsfrPDTy7KsMghgRWGgqIsS3+ptZ
FZ+aCuIOEnp/61KNmk5zSd502wKlSwsgCP48a503BC9rsZTZovSCptBVraEd3N29Vl+rza0zzsW4
PoqmaNKmIlSWk3g7AfQGjvmN4xD+w/h1f+iHEn1eVr64veC74Ynn1pD6Vp++NTcv68ePXoPs+wiI
lEUlfyVvxGONCv8JW64ph0dhULFYc2ogyXpN0qGHwwFBxlGpP6/zZrqC1Pgla+3Io2PIrsDrFaOB
OMYx1zYsFRLyTKIdWjCz5fLZE8p0aeWZa+EiCDhYsgJKe2PcFkhO3A4Av+S2FTpRE8BOO9EYMIlP
C/K1yxV/0Yx7W7WBiXy1wnwct62KWoOKC8q4MAbxlGIk7n7QvN3UX5zWgtiryqYbLjWMwRsaGXJF
yVF9FeG2b9GY7y0Suw0NYk/lcHpJWeLwC2wTW7mB4MQ6WE6rn/2LffYI15xdnzpHilBJxweHoYmz
DSyfOP1L/P4WfzlARgqa0xUQhbGqOkWWvEtYp0c3yvLICh+R/mSGx7G8OFGAjkZu69r8KvqsMf9d
kgItU/OKceImWoLoFEHrj4q2aq/7GbgATrRFV5tHIY6O0u5DcDDCeo+XZrysK75nlZpfuY58tK5F
GTghi8AjtGu+kRl17JRjpAspVutH7+n8+OfyNm6L06LqfmWMxhijDsG1eh3MU8i3qWRPyQGbPxGa
IqP/XY0xcRAlzTiUNqAwbj5ndD7PkD+P8W2pev2OqIceQXV8ZL6bT9SP969m+1PF2YdKl3lGxD4c
OowPk6O5t8obGHugNndChqtdMuKBYrZSX1DYh2VZ1QFLfjVJT0Pu/mFOOWnnrvnQ4Rd16ImiP31Y
CP3urCBa/SlzyTDPiE5OuPrl9f1LIPdODvNaJ4ITwLVBBOqvWs2oOZ57J7oA9hpX2li5MwYawwTF
Jq29IqSz/D+kO9Vd07M2rOUft//kyTVNJLMDJHBni+2R0DglICqRPZd5+tCEjq0rSI8k4hdPf97Q
w3+n3XGQsij0VoXW76C5/XFDDpEf3hhkuU1K0ZU8niaqG30JWCtnKYjGiAK+PptCOUFxjfQ+7y8A
OYzm7B+6/eBH2/nv+cBDMz2iS7IrVdpx+jZnU6wVO0au17gGl92Qd3h0H4VUAqHUEELKGtWrxeRr
oqHyWlRMUHkkelS6droz32PR5EMZYce4uvc8zVpftqrmG30BKakf10CJbCC4tj1g0b9jwBREc5YY
6B62aavooMYFGIFGODMfGqIUe9P6e2Yp9xgw15zQPK6QQMRqdIY/NXmsbHK5iclk6MLO0r+KbSYN
C7mNvinE9NQJ7QR+Htwggkct+f5jusYs8wAiP6IkKVPE24mvS2y89Mp85DdIpj6l5TU7ZmGMTAHu
qY/esMJ1rQCbpufYiQzhBI/LN39q1hfjN6fPCi8P5KNlAr1FrPkhue9Xohhyj77xS+3x/ZtwG40r
L7TNmKv6Wrb3ohalALUh8y5yX1otzqJGlWXhIM5jVz+X6JGYVcoKoT5Quc1zED9eN0Jp/zvzrCD2
yztJfiA3JzAxh5OuddawJVyaM+lzZ8fiKtn76jsT6T6UZWmtbgO++tQLRNAXlcDiD4jKwIgHR3F+
BJMEuo0PzAho2ZmXpgWrM3kPwFr0dISFltJK2gG9oq2+3x1AIrzpbeUw2S1iGAGBA4R28B6qNHK3
gBLSYtHmJDZlurpy0XBm9pVJqcr27Hn7llBTDJDSZHGoXepu4BZq1XeWYjuDD4N8UH0dBiRDAcrV
8HKOREgDPfSBw/Jf4v14nAabHQANrBOj40c61n3cMaTJhAMA4hf0BD21a9tzcPWmVXOMpTz8GWJX
fnoIBq1TAj58kob4rFpZO7wh9wQcopQlOetS1/J44V0NGnn1HEL5nOf+rQK5TSizsi2L9xItH0Jt
IMVG1s9cpc3fpif+BmLXpYgEkxt4yl+46U3ZJWuEFpH0civpyKsoyk0QbzevoQ8PCR8uF4lDNuNf
/BpHKmEg5+0GMLBaaa6+E01iyrZ2SjekX/ZCZZ1K8uE2wrpiT+kbxCxP6M0R27q3cGXC0ZEIHiTv
oMkmX6acNWvKV1ut74nuV3GVTrNCwdzsfNqNn53FnASu9CEDBudgM7gvwmr+swL1d1NbNZoxfIzA
1qbgxhmydU2MLxIzwemW6UYzkztOdLBQ6fl1bfIOIpeMmbeJoMX98JBS2aq8yzpsBDGT6ShjLVq1
i31kjivEDlUhwuruHXcg+AvAEAu0PEL92moigYtT38cyFcSa1b5475nBF9LkFOEOEXr8xgNrSz4I
qjiizrnfjyUCdRUTQrCv4CGIwf1lgKJlQAOV0HYTSfkM5uHLOt+GgwEf9lhjcUNQAhZtZMLEE5hM
Z67jetmGiJY8nJeyvjLD1k2VBcbWpkN9UJ0kCZ8eIoTNTqv15OMgFlS77U7okOPENcDt1wXpQ0UD
Hbd8mjkfaXlQ6NO+I5CmMDaG3h8cDYcodQ8wyL5DKP4ziAhA5zwCT0MilCTZgSC3uovUfKX04kOV
LEnRTzxPu8OKbAEDTAyCAOIJQo7YM8q+tqzSDUUkuzjueqrki8Y9hBUUUNrjDj5q/BNoCbP+o1Qs
YOv90kC+wJfbIh4GvHpHQm566VgqBkLoVLmvXJoGq5KGG/4zmwZquYwHXqWgMZ84HPOmkqRWAeCY
Gh07MP3LQZNO3EhJJrdZRJdnjEtIwZOS07k4NJ0WzAke0KdS80NR7roGLxDBXNw6WuiLBCWG3rTM
hmSnO8oIIdd1Lm/JvuB24PqyxsQ+Upo5Vyu52D9+A74N8Vskgdew8R+h0mnxhBCrML3/voBAf8tT
PXtfGcRXjEBEaoOhwvFW6yF3kMY4ktZLZ3SZGf8ht47mDI77Lm16QWhK1SQIIV1l4yZaIxxLnXMk
mK39orHPf9U5UFmMNCrOSuY80Jry8dcH0Kho4dGOyBVrLvm40P3Dq6sGZsRF5MV72BWDDh1BWfiS
5GF9XIsegGTMNwlpphSrGZ0EgraRDQcu1UztDalYAA4adFtEf66MFTfSRxefFlqbj8JbzdtzpW8f
3g0N4c7ihaiIoaQh/RA8g96+woVHQvnpYEJWO9sP30vMZQNIaF4Hdbc8ZsYHzeXGSEOp1DeOeVOB
uFwiqqhRCMF2Q3MUxexNEQ9xATcNqspfY9OWAt6s3vyL0hI46Wwnp4e+UECaI0I93biL7w7HF4ZW
ieBQDLIhifq6wszNqPNoqsVDfYG1USBCGWIKBCB37KTkZZii2haqXFKslDevh9Vh2N+iprqKPB4c
B+u6D0dTU1dB3nCWULQ6YiywtT+/LKj14WdxDvF0A2nEwTP1dn/YUItaVn1WvmzzG9aO2LHgcI5A
WoC5yUV8ByRqhfhUz4hvxFZQAnfwMV2Lqh4SAlqLG9m32Bhl88TLmdNQhjZ5jCwh1PjZ00sD6D6r
RtduNdc8GXli7SS0GHIqJc6x4NM8Wy2WCjMEwPk2i9qryavphSG+etEBZstSGiC0gRWi8mX74DUZ
W1tLLfcd5QAOtbSiIX5mUJRWgXDxOCkirdDstoxK01mj3uwzIInI1FwN9MmTvqnWHuakMTJ9ljxB
wF9Y/ef2Yvm++yFJR6aqNQsSugjtkOV4M/uypgPntsd2apHLcS47lGel0U/GiGjGyGnjCAbbwep+
H1cjejxUbbeWrBRt8junjZeZ1paOzlNHDujNdstOMOuji+OVbhnYYt/HoUiEfMxzt6oef5USNUWo
QmtFL+OZmXmVOYhHg6SZpngcRFkG7E3/M6r+Zkhbv6VtIVGN0Ds+CYVbqarPtttTtP7IlFf2AgT/
Fjk7zWVe4eqIkdzV1rERFw/CFkdq/jsZBLSroHFOFCU/IOGD44ZFJBvfskYZVl5mi01onJZRCNEG
GIlKxfs41eMWrSBFANwVdaFAbD3QNOMjrXF7SvEgJkVi+k8BDp0u99Oi67c9rVhkdzJNgkUWWAdv
gUPGo4gUM1Ld9QfbhF1xtB1n85necFScCb+2Emg7atwpCqOKyBXBVkEj9J2YkysDr9KgoXGK6eRF
KBKAg7361ukiF7s7K6D5YqUuM1JGdlQySfhmxrphqwOMG5M25GpVdmAs7hGrSkt4uJsf//xHQz8B
tvaUwqoOpY+jpfJGGKTcoiSNNbz3C3yH6Ufq5Osa3ddp2gw6IjVO6bO8ebcdDiuvaTSEt1+StPzD
qCwe5iUSKWGdJ+0iZCV4Cev7Mh5RBMMhGv4HwH7Jd5wTcXMQdgzj/6rVH7cVCIjeksPqyhOBHWO1
F3zigTsq56Fs38lAV/e+neEghc+vjQ21dSj05UQDsi2bYKyCL8BfE8638Y9YpkINTWn3B1U9N/15
jR+SVuJHpD8/aiDKcarFeXtaoJpY3HtsdhuQPk0h+hpxsBj04xaoXy+nrQgjZJoj961sBdVfAxMF
X2g9VAODJcncS/Y3wLzxowVS45oCwdPn4dCatKmtLQWPhl7xp/4Hx9Ptk11xsgK9965Zg/K29I+u
p39ZJey0zetGyz5QJAF7tUYXEo/0xLl03gKZzqTUr6D/txMd3SMna81S4A4/Jy2XrcW3BqKso1mY
xLQ66GcH8gPrOEqQiDeFgE32BqXjgIfHCzusDanOGS1a0k3Xo3urhhSe611wc39R8ilGOx7+qRT4
sqz/tTXPnVWsHRMQJk2XiM4up3l0iW0FBNJq7vFa2zyLhykYGFfPUqlolhcQiF0wLV0F9mV/vQiC
q3eXuGd5ZNiKag3pVBQwpHegW7kvsIeh4w4MV8xrj8b1UvwBn7pM9DmPEnRfdkkiqZDjj3sozxbL
92jMNIG8PY32zSU2fqibIgxKy15x/lgt1ph6vsTurP2C4ZoEH7nWe9Uc7AMCU3zml7nSREAz4pla
AtLKfjxxE+rECGgha7IgFp1rcuCL1xHrHXi0opIlgdCha42ZLa9MebtJv7/IUrIZB/yZhrvKH03C
qnJg9tqjhG9nHfDj17c0SaDEUFV7b70CZPnbKx4MJm2tc/zkuC1xBBqmX24tvdxCvUcBFwNKo1wo
eHcizsp0iNvOpzmA04GPpgdunW1pzdkb2/5pANWQsCdy4sFz52gZ3thPYoJLdpYdfTVdapiDAgSF
icJjlGBctcsV9uIwnJvl7HTwq9E1gTd4G9Z3vvLdPNAfXUhpzaiP+L+B/QawRPZYJ8mY9dRmjpMg
JyAH7r9SuX98+SAAABDcQZpLTeEP8mUwBRUTL/0VlWwv//ngvTiogdwuALL8y2QVAkjHZ8CSHeYL
IQNWuwUFznsuBRjrP5ObrTl1b6K4ZOUMnrREqN5fE58k+YdxjwJb/lj5V3vV091rId+16G3zwx3N
1f9Lhkiu3kUb1MDrt2maZy8jGs5J+Z5ks6C3PRX0GxkSHOlB5dBdZLM3Chmagfm6KJF3JaVARZNR
TvLb80UzJbt0A0Cx1F6oV4GFQJkfzkgr7/d/4vJ2Twol9TkZL36U6qRNo1upzYluvtBef0mlx8bD
YlYWqlax+Hufrsvyw1glEZiOCh/NOaaxSr8CAN8sMQJJrm1pkIPFW9DygXnIa+SfPp58epLDldTR
EyIUvjZx1V1X3SpC4wu6XdNM6SPaZGEEkhUhMjUslT7pUGlu6veQ6mODsggIvd+Fv5DOTDBSWEYy
eSZHYKqAX1UyWnhrQOj/2tKlu59vXmG4nkA/MHLEguevpXw8fqfH89ZgsHqHgFs2LnDNl4apjRu3
C2QazclafgBnncxkhJT9NiHyu9qBq++0OR9a328OCa7uNUikWb5vtAzUkgmkZeercYOGJcPJoFkF
zSBYVVcpYIqBjPZG3qNpMLUQDuhUIPn+hPXuPYAma+yVDGfrr8o2qhEgMR5yd8suvdI1Y5AbwzHl
fYXjnadooS9O6A2GNb2gQhDK16YtuezAq3ooUYg1KRZQQGOfN4Ci1dDwVg0Ghndvufw4FpQrbgwi
ezSwt45ASTR4i3CIBQA8U3+7zZHMEVndqlflnWH8yEDumJJZI9oraT3AyoIFnc9Q6sqYxR7aM1vv
UQiBKSLmTeYYKNy6joKUN0iMEAY6kdSMGTTUYindEtgGeHmJ+4Y3+opfyS8ABNHUkpcV/EZyzWeO
SyeOjQ8Vdrw2uKEViqf6m4LWUXuBw3AIwly//gPBV0ZDbqqkWlSobMzLwp9oJOBUXF95aPisBhq3
of5FO+t05vTrTvl9KcwSlkM7mhjJGh+o9nUKogJCXhqOo6ETnsYkzyVqaYJHbAfse6/qF9eR7sCY
CdGanKRz+zRE0l1dDMpq+BJarormAUAUrTrKAERflVgVNNfNf4GmmgwZNhLMNq9cO90qluYa8wNC
ESFnRiyrXZUq0yANv/+/uz91eaxsJ77ZbaGzMVzmbebNT+s7SLOuA09Z2aflh6/XEFMN6kT7I34+
fD5G3vRH/5AzyZU4k0hzOSL48D1M7Z74TOF29kdojdcn3HqxR6EwKxyY4j/isSpb7DJ+jRZj1RVc
B0EouVOnEmvMXxR/ZZjif21ukYGc3NMq5mEilOCO0mhooKookPDlxboaDHfOioLMgh8h6IdghLu6
1wlfSK1PwkphadTaXGfduqqlI2/wLW/RB11blW/pnR07D35KThS3ZpCDV5U2q0hvpGjLibuDcjtH
7cZBlTO2guNuuzFoEd6409jLYAEEkoneiEUz2k+/q8O4z2IXAHMj/cjJcbsST7n8VTN8zGU00lml
LVBAY+S5tyqR/0jLCfdjEBUW7LZjah18qey3QqOKaXriO4erk+aZtK6Ve6YPenwwzYGGt204+2oP
iOkxawySXnNA4Ujhny+F/uuOIQxFyTqHGSFmZdelxihue/TpxDDeekCtqGf+7JTgWIAI+WPErhXo
cpT3+qQPkPX5qOQB3RX5JrwbHAykSw6P4uWkaxLp1nmTp+pDH876gIDfk075EL+9OoLlAF03vcoJ
VFPDWUH7rZQUVhR0B1nDFA5WECoMy2KjA1CotdxUBmklmctLjUHjn8lREt8Xp7k821CdnVy6ITkQ
ioSih7n6L94oTX6v/8mIrL6m/NVbWHnGnhSUmjksIlXtAkS4BtHQHxltmqfKJtQ6onIZMahRrPy4
B2CFXww2rVtbTgw1+crWpxZvhsmjF/vFqW0N4Y5uGMRxxLZmfYvuggNukmfCM855efNshqjMta0M
+pyUdaQCFtu1Ef+sRz6pQhl6d+RatkP03kXIMuVGT7w48v0OJTUVtF7AgEW8aLJdFTyogmgiS5o1
tgz9Q7yet9YDUo0DldQsJAkfApyCyb4eHJvBLTNgMjBI0EraBvvK+jZbMuUkWia4D0wWO1/fO1Rx
+hz/aWKpiejDEVmmKt7y0LSNMfuZbGQn5TTS6X/gTdTVo1JVuBXIP6pf6dymHgI640DDe7CKBbBj
2b7iOqup7emQ99hrtPF6GI0QY6OG49d5rb5aMypMWMEatvcO+nzfpj/mI0MVs5y/LqscsMZHZH0s
PRZqn3ck9Uu+U1Jjyb1GWKKx4Aa1H3VG8K31sNUwlXuwjNvbP5wzVV2IRaxakXTcn5Njs/w7/yG1
5FQfXWihgWVB3tcoKMXSoTZr8ofm1r00YgDki2iYwMkFfwK4IClmASf8Y5jZDw5prfjp3JRCAZ1a
ZvLe0iNHvaxkPbbxOGszGD0Zx+zIBUYcSnz2eAGmdfhVPEXfaTg8n1cGOpX5LO1Iz4Uz4DXP+GY2
oe7C2c3Q7EV7MekNl35J+IQmANR6eGyESnLopR3IF/mWeUq7lV7eyTfzEOREP2IcRrlePBPGKYMd
lHRHZevPn9H9Ipe+T2eDOEyMOuITW7J+7IV2UqZSZ7rnsc4A9D+0oMDIVehhyFGz0bKNki5KiBgz
2DO9DGsDZfkRXNA9Z/iExlsOP7alvaji1xY9LWOpUwBW0WiixpCe2SQ8xT7UhKI7yqZ2XmWoG0ib
qKGvXY2qPkEVGgMYl08VHVZWnNdfDLSZzh6n3QmJMQMrNO/DEix3na2GkFCDTNJjYQZ6GdbRk5bU
BIx3k0HQP3SyrrIJA7izno6YZKRMZUPCO7ywcslQ/UbFxFeJFdg4MdMagjLkp4Ymu5iEDsh1x+t0
mHPNT3Yye6+v0Pmjr/blT//QlWTXKRXyOn2j6aHx2hsC8qiSATGjeDz08MaBWr0vlF1vujfo5OPP
YipsSHUzNumRg2odgXm2XccN316jynWkvQ9UEOmrL2anoyg6Ite/u2o504LZQZoZPojhMBJkud0q
/VhUxAbrGRc9SHPwFTryJqDG8EftjgQvL2RLtVzpffZSNL4fgMGnL7sfIUHIPBaueO+6Vyb1I/HT
Wq3UDrOCGa2aUhLgHi49eejuRqnB7bsiyKH6R5fkOs2ADNlPEHRl6j1nfyFM7o1G8MzUnlAlUWt8
Is2Kj2YgQnVml6s7/ZCTAnSoqihw5kk1jGhVirIXxlIzoBZwuk1D/PeGR8IsWfrsm/5PtoCbGD8B
dWJg87JtQwUGhstp+cvl2qNubl8U8sB/r9YG9V9rCZc6AZUZI4HUx1ICpYEDNhfqFgLlw2HTCk8Y
oCy/z+NbF0i92Mjnsj/lm6BxTFuoJg7Sa+t6Gyhm++mZFKLF08r9IODn4gFreH/AiSSJjiVDwl+j
SDr6k1//wZTZHVLirde7CmnSJmkjMwAosF70qgIYegjCIGN4AzYO2tqK3V0qnh/XoWRmnU2svjrm
brAGOufQluKKf7TXGoQvEqlDc6d/i2ByYHtzqqnx9rLOOSIe6+kEL0J9FC4EXc9PmGfSe/5h0FFQ
r+9Wybd7Lvz5YN0dn4bPZPY2+zRGyzXLiBRmhzsPc1iWoHrwD6KD/Gp3Y3Nv1IxZ5BM5Rqsw+qO8
th1Pb3QP3vLOQSgHsuKL+4MN/GYF0TnZ5092yBQ/RO31nObYuYTFxTjikHPcxc0GOEjmuu6eIRRU
QPtuAed4BlRyowq97xiXr5evOZK2iPZeU2Fxv1h/GouIJ8P3+7Omnw28O+KviufhuAlvf9RH44BQ
s9fQh0Qq3gnKRqIkcqZPx7e7L1y5EQPGWbDRY/lm/i+Cu7otXO3rf43IOwcyosBPoBvGyVN09fmy
rV82matCDo3A1TFvKiAnCklzwgmohWU+fwam7qE8s/xE+Vgf/oZp11a6acTZxkp3xjHNncFDJg7L
p4jta/yj1WnyEOT33f5cK5ndeqFUG52L39Uvg/kQqdU5+oXxUZKnfsNoHZTlKQpRfE9ELktpFpQU
VzPKS5qdPBQXo0Ts7WiXk0YAwvfBfWXQuTCfa+3UoJSK6vcdBH6Su9iev3OVHOT28OD4u40KZntL
1bC9VCzcKsYut/Z5OsQNcykkZlyptEvvfciWLQ+Jz4+JnK/ntSu4hZVJdHV6YQrKsTD6rwUpj1L9
G20DAatRC3HL4DW1rIu3bDMxGY0zpP3+Ea51kwSj0OkIfT9l1hU/oMYsP05jBSzmE/otSQYIwaha
RqSXAHm5MUVe0cC+WvY5Lg+azd5A0BTJEMxtSYDtKhd3TjVA950oOaALPpkJ6+by0r9dRjJUyqFX
PwF4atGQUBkR5yOdOJDs4BjE6veN30Z9RzY9kUOELAQ4qz2m7+jhgQk5KRCfINtSHKFWh0bbeaVf
/nKo/UMucUvPu62hAoXBgQf3nmNYUhF0vIHyFjlnzF+mzQwL1P98L3I0P7Zh8w/GJLh5PhU0DNpR
+S2i+Jq7XwXtnC2tas7Do0b+Y3eyHQ4xTmQRofaUZX7nyiKVRXdQgjt+d+DKQumkFFBDg34sLX1+
xIcphkrIGb1eym5gzdSvrkOQJqzTtZ1OBtyMbqN6EVC8GxThFTjJJvOaufqUlsY9IoH9a+u/cD6m
A24B+vWWwQ18/Y4NJZsR6I17HjRj8a+iJGtFYPp6UQyQ4G/YISTBsJjh5v5Tc1bbtoYxfWYroVDf
qpffKggCXZ9+3388mwhqjkRuHQA14mhe2SYtZB9COdrS8BKk3tUrdw1swWNoGi0OVxT/lz13D3bt
V9jG2oPgAWBBbnGlARoFpZxQnbQEJ3XhYos2PMz0NUJCV+2hSC/+e+YytmQcwh9HBXj+FqQDM9h2
1A1g9O8PRUk4lZgUSqAX8+uLnPGyJYTtzW03+hZnQzgiWFz+DnxjTL88/gshQ4ooOZKNzoQQy5Cm
2gw54BaLLjPA9LIkwwPUN9EyYJTI+mG2mQwD9hP+HE/oKmbDnUbSWYXtgU+ARzyYFeAyrzHwy5sZ
pIXfr5fPjNgvVHxGTFqNM2PXBbE30e+bNT6KEb40GKHbucrJ5ANmM3XoFjkOBdEj8NpvzdPt7Gij
iK7JudK3/2DM1s6eugTKF01ZKmTcYyld5/0chmZi3+bUKRXDP9hnxsUIGVbA93IgDQI3ZAP7NUW1
Dznvdk0wDveRQ1imcaTa5fmVd3v9J5YSvyomgVJKfo3RJ9tr2IbC0wBrsz+MmrLHk4BYcQ5dZiCW
j+xGB+HN46sN9a6K/jb+aa2ZrzwZjP/RFAZ8v3XLBc7jAazAlk6iYsv7pG0pe3ZNJ0fzekhWPc3+
qPBVxGzg0NCoE2haElTn1RuIx04TTM7IjcBEf1tj4mgKTFx9JSm19KGKdLP1CF32I0wzcjgQzxEW
M0rFkHN87+1I/mllX3irzofsPDsL7YzoIqiINJoF1RxeBEqVyEm27GcPMjGtg2UhuVWOdUuzQ1hY
yJryJC0pDSenDre5O1T7i83tgNLS7aSRnOPlsbvlg9zZ6fUkFrqO1KcR1zulqv6jgvcbenAoGHBJ
TmjL6YhF9sZJecLjGynCjTlagx3r3PHCLLCnNy4AqDpIR1E7Pp3ieDaxarW0FsKbXRVO755lB4gf
PKznMMb3Fd8TwCq41vM0o3UiQV7+NSS+v3I2o6lpiVvW9PaTD533/EJpSJezsqaz8d/vu+vHsuvZ
Tg0u59YxtjqAtWmdO5Sfdk5uW8YRHNqau5u5H6yzwbYpna1J/HlT7Mg+objSeiGI0oZGyDGQGs0A
AAByAZ5qbkn/7JE5rKKwfTABI9t5o+OWBeSKSdmPgTcgXVvT33uxmrefLASRDUbdLQ1cbQVovB5+
f7UldTFNEtQ/AYbkMOKvutqta3sLDn0nKzKjJWdJvsXmhbrkCkHszOFFPzOnmMXYtwCkZeDB1QDV
lBDQAAAP9kGabDwh+TKYBEfTZ50wI2IV9VYWaVYEb7WqsU4zingeKPySsyMs0+a/teTkeSaZ9R1u
f/OcjowFT9P/1PaeTBY92b+KZbqpCmlcybnWewaHgUlF9YNpeA+5OdXC2N0R4fg2Q8l1Au4RP4gr
a2KrZhxTvYbfxhPjOyItGUaiVWuRCWHEvGaIHgKBX21V4fPXRYck0Gsucj4HJG7z2bYFXlBt8qHO
0m8mwD7sVpptttU4BudQFf9xd/TX2+zjIpbWqf//g3q+Fb9fokr2awPk0qqiwaDptlqB75vStyyu
8KM/YlklhyIAGqU2A9NZJ6Y2y6lkhGkNtBzqRvQXa/g5WgQLMNtAMK6d/IIUdavsIvl+LnFq1xhW
Tw7XNOE6TdeJtIgHqYqDzXNkuL5PEnzJgsyq5M5WL13SF6AEGlUdlpiQqnA29A6ChMsdsKokkpcs
0oQ4Wz31FEA2TaXN6StCcSvUfTMu1MWwiuaYru5gBbNw5RtqcxTXLFW05kK7XorCD6waah8liJwb
WAiZriCq4NjG44tblbOGzLKvy52dKIx3ZX4CBcWS4n85G94M/tSs8cQEXwG2rt1jTp9u6zajetCt
WIRjxB+d2hyla4onaUiizHN6fNOK4f9C/ogdnDtJJgmT2FdzWoWxh8f9EteK/OI3BL3+R9irA3rN
kFToImCzixrh57RN2PE0n2usVnWVDoGFO6l4Ra4T8TMhGsJrSCVJ4CDlmDNwDWYbqltgStgfJoHY
xR5pww2miNn1ZURNWorfxcwjIjpV2WEb4FTWOktpDGbG9uenvQuDdWPIdFUPkKbTKIFq2//U4JO6
HSmWJ8IG2UlxNmQsymDTVNpuIGbbqMnkjx+K4hR6wE/U2QG+TvzdWWDmXq/m2vPmd1IcpmrgUN84
DMWbkTCmr4c1eL4uG4OWCujX5s/9QXu38kYNXoAi+ljPzJ/mUehrZagJKCS3kDjKye+lvyw1zpvG
uOpjAoe5Ow0EovEFTv4SOLu2SSsAwTaITXfcdBN5BAcn2nI4x2tXpmy0p69zjwuaSvTkbivgrhzz
P5Shw8KiVEqGuxMHY6R3G0lE+DdIewKDiN/HvCKXmnanHEZxIL+4YRnM946y8y0BnIh+j4r+X/2G
Ito4AOjUCpiprMBD8r3xS8yc/GY3Wj+UOKVT/TjJjHGa3FzM7wVTk0Y+2ZY/pz570wlHHlmaOlDR
1RX9z8FjkIGTIWTZjQccNujuMIJMqSDMTaKqnX8NpF3pIiOpSUxGgm6iHPCKkvCpHNIsIjU4DOaa
/QEn+saloLhN2BzQbLlhp/LxEp00VGva07C5GSLE9MFoxYrkdYhGAG+0J1QzddJR57pEXrY0gJ7c
lubTzbIhLbJZsOeDohiaATBhd2HMVJXrS53YRX7LFFjIdijeYh61wt2OyU5YSeod8sTvoQjiFurY
Sm8O5/NeExjBRbQuegjefnthphaq0CbLLpB2Ac1v10HVpXIGKHFv1UbY7zBNvGXfgDmaBL01HQft
tKCpesElgLhKAEruWMX5nA1OM36P9vQVVuHmzG4GYQemUvc0/DeceT9OXhe6zzQCFtJAUgQ3BUze
oxExMh03GZtri9mmegGkc0xKY7QtBSNqowtg1wiFTpbYasPX80lMM29Ag98qLTSViu+VfUGpS5rt
abRjz5C1bK4AfUoLZnh935u0OLYwDp88tlSf7kmn+4JDguh30ZrIgdKpDDggBIVhn9iln/JZhk/C
l1Rdaxc0un+w2AWLzsjFriHzghK+jpTDZHwnGbpgyaoYaKGNNWhzcIFW7FlqZRXz6oj9Ik27mqb6
xHmluWFRqzQXazVGKnrgZJDs8amT9OwysNVfH6Y2NEM/qUcpsAbB4G4PHxajIcziDBZuZDjqYJqy
RacNj7ySyKNCrrafAO0OYvPvUq6A79zJgCY9S5d/e6AeSXc3o1vw7T1XnTPdygK4FoZFicSPVowv
Y9xYJrNC7/NswFJEKX75l9UUpg5TDVUPgrtK6TyUlgq6y00Cc1cRfGnC/3GFEk3BEkPCLpYxLri5
8WqheusBF3OvbZFwSiSeSYxxlRbs3bKS5m6t6TUXxC7+vEGlHIfU9PMSznJ/S/38wLjkc8eaYxXA
Oh9W/BLq8Gmh5lgYov+yf0X/YOBvJxrlBLfKlZ3gRYqWiIhlRsy050dIpuHIBVyXA3Qdx3agygA0
9f2Jv6E0JzclQ+d1579Wf5rkrM1SeyFvcgxCwrni/kSlMem1bi/CovdqSZFwvei4XW6ijR6mpbnd
7u+q9/RjRSK4H0SYJRUY2UP9ckDjsY2mOZaNLoNFLFEBi8m+w9+DnqVygzivsG+QJ0rET+S9f3DO
GDJIyE2qZyZ1N2Sspo37H3iG8HzMN5/EsMxdNzlO3QZbUzI1/LY3dsvLTTMZw94Hayklbldlihgq
OBB1GACsDyAZXIl/rkbVYtlIPpasSqQQmns1TpJqzdUNDzMACCPnuvFz5AjCHUVDxE956hXJGOwb
OBYh1ZTkfyCu1H8QqI5YTQ3/Ggf90pUjedme8yx+fJNVUkk54tiI9MyKj3ZixW78/xqn66JDLpZ5
8XiEyKlGDyGWm3Xnz5NLIuA/cvBjv8SIeea55A64fUFgq0Z4tkjgxBY5o/EP51mHnIZ/2u2uPCTD
ELeomQs6jchz4lW1lWczeTk3YU3/+G4vv4pyXlCJ9BI9TUE30VyaGAPgKi7uihF9Po33nnQsCqWz
36fEGRtSLCY35K6a2YiMkLEdWJDentZjcMYxC5nJjR1GEgXk7w0PYy774KyR38tVDWNZHBUAkW8m
j+RrmGnufIhz83AhkLsW70YfKorrobkMXb+wWVKotybWup5MqjfFHrV2x8vO1ZLomn1V9FSBnLHd
UEp+SNBfsxW5pYr5XrHPasxax/KDJH8dlJ1s0IMA+sF2qJ50EgBnmVR0lAhkXSDWAi2PPH19rsYA
lPL6gHrxgopr58gCkyoZDWkk6t6tvrTsl9csd/fyGoVxPTKOL6KWRAeiy00VNWoVvPE881SpyorB
0nTww3y0LMIW/AwBvrBLT8RibVE7+JMcVdIo/LTnySKWk0Oqm4D0c7h1NItSBnMGOMBqJvlXWNTf
EHW711oU6H30e8L53SepPQjdcCJLN8LZnP2Ys/kcBHC1bCC6jFzSeZPCm8QxBGtBxixyVKDIwVVG
w2WE7uv/PJRSH0Mz53n1lf03q9wqnSfupp5bcktVxf2gMLm6RAgIK7h+8i/oIjqZm3kQZshWuQ4s
dKa/MBuuSsXX0F91KpTWQGyMjKJsSmURT/L2g+on/4PZkYvSp1Iwmw0Rq3smyml+VbSY7ubmXtdk
AztZFDsU2nf+LbN7SAdZURDG/FS7NJd6Fd39iO3tW9MdVJS3GmbFIT0BTs18armfdhkhQRhSPnS/
bmMhlOI3tTzK9xis/ZRe1InCWw41Z9/fjIhMFCtgfRSOQEoP8qpjp7wQLL1CDM4hRO2HXvDeeWYk
dMS6SDqFUkMdqtB8jpTHBnfMdNcAYJiXSW+cMJO8ZB1KrcCsJoF4cGadFo92S4s6UP2iuytVvrhd
342v9nt6fF/CIJpZ8PiGb7+fC8WTRRIA/SE18dEA036aDFhb8YSg0GrQBHOrjaVSJ0g/FEdWMgzU
/sgt/CTVNMTrIE2yYiFMYlc3zgAsP/aPaR/vkxPrz5LceC4ViMNmQTV5VNVrfx5PGZqnPcCf+FeS
XRVb7KZqLPrYAS7qy7CNhWHiSc40F8kMa/d8Zjz6ydRxiHfzo+SIXVWzFq20WRGfqrf4ZUAcXzgk
R1/OSPfLGd2SfhFsR63hQkdBCxvAplRCLDy6EvIl0RJ02LHrqcm5TxOSQLk/+WwtVwf0pUkzO3mb
77fuBHU1dDFhlx6GwHghOB1Oy9SwGKFd+rd9k+5+s/5CDNlXy+cTdVeOce5j29O6uJ+Xu8L4GSdm
ccaUYBuE/PdShYGulaIl4ZYvOM1qH9sIwD1LLmYY2Ljd7cPX7BUbEzFEaBqYD9e4NVjmeZsJXIJG
gOy6Wmwz6hO0gns84KgBasenOEWQ3vzZzkNnE5Z8Kx2sLi1kjAaBfIPj8RTSZx5+fhjAdLiIWy16
ImzBndhpFrJryid1VznMcoS6CHyXtljw6XruALQBJJw+Qj5trvSfMHu2xCoQzbb21xPJRTXpMNuO
adTURAuCI/pkmIOeDRJstnGeP091aVSIN5bF4Z/BHTGY94wpd0Z/Re2ZgmgJ4YpCEtm+fQEM1iMJ
EcfaWyYKlO55enClHOoTmV0YJslXKzRgJQS885I+vuRU/uPJPbABhopG4Wt4I2fDiDIydgMLe8jH
JCnOF/xhQIbpVbNKMvKArr96RXGwRirvY2aqUF4pWdaz1/XMOlIbxOmT1wTAMdJlCgoUXvZ8TQJh
EyCG3O/G7m05NqvvMFH1PX0jF7P6uLc/KBaW49VrtsUc1ptDopAQ+NOd8SQtW+cwMlQKmjg/xlVw
CK7/shdub+tusQnUijXjJCvLAzZi3fAcvMIAeriq7XFS7w1Inp3jwzqZE5bq9VF4AmilF8rQrJYV
xgU6yDsUI0b+IJI7UgHmZtZ3D2Mc738Yvyq0YsrI/9KqKSE1RueM6CHGbddYwJSVo0OOsrr28726
BQjLhnmJHX6SL9vcgUeO+zNj+RZoL1u5PYxpcMu6rz2+zPOokDqfYNkILiz9eU3tB1gjmvy9+N4U
CytYNPnDOGC+ZB+pkYhnS+QUyXfUgylMuKu0j8+0r8Lxa67xhr5tI1eeKya3pGyry1/HHPD7tlEA
Xr4I7zkl02C0mxhXlztooK1ci03s0Z+wXTancuJnfmLGVdbbR4qRJws/BSfnfbBmWTgtW+4ujHJk
vMYGlrRq31PxZpDGjr6p+CMGJTAQ0Q5nzHsyH8Qp4Q4KDRPeAtwzaCZLDFLShrmGh3bDgW7oxYHy
cPEYPkn2+t+aequ9VTrP9qwIgAPgk22ctk1gbhiieyHD+KDWcys7aWyKa/vucM35jCEc/n7QPhT3
X2D1HQTx35rcq8bdPwCL0bmu0gieQtP3bkJkoVWblSwO8mdE4petwU2o5vWkgCtefY2k7eeGEt7J
dmZHWVSCwAGUKl8pOf8f/WPMrMv2vMbMzp29W0hVBzejMGQ7rKtxNhehi8cmzG23T5GYp6ygKTu3
si2SgGaKDU7hl0TCXxt9mDg2KyElspIqBBb2aP6MbF3rlDQAWkwYkK3dziMo9ud0u1a42Fo9bZja
gwkg3bbugBYk+6+WWpy2+By5g00x9An88Mq2KjXC7smx1DLJNEUA8SzWvTNEYpTGf7ELbFHscBA4
NNgvqwxM3STVBrWGWYv9Kv0RYFylyjgykPE+OeeMMGmtasLAxh8a9hfMoYQN/8HHPzm4bT8IsyYE
zlVZNIq04DMQV4fdLF0ctAyXErqSCfnBHIT84gQySsRnZ2SBOpWHKyxMjUf6oAAAEVVBmo1N4Q/y
ZTACT8sDepp4J98OScW5SLvvZlS4z3Z9NnCE7fX96ZiUKXjKBSTm0yrjIZ86ZXzW6QuAi+7K05ML
PzUeIuLFdhCi5/zznVvgq3x4xCgi5UKaTAYPMcWtg8iw+FZU6lGqfklnd2dI6u+YM6aO6mFCR/SA
etQyY38BtLfoUc1+GgpzjduCwcElEg97n9KWP0FFuk6xSaoZiGSzhsFbf3+jGf/TrHj6pNv2xVG+
DYyfnzVY8z95Wz5bphOl/4NWupSad9kHlvZjFGu2/UQYTcUfMGhCTaDyN2dnOhYN1Ok7xaQwm+JJ
GuN00YIy7BPw8jgs10DgTFlmsBDyrLjsCofMKHHBldm8/rfy9KFSAVmF8a71C2TxX58M3qFuiPhZ
euAAOS824M0NdQpH7rrzwNAI6RQ1uGAw07QknOKqZufrDfX8+VL5sjQJI6NStNYiFU2L642j47hO
HTJ3JFiu+9O//gzP+5nTbNebYN4NrjnVsffZ7lUuyAJpw8Mw4bO4+EDWhK6byzesqclWR666iZJ8
eqavSeKlNqJu/2wWO3R2Lt5VNWq4ymyhSKgjoy6iw5t3Y0rlT/bGJ/gftE2dg8ZeXMZLvRTD72jg
Blg62nuHdUuM4eBLuariZo6DTaqOBdthu588ARnO/PDo/dyznXu6Dk2LIvgIgU39rs+svrDsGfa0
MnJlH2JGkGVA0Ny9Ft39K0bAeDmXshDtiN9dmu6WKKctHGn40jv32Bh0rQBY+W2AzorngxTP10/o
3oF+D9SSQ2b5Ko+cctwTFMq72swb4y9Cp7fmFN6C6JuFjiaAruWXSuOT2K9NxqZKUGSnMnYsAIM/
WrDReR/UVKNPaP1zeWz1kKjVq8Bkd3h3OW404F5MFsE3S6UpVR0Fu8HMW0e7yHfuXT6CPX8Dcefm
arq0coAb3Uzd0F+vWENdM4OqtdOqMVtxPtwyU6SgN/03kHRnlu8larAQVn9yACGweDLvZWq4Qel5
DQhmodJtLOk9zjfLfBnST8R5wEpcbP5R+oZJB4vg2tAIwKqLwWBRGmFVf3Qx/FyW3Dzzd3Cn2/hj
JfEV1pHtiXJx9nAHKItB5qpSJq33rpLZBrzbQeSQHrN9zvwF12S4cG6FTteyUgvQLGQCke5pD3JX
nIDDMZF4hSqirw+rKU/lzztunOPRUpaXPOmYHHELGdY9I0HKGX6zR8ov8Vfcov5d+edYnxOHIGiL
PoCDfQAg4Rn87xVnE+gvfDVPpsRtyKqaqDWAazrt0cDWrF5PHj2jxW/2Owy8krIlIXOvsHIn17vK
FlMCGFZn/+zWxgyim4irb/FCrRQX7CoCaPzu1Sz4JYE83SAcwb295RXy6lRnnoU3pDtgaXSFQ9dX
ur+G4pxUbIH0Yzfv3bBXiPQNkUIQkxaM8LrfFzjt1aTyNjQ0130Q8DI6fBVQK3BdPMJFrzBqjIkP
BTjthDYvuIC1vu9ahh+HwocOB/6rACkYV47khxqMtQYhyZuVhcXmLF0K3g1DBu4830c9pThBZReH
XaQD2fTUA7614WaY8e3BexvE6rdjjY17YgPjjNxFityOHtxk7T3yWOj7vAZt/Qks13W5hqnBLCpA
FkHetCRrV9iXa64R0ksfSDBxgyot4B5ptNCJa0DVNgQNSjTACc9W8UbnGW2hoFeyK9dM6IB/6S4A
CUpFKyHcm8XGSqaBj4PgPSwxiNQXyCeepEGzgJEIHGQPtJ1eW4pGgukAL259Gb25ngXOl+prnBc1
l6Pj9fmt9opCZ68Z6gYRvuWn6yTOoXuxQmV4crV4ydxSHKNFl06YSikcEWEPn4s/E9LMZtsHPflJ
oSTTI/KEbW6WR4QVF+IA2AlCHKK7ALYTybSuKNj7cxJjr1ICqbEseb67CBZG64wsYWopC+xh+3xY
ttXLC9supf/W0XX5G/T6cGA24dI7k0/xtfhFxhqiezJ/lW6dbOdveuJRIFcA6/u1DRm/gybqxneq
1tYlSteplI5SJdvMv/RXCsD9QmWdekM4uuSnAvdQVpCRpWYqtFpFUhj6odZFKamK8RkS/KV7dWSA
QrpDS8fogeSNVfJiQlQgamY9vYxG1+/ZBcyx0pXoQq3P86t8sKeEPQEEs/LvslLql7+RxEsQq2Qg
HBwwfHzgDQm9GWDtRwq6DYTvFt2Z8bFerUhj0v8dL62aV92u2NVWXfGoHy56D84b+NzMk40WfUC2
LfOxIXm7uZtc4js7apEaiVUb5p3RNigPS8zJbxSy/1g/tOt/i0pSb8eqDDtDz6eZ9hJWrG57uMNr
tzGv4Ns6RVqhAXlKMaZIzskjmXzXRB0JEKxjKoikUxTm2a15qGO6rB8WJY83X2qkc/qt3abGYG94
nOkDCLx/WSPpPNbt7NrUf0UX4Dyp0fS0iuLCXF5rHKRR1WhUH61jJbtgF5tvaQxI5WeGTlTLUcDJ
S+YUMjzwWl3pIOWQdYwKUmP83qeqQjgxjRgBwDt7li3jIbpHkgfvTXgWohCzt4eyoqgarmOLl11M
cQu63jreKybG1qRp+zJORaP/fOtIamSjmNaZDF/q95SiabIsgS+XrXw2hY8Yk5BMmwZvZErJG+po
WqPbQNHYbqShF6bNO75cyDnPfg9A/6BBYnIlEiiuxT42djdtGQP6iLb0gGUaYZ3S+6knhTYL5bZQ
ZpZwtNYLtISygqB7JQtbrQLC7LzLv24AyfT4ffemo0LRp8l7OHBy++p2f/IyTPmCllB+ZH717dSk
ONnJItlUVEWfly5GmU0m6FgOf0C0C+QVJrsex/DU6zOsSgsANoyLIytkeGZC+ZhNWLVQ1fKUO0IS
eE87HfKXjLkA2GUMrO45S3jOn/y3lnNyL51AIN1iv9YzKrORF/t9uOsqJPX+fhyrUyDKIeudiDHt
Y7cwlZptAiGOf1EAhkrJqvqm3oJRifsuEpBzadxvp5WE/l6Lx7t0eJvVrx4wPhm6AzWnHdpGND1S
AfV04wPfKjh+irrQ4boTnSRobgDkkt5AYDWqs/efcMc4gdOfwAmCIGfxvDqy+gUOqu8o9ihapveP
Tc+pYo/wL/BfzjU6JouMNLuMbJtP+tzzTVpQcPrnwb5YfZGjQkvwK/dC53O7JVMjwqJYuDEUE26Q
1vCd9SyXDHqVWOnn2w2D+HVoaKqFit7TV7u0oB8EWS/EPyaZmBIv1A9vfOaBxCyZjH9FdsFWkWX5
KCoWSV54QDui531lzsZxjHXUcW0gOf5eGH1xbxdRsNtNWho7gzGj+iaaKDxi3Sq8D9qZcmoadVQ4
CzlEOya59ivVwyODi+h0HhqPfVfcbtr4f/qE66EIdP5sSOcTLZ4PyZZNgET/WJIeuoG7jMOPhPlQ
dDtuqqFSuBUwVOYeUyJybik42h0fwOXu9EM7yd+6yDWEPem8brmdZlQSE+yHBpjXl/mvmSZr1V+K
abgjjC6FuqJ2F60l6eaTMKfDzNRjmTaBJX17LKutKO65dO3oS6csnbsy6Lj2sG4PkaoGytvKBmx3
t4IgPe+Qhd5RKGoEHZMDVBw6Sy6CW4+ahtfro6ut439IJIw1UiYWhqWvE409ddTbbH9qfbJrJxqa
pCqtlVEmTB3U1sfCZzWYbm1juWYpeGGVH5InmDbIEH8sjF7zHNFGjL6cpAmlYFwPiXG3mGirW5kd
AE9k3QZjK9Lu2OVzH+Jr0f9xQmWABcad19lBtc8R5wltkmL9q7vVAj0lm0SO/tfT4ThM2/sX8XH3
W03hg/ioyRvXsMTnLv74qzII8tn/lhaMTJ6FQFm+2LbbwT8mQR7HnmD6KtulyS3/Bd7GQvus3nfF
RiomtvA4vdaHCiakLP+obKJv0ahoQ5UZKQWFOf/qqNzFGLyQZpynH1g3HAQMzOG8fgzKkDiwe5rp
QcueRrbf+VyX0W37P9ZK2+G2i3q35g3X4K8tAJGYN5E5Qbb0vnRUNuTYZE6diFf+Lp0IZyXULk2I
OI1u4S9+k5+6inpiCUN1wSdv2HZxAKz30SXzQ0V/RSMPjudGITPbassnvdnLQ51wFMHXUNLLzrbE
4gOc1puIzKfyGC8gRtm4v1SZb6LJLNp6kW8oGFwQ9mEcbQYzGImDSJAruSj60S7LOnTYb3NkA5Xd
sUauUc20Fzyom3UKTUPBgfAR1/aN5vmscTnmPl3czLWPhHgKvla1/nG6c4nQbbqK6zcy5p/p/x19
RKBPc5oAxr3nDi9h9/Ne0NNIJMOxmgY+JBmFzwXJAGus5pzhMhB5El67LgSu/kcXqcu8BOLALGJR
CRiH6esvkbdHClR9zBL9QA9gjnC5/alD6EpnPhAwFzVK/KneabbA626fRFd4/m2DRnsxjCltCE6Q
IE7X1rlPA//Io8uoUyCNx6tsYx+y79MN9ylvvAjdj42Ffj6BQBTfEC3kM8rYhDoW7gGEZwP3EON+
NTwqivnBiPqMkmLeNG1IMEMuIwHdR5x5haqYuDRn8JpemljDhv88DGkWmv+2L3o2XvzINewjIMfg
j+sv7lbZUlYTf0wg1SBNTDMq8ju9NqqvS8KBnSHoqAOJW4fVVxGXQFXLXS8AsTEWw20nXYVSDbcs
kGvj5zntsaXrBdWyK4OgRrvZ3TK5HJMGf1TJLz6PyFvx2WMLxNeyHX62QysuxLQlZUWAkD4htzuW
etg1vNMgL41e/OgeEGXCqp5Ya+h1JkE4lLv/dBxTW2Ga0FdDLql3148PawrqNvWuZ/luPRJyKf4o
sW3Ye5BkiLjgitLE2jheV9NsWDK74n8Jnv6RtvlCvvc27f6Fd6kYcDEw2Ot9dli5W9ON/lj4raBw
4Jd3luBMZMMdXLCKMzXCj4pn4ZIPQDiMMi4Gim17F5JmyC9AWUFQrJxFljPcVYXvapMHvrQiMNJ6
3+iPG8rm0Z3GxEa6bbPVFlko7sNMv8mOqJYU3Q9zTTdZ0XXxkdEXtDj/I/qJc0QjzRK0/5KQ63qm
N9n/I5C3VmgXjrlrX9OpzdE1GKTPkwhuxP38vQVAk/aQ/oQUfbBDlj7H6QWfwyVg/hXJF/NhI4VD
JBk6+8Qm74SZHh6I5qJYuCPJ/k1rlXFmdgP3luXg+rBzdmGUQfZAH3+E0bDK2P1HiA+wgbAaE9NQ
n659MBmQDJD0WhUmUXOpc/6fJziNyyCGOY5mdu2xhH3G1Y8IIEktVKkmBDRG0Mbda3ZVA+P/2c7t
6CDDUayaBWsoUXg3Iig7ta5TDgTcaYzNNt2+EF2FrX522vUlmamspY7nkYdoYyTMMh+LHUR/YNOE
tvbyT/3Csy9CDDLhZzVIVCO3WHY96HerSWLnaRBLNf2gwLPjGGWGmWmXUhjdx95u35zePKZtGGS+
zkcgCiGar/8R6Z/8HUrS+DYx4Jb8pEskKHAPimf6K7f/knoYH/oFL+p2UlpEe61V9SlYE9hboAt6
7X/D73lbQIHoCWxlI0LYWZpPCzvwJ/TfNAU/HV74YECCP+7elLYEyK75vGCDUM0KO3fiw2OSJz3y
kZJKkUgWOnSU7HdZx1Yn/aUD86l3i+9W0YOkp0RmoCCHAH17kSdzYXBwOdj/hN0s8KoXt2R//UZY
lL6PXVRHjBnYz6jLCLYSL/ZHOR3hQXxXhLkdDbwtp4IZgQAbFEgYO3hiRK5W8wffsGEzmoTM+7xN
idGIXyIMOkxo+mlWTqY86WHHWC4X8oepOiunH1Rbp1NEhON7YAGMFPjNpX74h7QVBoFLLRUQ2ZhS
zZJPx0ePtEirxbukwotKYoC7olXgS8w0e6F63N5xxG19ce3b2SaexzVpci/nc5x4LJBuWPN300vp
zSUlRJkbw5YO2Mo6m6Kd3w8tfw+29cByDAGRV9qXuEwYVZDJh8fOq5s7Qslgn2eORi/p5k9oW1l2
Fi4p03ylBR9Y55YXCovRxcIhhofgJQF2RW7Ivi9YtUAuh3/rsVILfjEAAA5rQZquTeEP8mUwAjf/
i6QcH3fQ/CshHMse5e1akQtH/OSMB0TSEDIIXCwqKiRXeMwxELNmAGgoPibicM8x2JdynF7uYibw
MiV04EDKsEqSjaNTgKIbiXpoH07n4kMpbp8cNvqrUZuo7f1EMvA5VtVl63E90h8a3EFVQbxiptmy
xSRNbEFq2Vucl2SBPsqFh28VGnEmUaZ9pXSAbFLUvtmK+5GJ4Jf8UJT0NH7miJgUzl/WW0ZzMQRq
8TqERM1oyBUUdvVs0DlXe0BzNqQDT6gAnZ+aAeFNIBTSs2CkJw5DpzqHEyPL1KULkBs3wgQx0ESv
1nM46WQOUv68+d6w8oq3cuEpCIeIhJcvkNtvbp2Y+H/WnC7WQEUhuBbXJ/TJ+/c4y0HVBXOc9Z3s
ye9TXOhFpxKSO7k7rPqYyM6EMNgrbR7eBq7ZRmDP+TlxreEVXPzTyi7mNyw7HvgN4ALCWdZVv9Sj
zgFhCm8Vp5PK8XNO+Ei5SMyaZFOTdXwyZCBZDU843Yyn3KlhsMESKQumvmjSsRj7USLcENh+B91R
d9ACHyiSMHsFCY5hdIUZOoLpCi/sfTZhiY7fF645DYujGNZqEtP5m+4+R+svFeaRgu7rQMtEkbtW
fIeUZy9VI+R7PIRQkbd/a+I2jR6uxzvVWrL4yJ++N+iLNxLqjYwM2JuBsUl/RSdIgCvgod3kPeXV
k6p/H1a1XhV++pJayvkJOBw4geHGxQ1QrM7K9JKXQM/oma9Y0uOvvhmWUHz17ZFlqVPR+tepD4z2
aKmXOrWgXbRBIiX+ii6U6Wu6ZpjzVwo1lB7yrhFauUn0CsVtnb1idB9OLmN/a/Y8s5mrpqKEJey5
fylIyNkz7LSSg68Viw9vsbGPO8AKvxbYN5+rcvC+cfZ1nR/8NXipF1mv43zSmvjOqYX1uJ5S7Pi1
/Z92zSOqdiBgA9tKA1NQVr0ccRvY2C2I73DWTy+caMVDtuoGDkfoxf6prn9Wbi//G37Dcg3nsvRW
Y/MmCLuAe9DSbXC844wpMgJ0JEhP7eEj02yCOGH3D4T4Z6GTetVtvohkgggmu6EiggREZQUaLl32
UJrOTZk4EzGx4WxzvAekzDax5mCMFMVoV/JuGuxd9oAngLzv7QoZgVgu1O0c8m/YjPZCYhrfPCp+
1Yfks4ZHxBjakVsDcLktuFsaWFlY6z8V2uTgPsl4Zomzbxdg6kRaqSB5Gv4DqIeFbUDHDMxY/nrG
bmxs4kviBRruDzHzrwV71DvR3EdhPQd5Ju6YasPnUOQo3r7TlJNmrij+orzkb6YfzK9Ewx7wr7Np
3kD2zUomZ4KiOEG+bC+EkoZ2a3i9ODHDgjHzw/vg+6ydb5MmGnsLjh5CvLn/o0oWlIqV8QccdRzC
VtoN1ceItSwe2tJklfexk6llppmdpfD/u4pRc5+GZ6pwPHTYuJ4LJHcggKG8mq0d9c+vpfiVG7sl
joYOr0xDUVRl4xrnhuOYEQiwAimJVT+ugcWv32qK7MiqWLFDtvN9R6gf0Z/lSCLXvxIw8MbwAST9
xN+q9G7/CRvpXlRFuaTBHnmiaFZQS+FkSCWeqlQptsO60vPdhUVeMBHZ9kZI6y1WGgVCwk4FQiKj
puzMoJFpuLt80MkrleW5FnbHvLxzbVZbXh921fq7zMjF7p+wfqOH+dkmm/61Lqj7Jz864ucItDP+
vh0auXPfKQ4f3j8K+z4eeL2kFmwhLvwD7FH6POeleCS4ZPcihykzxKgsagODnnwqmZKiC7ZXJ4YM
GS0JttGNxr/Mm+Hgwg6I7zttKycWh6FFreZmZVhCwIrSaCM1gJQRVzHpJPUhb57sgr01u26LN5Y6
vkWE51qqlVIWU1oeQkjCPRnZul5Frh2gpkc2ZRzFVj9rt7mrJnFhbq6iwsva8Hr4rkHxQ6mCmCLl
s7uElblGfoijFunUdBY/2wIb6tc2EholRwc5bE60xrNEDWHAbBswRuKKQsDT0NV7ffLVIVkcIf3+
v9rs6HfDvgonRmvurYJkJVxsDuJy5zVzrN/PF61sZu9l4Iu4Cil7BX/NhHaWCKkFwIgu4xHseF0L
HrSZNe+0KecYUCi/e/cyGxZKuy1Vn9QaVFA8IQ5FzvsWR+By8j0mhiZjsS6ekC/tCwGEd9u8j1YJ
BPV4aIC/iCpjlchlCoOaR11k5vo824174sF36IfRuSaQwqQxd9qeKlCwL5Rwj4A7qJHHnSWBuEew
GviwM2RywbLT4V9t7xRb0wb3mupVMs8LgDtiV+r/6E4q9Nsd0OJUiAJdrTEwI9C06Py3g1clRMBJ
XBXSiYjRC2YwRDmqjaWkXR/G1X9bqE0Kq9xwmnHXuuH9wt0h18ydvt6mYW6HSwX+cYbnDRlMKQM0
NXMe3nxgO1smh7hj08G3W3MHEVQmMhQmZoJlmEGaKIILDqa0dFRGQuqdXFh+6GymmLoOMS4r/Rcq
A7Ql7Nl2SGcnOtpz7Yt4xlfYcVA7pLUIAlYe+Ennx2vri6uo9SX4ixwT6+EMniVMzh/6DROvEw4+
LzZ/LNhWFT3ExnsIv/nt+znialAzXCJPYEXd2d8spZmadOqbX4omIMe+NEUTpt9stg8Cy8ejPj/0
dpZriyjUtt82ESa+pqTmsH1OQQKmRVGoS5vpRU2R9iXj/bDFH1dmDSP31dLWRe9QkeYrctr8fnEf
ntVVKCelcHhXSdvQmbis6W9xXr2ZcqUGhoEgaIgM4aHF8WY/wFzhMktLdvb4pRCLOD/2g7pM2XoF
L6H3bYcMEifXmuWPLVYmKZZaJdA8qB7JPYgE/3Jx7fPONrKkvmPHBs4bBX4lQFQkPrDtz5cDa4+M
pb2wf7Ex6JkQjxSDVTJreJi3I21+b5LNtjuRDZHVAY8DbxhHjN14YTMM3FlEE5QY3X7jwRBEIqc4
/duzCirXxJ56xkhGqMXb596QuAgQNoKlz4FpPzHleR/JdkYp0ellVoe4aWZPmx5EJXc3g4RypYMz
BrTlrvBnO2ewyHOStroM4EPzYkVRBFw4TMnxyGha0yh2dHv95cHpCSZhDNOSSOFu0UNUj2uk2cJ8
9L5Se3kxPQk6Bs3GFR3lAzS5e95dxuky1atjmzGKzRFZtYnwsI9tKCNAZD3WKx/PpOyodL2SyZb+
7LQrhSforWGuSayMWCOEtYDoFa86Ss53e7JHlLePjfE9pIJxdVD2jU54rhhSrCjTu1re8QLD0ISF
y8DmL/jrAqrsrknQfo3M0Ix0FNLOMxuk9+VFxl2Rjw8CO655EVt92kvAT28Harx+UiaH01QH9Tm6
+1l1wUCImZhf94Z/N3NcBJF6Gdatg05BMu7zMqZji7LZf8G2B6XC2ualM/k1p8Ax4zA1N27y2L1I
Ys4e0kEigiQqQ9R9GlCKg+s0K5WgXomFZ3qNoFhHyDnpSP7Zazo1fMI5T7U8D5ZlhiuhyFC75Rfs
yQymehWW9LsfaEkk6EpR2ej9w4hjjKXD/9b/BRCUubDSsRGm1pf5fBpzaWSvYoDWsF8EVOxjNPYS
7PuhTmrjy1tFj9XeG+EhO4lHW4WphCj/hBVOuBzM6xqQ0nvhB6qTiUZ/bSwyD+arhZoMB0jlTvYX
GQ19Y4KeY/SP9GyRk2bAAQ2rxeT1bWtMPBm32BkrpxjkNedHGbRdWvc57fHnVP//QDMG+pC383V5
A//lI2ezZPLJ8McGeqRf5sWGfjvDIOSQubRGBJpvxp199XA8AO2KvX+YV6/a/MhKKQMYm9unyLTd
CuFrovLwTeN2Hd8sOTac7yzaGLHiv5ZYi9x1FU2pCtEfLFc0CVYcv1ql407reXfKm2Tgx6O/N3gR
V6vSq8CQyM/WvfCyt4z467UTnH42RbNd+rSbmWafmszT1r216//lnNmcYeuPVhUoL6y2yL5Gf6pr
txnXduCXNmhEGQHy+w5XAmx/oWunEtmA13WckmuKNsWroc2JgFXjpfyuuV9JRJQtqTuz4+RLg4py
wP3xPRB4F65icNMJNUfpo15cYcLhHIpnJYDNvJIZ3lyLtmoMFpexss0Anh8OPxJKdrYPNmKb3f6N
o9TTpJ4HU3jy5JorJEqK39iiWtLmk639SHWdgS4OobztclWYxM1Lqx2lFxpQn9Sto73ZGoKdDd8W
z9VIyAHm8Nd1xYqg2MKDtqQ3z+mUS12SCBhJc4tJ++AhafP39HenOX1/1hB/bTHT0oWzEeXP9G1+
LAgG1xZR7Ty4vxd0D7tuyMfOIDv4D1OQxRL55xNqtjF7ue3PJtPGdukZRf7RUckHEN3/OXghPG9d
EnpiD50Jrzv7yvgDY59goxk47Rl2qGkH0xti7f9pSkp2YFbMFSqJSD4oGOkJ3EVFISXEA6p7fZsP
VlZ6Bv0dZk2AnILmll2I+C+ZdjaN17Q4LS3Bon0pk+XyYl+KIUvsKMyY5/pn+KincUeULFR8jEgW
ex5lXFMZS/LPloyL9HbhZRfJaIUNMRbN92bHPAEwJ/Qd94STWXAdX8mj+8QtVq0j0NWXLibqiUF8
OoisRsJejEICksq8zgj2hoplWxw/lUuLZb8T8G5IHfQgWSY5qbP6iuObG8FXk/ASO0pp8vyqdsT0
40mVxxDH9tUO9EtVKp7rp6t++b++9jcCNRRD5+DNdNoDLNdlHwldJk3+QldvywL9sngIZmxiNmUD
8gFhA+i+RBy7G4u0uqcF76+LGN5hmsdWlat1WotmVLYwNa4MoZFQB2sKKXqFIuf0Wvq5QBbNLi4D
WHOmLBRC0l0SHZsKQPUKZiuEetfbPeEUgh8jWTFbxSjj0I/4zIZkoJxXlfm/B2RF1iDCZoY7+Kwq
RBjg0UsaMJn5/UyIDcEmgS0ISEXlkOSdNgaK1dEveeH9ZM/4Rcd9XQBq+OYOG0N0FkTWnujkpUX2
VDv3VWaknhRnlcptDxo1imj9IVZAec466JCS+oW6cQAAD5hBms9N4Q/yZTACEf9vXR9NR/fpwAY4
uv/7ViUvTq8nrIZDrsB3X37L20PD8DTJQyvKN6/BNRyII34CKCEMIX5sD/kn2UYffmPDMmNm13J1
xYubcWaA5OiCNBKTor2TvI8JqsJl/Fv7Qdc1YRei0gEVQl7Ty/aaxArcAVBFvsph55arzuGk7wf/
8ckrRs0b7SwiM1d9YfWRI+S+ICgNpqUbwDZu801CL2fj9p89t5sK0/Tg2x7+2w4pGedqNo3+cKmo
znvcQCEBGlFEuvXlZgSdIbjUOo867P9Ez0RfaM1RwByvls/a8Kzc7/pePnS5184Ynp0TzGaVvGIm
NIBATADZu50asDr+8txhMXzCKuoimufI52hVrjlnwXpQMO1Bno3nPm6qjQv1mHWVCUgX8deHDOUH
2XqMRgy2ayz6043QedITbeFzXk/Q0Oz/A+raVuRWKXp3bWsaBy11c1vD0nY4c2MyaIPNhYJqej9M
7NoWmQMWrFl9NUUCy4BlsAjFW9b2YohvBUK8rYl8T/cTI3eKOqs94uZ0//2DwuXlzP7Bz/NIvCkA
hZnqIO+KJ3usWzY6hSI/QYtcRHFjqw7ms+/rb244pB+MYeFknseteHYxblIKkkUHqMFZjiGiLFql
eTmf/uDpbDHaGXAR/jUcgLcoCJN2RGUhxFF0y68urLxmmEVhAO65gxEfV1GrVhubYmJB/Tpj4ymh
J05CRhBRzE/Emo1gcqCPLoa5k3HuuoO/Jb5UWmPznA9oapKrutUPqiTGdi5cKZRdxlJI9HHvtgoI
R91KyEpgDjJ60N92rDuCGzNHLlN/4Jv+4X/zGHB0pV92itsk6541uerttqLNbVbxLmtVW2qmpDra
BmAvHLFRmALRqt5Xd4n/k0NkWTko6ND38b7iZz5Za3J41NzrFhUF1cblD4Jfj4tNL1ypwR+U7hrX
nbOrEKwJF2twTPbombhgSHzXawSjsBIhaDFU4B2+AS96i5fwiwhoMcKWZbJmAqFRLZZJHOy9wKbq
ecB90qzcKHtWAGBgjuu+NWRqyBfLPVkHfFqwxuUTiYIRt8Y6KsbMs4EtF4KAgulhKHfjE20mSTXV
MF7vkrS3kuK0hqDmOdLPcWnirgQS3Fmfkozdi72CTzLvxzWVIt1QuN+bLiSPoh9+FTwZypOJywBP
IzyHaQwnOedcujq3hRcp5VP2ZQ1SQ9jqLzAb7GVR35bgntPyoAgnlEgiyi5zhTyzWItZOoV4Qw9+
8CU0Fe39grvdyrCfhAFz7Ih/Ve+vJAtsJuXo+9UB4a+Yc6/3T+buZzun1ztOytmaSzMA4uX9QPlF
1I2lFk0os+CDNRn/O/XJGH5jzdb6hRsOe6ZsVhldKhZpV61d4TF/scQiVLiel4XvBPeak17v42N7
TubsAfjEwdzuM/cxz9EXL2jTu+CmKpyEAYRQmgzI9XHXzgCntATQ+7q92nU6/gGUAa5L9XqdBSYp
peE7oK2J83rynpoGtSvtqUqwnbwEyXuLcy+0d+dMaVoR65z5ceVjZsiY27VuFjfF7I7bRA8Or1av
yTqrmp9gz+aOZ38HW8gJ1wHzz6JH3EsXtUogbasY6az5Jjjay9owH8y3qyHkkpbcj3HKU2gStZ3/
SVlMZEJXc9iKRNk35kdekFR/CrEVGnzqQzhxsGFcc6mz6AyriSvLjXtXYFRGoYG4c3LAzm6X46Ac
3CoQnOuyNVXDjF8sy7LW9eq5Ajfcekz+4zO8RCo48vYAGixx80HJFLo5CYCvcryXE2UFZgvKXkdP
Tav3UN2SuMS+9PQNnFS2UT4AwqnqUgct6vI8p8/1t+IMj9pLyNvUOEJSBLK6PZIOpwJvThTftXN3
lmCxwE1qOQ+8OLj30AORCOfNCrBwiMZitnsE4z5UW42+pN6InSi1Y1nfZSi3awAOH+6rW7tVHn2P
JTWIiDKkp3xpUmHH+5IE0CNp+fkBPfF/baUj2Q/yKb3wh5wIfUrH2EwK/lMB3k2Bby2UCOMZfixr
xG9lKVCyHkFKudc8oHojMRgCpXrII6enBQTQR9V7YTX/4dHk2ulVnO27+TP7xYGkQEGTHSmX9kqh
x7IpbSa0bsfhigPZGqxmOYZim6dQEjdwg263sbM+jz3kAsUYKkRb2CU9yvG1BdhbU0jE8JE/HfiF
FiKS4wW5VFzRtdVZE5UXqbjBQX5CJUv10d2CpmHj+qO3qK/NkplGm0BMpNeQggEwXrfEL3WufCSX
YOwdlpllEsI9Vg3IfMxCtV9Qb3tN1/w+33F3bN+24DNN7GWY0my29wSyOvBWv45rY/sRg4cSkYE2
tr3dSpOoM2gWHJmQ4YlecV10yGlY0ZdV+R6puab3W+fN7TG90SCMbGVHbu+mWZdOcE54+Z82i+Ap
a/A+SI0Z7+Wuevsi23h5L3NN+rNNrC+x3PUV5sK8S2vcn09tCXhidewlHf2MAtohte5G3UYDl4IC
GDFhupwKvppMe/IPLnicPfhRiAfO7ftZGn67Himeb6Dwg0Ry5yIrEvsWLc0jaNBFl721f8E63XpZ
Hef0jzDXX5Qka0MJe4uimLDxojMwpJlVzdKLS+PK2bBhV0qJaNlpJxNfFrAABKsWEa70VnlkAgz6
7tiX+Bv/8d1SgRLGulw5l1rCSmzKoncytN4uEDXMQNLzURJ3cSQu16D2/hqtn5t0BOnmxbgzvTQj
ejohM5sTWruPHPcGbdB222WS+QoQRAND7BNIDEBFqA7EZzI3IwdaYAgS/WGbzs7aMFRvnUYbSnbQ
9Vl0PMeKFQWe5De32wkEf4+VjO8Vk7ARRA2HBNWf3h4QwQh535ewmwu+7HvwZ32JgNWNLC4Zjn9U
ExNYPx11+69HkmdGH3jImkxM/8rSSmz70HpAAvCtUR4tgJ3l/KVprOE4J3k2tQr6Skf+9LssAgkC
/lHmmi2NOd01Mz40iN8SNRVnfp/+Hn/eaIK/2FbUeXZGCVBRz7nwYB+fEezjkJ7nvtlkIEkxcSUd
M7DrqdKCWk+PIGSUSJtrvdPYs8Lt4rQXBc2up5vqWXMplx0Ai+9B87jX9UFa23JaWaX7bBCpKysW
BDop0n4ZllgpVMHvU0BSOk/zJv/j0L8+PL/aD9g+rC7zZivnxu2ib3rtk1c1xz3ThibCFo6uZq8d
bmUU4xiQp0h8jYQ2FGhk5PByNeimgns5oz5b58r1Z9cupy2Qi3aRWpBoF4r6lhp/uB1se7+VBGQm
MWMZnlJbqAf4AOSGL4Swde5Rvld0uZ5fpLBDZZnvntoYWTkapowomeofsgR5Wr0/yW+TV1oYExGg
/CSIvFlBzkx1tTGpllyMdDlvuehDeb1E9AD5n3CLE7mgbKfy3qSwEhvbOLylKAx92M3uaOkw4ROI
MMzK0JoePsgSz8sBig+/6sIauO+B3K/IgdFq9RQBd3mwUuCSJl3cYRrDEZWw21T5OowjTHk6LxNk
dZEhPrI1Cp19EaCEFcuBIZxkQWYjQiwf6V9yan4cdjj2BQp7DXBb7zH0O+R5GWnjaMne7zll+FUJ
xlyMNQ1LwuQjHWZAp1GprFbWzhKRxqjJAZeNKcB8nspRlPXCCm+D34ITeH7V0ciq8BNJd459lW0O
gGsTbfjYXWqYNmNft7UBOLl3fM3T9JerBP4183ZBd2Jl/Lw9OZhLqB26EPGKIXySYJhY65S8s0t3
dDsO9DLv+LmH3eD6EIqcDPF6v8XdjEg7zE7onVsvD/yFwMXK4Wv5wg6fSGNg3a1/Be5FubZhJDh1
Q8SFWcH01rm68MV+3t7eRC2snsqj2DlqGM4J99MbFN2qog1jxsma0jsrLiH+YcvwOlipqGdN3LfV
cViwzelae+CPmeEdcabQ2ZlBES/HPDtFSiI+uuz0z2a1F/iLBTD4NlZD4+qnNAvLR8mjK71mI3FJ
9CV8vKIRiBUtYC9spP9XsoaFECA/6SWwyZZMElIuR4C891fIfBww0pWL/T+MBFGRSa43VvBETzyV
R6J8JKe8HCovR8bFJhrOdXvAqbH3c98OQ0xjXjVOArYcedq9rmZFD7w9tQ6RYH/pcBl6JcKShYQr
NNBREfSl77eoIyoumbECrfnusugstrz4jWiZ3V5N7NAYGTiRopp+PC+eoX37LB6kkTWtNgYG2GQz
eU/F3PUlgYzPpit7qA9YMPxk9jT+qNgiPeMRtLadJpbtD/izlXZUdE5WJpTlcMjdr5zjuEwYIFNd
A9F9PGrOaRmGFHCVDcVMj4GK2qrb7jOwu9eUbszwQlatMkzWN4v2MoulFEY8t5v7PuiELyTIHkDC
jp5xJckVYPYzupoiDeu3od+rP8Hx9DapU/nLOWW3/vWKsgJwo3NFxQNW37Woa4DXX0h/TJBd/Ncm
vcq+pvPs9UDGN+4CFobvssHPh6xRe3bfgTKVhxEHQccUhBJkBGyJd+6VaZ5FMPq8dPKrSj7ivqnh
OUa8PzX0ys1WxJqP2ZKVOW9UNDI62fozaFaxudd1ARMHRDbQlzfPUWVwylppS62DyZgtuK4jcC95
5rqVpfj1c0x36Eff1EyWwU4/vjtfEdM4TBlHvRiPaL9pdoBzM1uchAImngw24gpAtMnns7OZZi6T
UbwnelGqraZFwve/6nGJZbmUHHlyoMaybMCuTHtsONNm4DsZLhoArEKn/eYAjOdKEO6ToXl0mvkt
gn2CO9Fy+2oq0mB5UnCMJ68iKYwNAVI3tyHRJr+oslkbniyoMJm/Wr6w/bbDO0VlroVtgrs8/mSU
eWEIxS+mY90/lfmTTvvzxQArq4SMI+xvxW4Xm2Iexn1d0TPY7Mgb/wsljIzGHz8OC48UI4i7KIn7
gR8f0ruNf478e9l0/bUZpY/AseXMlNEsVD1F3nleygYLhukmg9vURIXoLc6MfJrPN9pDut8/U/AU
/Yx93Cza0nVIJsnA8Qm8YJ4NLk7cOhB+CsUqiDtBiQgqkUwNJLSHLQcmFiIRH+ZiusHa+IfZvHUg
IQ4ElcrU6/VmlwdB2X2xnHYeGnuGVp2Y1mqMESE256nJ9tbqlwxNZ5GgfpiNC6gl5k1QYEmvzCUd
B0cAJ2Wx/eMISb2V5OJwfN2ffHVsJl+zjZu/QhcE1Pvp/+sfju1Qr0MFPCJ2c9px4HrGXvPdb2XM
xnSnGd9s8Q1shIhYxGsJWeWSJSfzZdyrY5k6znArF6gHS3v3e06bRsp0FLG+Qi9H53dr3I1v4oOA
y03b1+Jf+GTapwgMZT0THUjjq+gF5HFC8778m4q8R8ZMwzeIfYdAJDTE1v6oLxQpvGGYv/qBJAUq
xWvJkG0w8l1Up9H5bs+QHcRmytKcouztovPATGV3bc83u/1GxSEaj//r3/PBL2mTWiRgKwuEBiJx
gQBCQlTYWgj9QbHAlAkE+QYgigHHcQRwHpAl1jMEqACAJFE4jr/IcnstrQdB0EP7v9N/Y30n0j6V
9IB8hvzB/h6FtlnA5rgv6jMG2gAbbmPMWYdt/yZNZ6DyHMGBF5BmHMeYQAAxn6IBlK0jhjPQf+uY
uQ+h5i23bAfIg+bfSfSgHzXzb5v+xh6D6FmP3T/JmPbQ23kG2BtvIP/cAAAlCoMan8P8Z/GAAHte
2AB/d/YACUAdjAVkAVjANlcIBcVhAUhAbiEQECSqULEXroHXqIwHCAIARwlAA07MfIcxByHkGg2w
GggGnfzZg5AHIcgRLTR+dvAAtrv3IYv+3+4aDp+n9d2yAadoAeF0EA9M/PB4XjsDY4bG6+AAB9oA
fbfbD+//9A/uADMO27YHIA5ByDbP+nu+2+rfc/VvVQAAAN+xu8v359+APIAFIA4hGo///9f4gS13
ALiALhsLhAjiAwBYWwBA4+hRQPCEYEAhyDiAWjQI8I80Eu4YAnQQTkUCfWMRx0AEJAA69W5cx6CA
afoOgBoIaDp2nafbAByH0PAyh7vWhdP/O6dx0X+XkHun+IdfAAJgBRIPC0UDYtEAIQIBMCOv2mjh
QbFDYvXwAA8Jx1YeF2N4T+TwhIC/0fqP1DiXEAA/9AAfcA+6AD+7/8/u/P/nP+/XEzi07Qe/NB/7
W3p2gh9v7gfbAAAbuRyNjd995AAChAdkAVocNicNiALisQBcQEEIGH+gHgLNFFhq/2XK9ZjR2mAn
ARoFt21ben21bWg2zbAZj5CAcg2zMH+G2gHSIBBbatkNB+0AA5D6BmLMffn+4W3/vbI/uOQgHIMw
+LByH/oAehZizAAP7AD+wH9wAD3QAANsAPQAANs5DtgbaAB6FtmYPQR/Yf//9gB/d/aAAYagcCEa
lK2mU2VyWKQgRyAQAsqiiDNQH4PYASAAhI5QTwHcCcCgTRoCEDoBLqCCcDIENBkCGA2BKADjiCcC
BREDYvu/IB9O+mfEfl35YPpT6T+wfNfS/N/SHyHyD+6n0wfIeFIoAGxqKRRYPC7H46DYnXw2MAbH
6+AbYABmPbf+nX4Jh80gkHnEE+4Ptf+n3R/f/f/b/Z//v7wB/aH9j+7+9/a/sf3n/4AcgzHtoBmP
MfINszF6HyH/pmD/HMPunIA9B23kGYMxByD/efhAAAAPC8EeEADo5nScve2csAHrfwe0ACVtQBsk
jsMisTiALiALhAgicQEWAAwAhb/QADjjOElAHu9A0fQCFhhKVRoIvHS4AUAzHmHMeYdsDMYZh5CG
27aHu3IMxZgAA+bAAB17r5FAOvfSH0r5r6U+a+lbH68AccBx0ABaQKLAHhfCdf2LscB/eA/uAf3A
P7AA/v/sf2faH/uAAGKAAPvzzecAD7zzAA4hGo/3+//twS1olVikNicNhcNjkIEcgEAEAKQaFXPq
B4UmAFpZgl5okUXAIokEshiCcCxwiCdCATwFCiUeE44D/ayD5p8T/snsw+RHyB+WHsj4l8S9l8SA
HDeEB/MH1HbP8eQgAD/KgW0HXWgf7d/9d5h5DmLJ5eQB/jyD2h63tB/1zHmHMIbbyAAB/cAP/3bO
QbZ/1DkABmAA5C/L5pDtw12xgvtqlJId223lNlVzzsuEUf1ji3FTHVlNX6b/uPq/zf0v1wPVe/AA
CoHS8LwzwugOgHT08wAB9r7gAKBx2txWGSWJx2NwgRxgUB/gGwpAlt3f1QPdccQqr101sscAX+G2
3bFt2xp9sW3bOnW1bWgf9ratkA23bdtf3gbb+e5BtofIf3U+Q/uv0/yH0nzT5r6T5v+7g/67b6Ft
nIOQZi90osHhNj7F8Lx0GxvC/2gf/5/f/eP7w+79o+0ADwmxdj9eDwnHQdfDwvhat1vB1jkrUdJ5
60ZRu3tmJHNSrtzNpVjdUT2I4sv+Fw7KRf93/+f2AAABUFc7n6XT4QB4Z0gAOCEalMW5yWWRWYCG
MCANIAICBfDocSJmrcdASXgbdF73JsOgr/of/QhUf+Z7ptn+AZiDY+x+QZg5DyAPdAzHmLkHIQzB
toch//X/4H/6P7f/4P7uv7G69sUNjehZizFmMAAOQbbmDkPIAzDtgZizBtuYPQ8w/5vd8xbZmD6Q
PpXzXzf9g/2R7L4n4l+WA5BmPMe2gGYOQ5j5DtmY8xhyHMWYuQZg5DyHMGYuQ+6ZhzHyDMHu+YiB
S+6+75jzFmL/qFaF93zD/kwAtAsDkO2/4chD/pmIPQswhtoByDMYcgDkOY8xch5AAAGYwzBmDMG2
AAX6NWpeWtUJRd7+SChAtDANDlNjkVhAMiApjAh/OQAQIPL2D0UI49ZxF9dX8/f3d3O38477vHeP
VO89U9UPiAAPpnyH0/04f2H6T6Q+mHyGYQ5CHIMxcgzHsfY3HQeE8J1/YvXttAMwcg2z/pmPMAf3
X+6h/dz5H6U+bfSPpPpfpAP8/oXuu27ZyDMGYwDMR/YD+xfSD6UfS/SgfNB9J9Kl2V4E9FUE/W73
uv/T/g9ZwCEalLXKSWKR2QEmIA0VaFYAD/3aFFgokBAFC0cBaICSAEUIJUIFBs44UiwvoH/TMIZg
8LRIP8OQ+g8g5BtvvQDsnMGYcw8gzDmDMAbHDr/XtjAGxw6+HX9t20OQbZmAf2J8382fNAfS/NfN
H0r5s8J4QPCbG2KAdeAKIAHX9icIDr+xvpAHzY/sD6U+k+b+l+b+lfT/3X6d9N8gP7uDbQ5BtnIf
8K2LQLMwUGUMxcIyiAWkAkgHXiUAHHAEAAtEHHQAHXvC8cARQDr4eEAPCh14PCh4TY3Xg4Txhxzx
hwnjAAAAAAAAAAH7k4gSYGs8nsbisQBsQKMRYAKZQP/WxwoLRB/gGYMwf9rY0+2rZ0HT7atvv8Ni
df8J9IHzb5r6QB9KP7B9I+a+b/sA+a+l/sJmLkIBtmYtsAADkPIMx5h2zkG2+gbbtoD+z+7+7+7/
9//n/6D/8f/v9+2h/05DtoBtm27Z/iHheOAAADwgeEAADYnhNieE6914PCgABsSiAbEAAANideAA
DwmxQB9q91ZpByEalM35wgsC+gAAcgFEg4UBBEAnIoEIcrMJBkPA4fu/+aiwde+pdJ5h/w91zB7p
/1zByDbcw5j2zbNt5BtvoOY9s2zkIbZtmYMw8gAMw7btobZmDbeQZgDbds5AG2Btm27ZmAAANsAN
s2zkG2AAcgzHtuYsx5iD0PkO2Zg5CHIMxcg5DyCgi5gDbdtAAAA90DbdtzHyAAzHtnIf8eQAAZhD
bOQ+hcgANtDYnhOvccBRINjh4WioBAANi+F69wgNiUQDYmxNi7F68AAAB4T0PMfIAzGAch2wAAA5
Btv9v///+j+7+w/tBIgW3SixgwAKDYAGxdjkAI2NmLbMxZi23MXvfeh74Peh2R1/YoBfr/fp4v89
X/GQSchNQg8GnM4g85nE5moBBoKE1A9mPy8AD5AHzR8182/sR/YvpQPmn0vzQf2P5v5s+lfhfkX5
E/IAAAAAAcKDrwB4TwpAACEgGxPCWijhQbE8L14AAOOA4VAAAAAcIAAAPCgHIRqP7/v5swEvbZXY
pDYpEAnCCAJYAkqiig/0BNACFjUE+wcoIZjIEkULQoEsRkCEAHC0CcBFFo6/lQHnX+//bMIZj23M
XIQAMw8gDkGYNs5CH04D5p9J80Pp/kPkXzb5r+wf2D5EHxI+IPiQ9n8T7P2R+XHsnyL5H5F8h9N9
N8h7oAAAByD3XMP+UNt2wOQ8dZgJa1ZgRf+v+AfN/2F/YvpBsTr/XrSARADr3hSIAUTIJAQBECNj
7FJAQTkSOv9eokAcIC0wUWAA2L18Pm/7H/Y/pf7AAAD2X5Y9mAPb/gh6/r+t/k+B64lbEAreAaDI
wDYpDYQI4QQHQAKcgfyAAm2ZQZoJ57Nd4ZxJEB6CAf5Mw8gDMOY9t2zMHIcx5izEGYtszHyDkPIQ
DMe2bbyHbQ2zMIByAA5DmLQNADQbY0Hkuf5Paue58B8g+b/sIfSvpQfSAde6914ADr2xKKBx0HhA
Dwgdf2L1/wnX/CbHAB/YfpPpD5v5vwlpo8LsXr3hNjcdB4UAtEHXwEZ+dVX3XDocIRqP7/+J8YEv
bXLYXCA5FYXDYpDYQWADg02VmQSAkgBOAgjA5QQwGQJAwBOhYJcQ2BHhGgojIE8BkCEDAUXA2KQR
AIABsaiAAAdf2N1/wvheFB4SiAWz1zbOnh9z7j7g+4+0fdAH/XMQAH9gPifiHxPs/+4/LPiHzQD6
VyDbeQAAeg5izD6FyDbAf3P7P7D+3MGYOQbbmIPQMCKSYXMGYcwZj5DxwBJAOvde2N4TY/hevAAA
H5Y9n/lfy34gAA5CAAAe67ZmPMG2gABOWIBWhzWECSQAyEAuEBCEEB7EUlylcqAB/PWwvHqXzuL/
57USRIIYihtoAGYcwZg5DmHMdt6fp+n/3/2n2h9v7p/f/c/s/933T7g+1mD3QA9AzAH04AfIgB8g
fTvpj6Q+aPpX9ifNf2L6T+wD+wgAeYADX9owcCEaj//+l/8BR25yWGSWOhSMFgf6AYCnlzKb35Ce
Mw2kCVJdW7jrGB6TuGgE7nYiYAEZACEAFpyPzun/nv+3DLEjSsbhmCglQE943MAZgAIPOYO8w8o8
3meYGY8rA3Y5Naenfzn9AAD5D/svpv+3/dv7t/dH90DGz4PRGYfyNgdvzjr85vwY2etUzxPF+/wA
ADGT3f7/qnRHZ09TzotwwzEy/2IWw5tlWwtpKVl2J/MditVr9RjfR86yHf8TuWzibvPNrYN33N3n
e/S+r+qd53vqh6r3g73vzvf853v1wd8S9iAVmdFhAVjkVCsINQFADzHZQABEcGVx6pIy43+efWW8
ifhgAcg9/IIfZc79HwvCc/RzHT0DmHT0c4dK2JZFEroJagvtQBp+gBoOg2yHIAAP+gB4T2+0wJvi
6R+X5B/jyF3nfHfPVe+AHqned580R4zCv122TmSgr27N90X/xM22kh96JmJjf7LJXH+bBRWRyEA/
+BBgAADgIRqP7/7vq3EtbQG4rFJbI4bC4QIowGBAkKggU+Kv8ARRQ6/xzUEeQYAhQASBmKJ7Rwkg
nA0BNEAhAAQADkm3C++97/jmP/DkO20HDzH6F7rtu2AGxgB/a/uD+1UJrB5JgXhmn+7Zh5B7pyEA
A+nfInyG76YD5v5r6Uf2H5r6R838182/sPzQAAFpA8L17wlpA6+AAGYAAAzDtmYMw5hzD6BtuY9s
zFmLkHHS+gf9dsDMdYiJRDhoGnVELIYv2e/bYAAD/2PtPtPtf+4/9vtgeFtJIBsW0xde46IA8KAA
APugAoCQHgAAACwErYgFZXRYgFIwDYZCAbCAbCC0AGiOSM10ADjpaAKThsyYX3bjsOgpN0B2wA5A
B/b/Y/tD/3+390D7j7X9p/bmPMYByHMfk1AmjjBoNAM04D4n4h7L/J+IB9IfS/NBtuYADkOY8xh7
tmHkG2/SD5r6UDfn6YNs5Bi3c+M91zAAAAad1GAW1bOg6eAacAAHIRqP7/d/lrEpdJPYnCDAAcQZ
mWCjkCcgBMCCVjiBHcQCAJBLAdQojwARkQCdjhBBFAmBHCA7F65DY/X6JB14LRRsbwmxLbtv/fTg
zBmPbMw5hzAG2hyENO/n/n20A5DyHkIByHbKALscNj0SDwtFo7VvZKHhOvAPmg+aH0/0wfTj6f5B
9P8j8iH93fT/IB7MPZflwPiQ/LnsviW2Zh5CG2BmPbf+n+IBmIIj5a8PMQ2Rsp4kJpAAevXAAEkA
rKA7JJLFJwDYZEBBGBANCOwLB7A2JaCAC07FEg2LaKJfq4Z4Tr4eE65/72yGgAFthbNs6AHyO/f9
KH5eH5Z2V773nZXvveESl9v/zB4TrwA/ID/fv7uB8gfTvkQfI/T/IfIgPkfpvkX03yP93+nfIf2P
5s/sB9KFIUIHr+23u46HB1/0LMIAHhdwAAPpQAATAAFxwCEalJ2sA2IBWST2FxAcQgQAIsACnsCA
AWgAhQ5wQ5AC0gEtxxAj4gARyCCO42FF5gkgHhSUBHXuOA8Lsbr1t6ftmY/QvdgzHtgZi5DyHbOQ
bbyEADr3hbQASQjhUWmCi0dfIooEkI44AiAAbF2L14A+mfIfTB9M+mD5H+7HyH0/07+6D5t9IPmv
pwH93fTD+6/3cfTPkTkO2bYG27btn+P/UNs5AH+L+3+1/eAPaAB7YBUlLNK7GAbC47C4QDYQKIwE
IwEQLKAHwfQADhQdeC0EUUjYpFEDwgcdgH04fl3zf9jfN/2D6QAD5E/uoGYAAMxehZiyYz/DMNaF
5D7v6F/iAAABtgf9AzB/d/ef2h/YAB/d/b/af35i23kO2BmLMWYuQ8gAB/d/Y/u/uAP8ocg5DmHM
QAAbaAAUoACsUwSEQABwIRqUjbnHY3DYnJYpCBCC4wEIgALgoAWe37qBwgCIAE9BQI9AwBBEAjuO
QEe4YAjkMQS57wKzs9ZyOFh/9v+/X+Og8LaQPCcICzxaB/30/QNAAAzH/jtnINtzCB/a/vf/oAAA
8JxwH+ati5OLttbM/z7ZtuYswAH9w/tAGYg5BtvIPQNs/6BmDbAAH94D/+f3/3/3f3h/cAf/j+z+
/+4//h/Z/d//nuocgAP8+Y8xZgzB/0DMO25grQvu2TS+hZg9BzBmLbA5DtgfSgABGKRp19+Hm8gQ
nyoB98HlsffEAPMHogVAAJOzOShyWxAGxOKxANwgMguQBgKHUFAInt/NUAeFtEHXvCcckUAXbADk
Pu3/8fd+4L+7v77ntp2jafQ9V9B6AD6f6YPZ+y+I9kD/e7FosBEANikQA69wgA2JsYNidfDr/Xg8
KHX8xbbtv+G2chAB90AA+6DMAbaAAH+AByEADkG2ByHbf+gAD7/y+cADA51fqOyL+I9p64P4j2lH
lDzvOebyg8wG7YgAGwHAAAAVNUGa8E3hD/JlMAIR/+fwM+K/xiAfSbMsW1Lk5kVSTdjZDslxA0oi
aMFxG1Meu3X5xAXvix7LyFKCNgsylDSGtr4tOoMc53/oBt+59nu8DjYrVudwYFpoJCpUGTeVGe2W
SyAXCpzEvwPu4tZX8/lUIVqC4kmv9VJx5ZcB3u3tIw5bzvbcEym6lLtpDuVlw8eT4WNy+5fnGdAk
Q5+7PFc5BqKYCK4C2/2g4n3DeRHioyFKnvx1pPgWBxZlZIqgUtdumJrL34r1S4UgMZ65UYAy/I7q
4QymzhmsHVPYAmLt5ZCYZ5+aq8vDomQ3uX9j6CboiZnUntFoa57FObA/lSG4TsXmB+8vLvaZwJJR
y80xY47BNsiXnOJ+I5zVyQogAP5hlFUUSfBbs0JjcVwyz7hrXHz7EYH1C5TX09eWwKfuXDI/TupS
MI1oWfgzdhanw2ZD/0O2Y3WhDuOcoIINxC4ik0ZXzZE1cNASLtf1d6Lkud+xMwp2FFCvTTsH2VOq
+Jssavegucwp7ynLDFPj8zGUpyECfeI0j1Emh/9rXb/pHKq7/4pNrBXCuC+EuB5/dfLz9M7dGZXz
c/QcimSPmauhLpLxvh196V6OAJp8hpFZpS4KzGCYnRaQ9lA5TH0U1xXWb0dM9S3ffDPJj+WSHeM2
4T1ZHgvEXLMtr9QOZLZvenp8E9JFze1V59tGNDchSkFEyaHb278LyikOkRJ2EheP8G6JfYhOusgy
1GIfiiZOHkzqzUnehN2jv/BXfVxl+PyWRFPuWTWkJPlxAxqhkNoQhSfMy6cKZ8PRBub3UILY/Wit
zvve8l2Sa+4fWUicruFNRe8oYQXlTUR4Uz2T3aoEgl45KwEdv1AJu/HdJYsYif0eUJVv5tJ3xj2f
Ymp0Ht0dCDJPvthaDBudVHrkCJm6CtUqM5ntHY61peEa0J/3IYNpFXjmfHCGRYhIqnCj2aGFbVmr
fsLKOJcV4yEAdbzhBcCGIEh+txZd5/3w4jWQ3jl8VrTb/eJez+0th/2ExBjdVm+yVCtA209KuKn1
MVa5olJVbdbVmLcKmScafNnG6IsvC8oXIksPMp71LPraaT5arfYzAZy9wIyr9/24MsHfJ0X0da0B
F7b5wN0Tzbgg7/H1EMXRY/IwWS/kh7C1IcvBS+/VWBZVA61L2+/PzyzDV8x/KQozHPCdpbUqvPN7
b/4Ir+jjFCpiC32ThKzURKeGJzGJqayu/ZFipNc9XVrB3KUBy9DGLSeBuZcgM8aZnezRG3j5n/7G
l9WWfDM6/NMdf1SJveFkjoWLU/T4PdWl2kdGZkr3wboacLFMcX8svEZ5rnS5/3C+T3g3ThiMA5o7
UkKW6PCKttfmN5sgLXCdL9N9ETmF8yQG2O2PMKJcQcCvX5VeDAQF8hFNTp5TCPkhuzitmj43jIah
RNBRpoIdxrqOD4WKnoAOZQ9bC0uDvFEc9WaQmV9znHkyZ2dTSBRHbpzwf6l6a7nowLe2bw0dwdHe
dDl3ZAuDomBvK/lXTLxbwmwrVT8Jw5ithh2xsFPMV8K4dopP+OOqrODn3RR6RrD+lcu/sj/vJHEU
xiVV96883XE0oA+1X/4WM23N/hLDL0WWZR44n3gC4uC52/3WucqwwMeaiEZdsVyNkHi4ZA2EHM3A
Owajp2iRRIaNzKsyBX8DaVfUBqd+R29tnySjpqgJH4Wcf6nuFt1DbwSMMjW0WoEqt93wzBZsy6AD
qRpgHUEnxMufSis7QngcuLVu2/eSCwr695+2HpDON1aL3RKBUlVlcqNVBVLm1Hi90F8Iv1Yd+3fc
T8UXjwzu00QBuDIXKkLyjPLMUuS96MEZsKoe3xNdTebMrt8QCTPxyS7Ts3KwnlHQO1LWvEPud95J
yX8GWKeUeUWjKnElfiBpbpD+gBWiCLTjLNMm6vgU4GsDCjJn7/hbNE3qlD9Qg2fxvMlrZzTbEWN+
WOntaKan3dILZ6rM+NmKKPXdF57IbGV9PmsBfPiY3mcPvFhu3SqbiZ6UDnrRwvP2GJkOdWs5+Rd7
xEteowaVgdP0suPC+Jh8Zg+Qmxx8P6yFE9UyaA5Io5qVTiAmdiFwr1lOnsrjYLNiVrPoZOUfTQD0
m10dDRtD58Yhf6ADa9w/pOemuElsaoT1Xcwp9k93S1t3YhsKSfrdaj0h52BQ51v0StnBfpAGGFXK
BzSqlZGRENYyuf449GvGSEQ1M/oNp7ADqNx74Z2vkdRQls7r8T/epeJ1t4jNofJPdyVctys1dEGF
Y9F6/5yZhfAHGRmrZ1sGlaAPHTdKxrO5lTOt3UTku5aLwgMH0W+X21xiuljjiyTWiDq67p+dbiMF
cZgDGI3mPeV/O+JL1SbONjOZkdNlFJ46ZnVPYMChncifrZTKYOpsrIW9El3kaKYONp2wqCc+h8DT
27eOcIHufiMhmSKSGSRU5i+6gA0VZH0R2XMhoy7EvEdijSXE+324Q47LvdZSLhacGYsDwkWO9GTP
qOwf1e0DeuQnS6d4FohHoAoKv1UD9C//tGV+ZlVf0V9fcynxwAzu2Uo0k/MiTeE4Wd7WaopSIdwm
iGpcuW8l05YN8vlXLakdNL6TsbDSKTcx5w3ZIfasSq6wgkhPHzceCHr38NkU6T0OGkFT3Xg4o5Bl
eDl2t39pze8IFLc/FRmORptmb81YlutbLSul/6NsGlmBLkSyJTaz4BUMhrnCLN9GTNWQaBvolFus
+svb6o7RJPsQK0AQc4tRJyH9jPM9GuB78jjg1+OV3URwZ+VzS35pDAPVvFLg6nNB89Sm37J3/6WY
k3uOQtClEZaGB06G8OraH4yHqkMvr/8dj7Lul1gooSR72ji4yP3M83oB5T00ysgpxzT9Lrbnhb/O
5IWgAHe/ofN1b6SEa3LgDCPMZ/Wqu5YR7joDDvijYRtvTMsr3psJFX3pllD9CvQ1IUSatZyr5Cfm
EodAFe8j4JPLaf/2Y+2KHF2U3V3qcHUAhqpUdByt9fbPOaedj1Vgy9cgZIiB1Jx464OjNpb/sl7W
3SJqKNZxmDUWEpUBYyTXwSlKTdjbOBy8q4egOrHA3PkDtB4CwSMj9zW6boLbDlQ5rWwIY/mbjt+w
wYQtbkFHk39MZ9ShAsvhQCCg1pDUquKzKilRzfQDGVcLfxCWdONx+uiyiVgiUsrvcRMNwjHv9ZWo
bJ39xudMgdYLDcZ7kkk2EcwEkk12dYrCoILzlI6G7BDUxQMxNSnDKT6UAAEdzPsYfL61HY1s4tWS
RX6U9UoOZ6l9wGasCqlG3jt2e28Evb9Qskv3EBkKDGSauhEIiyy3wiMpK3HRO56n6b8qDBfahejQ
SYO6hQJgEZ1qhr/9Eq6iG9OMoZz/HD7eURPnKuw+HjoNgDxUVc/4iGArKVjMduAlpcAI/zKvYwXD
jAWzRPogW2ykSd0o6LI+72ld88iPTPcFRz8EA1pHoPE3imRYpDGWQ3XuzVINvXZv2M4VlWFqfXi2
lwWBCObJde/ddmCruAxYvT/3C9MZgMwNkids370JBd42lhYe0Zrm798kI+YfUlw6nB3GW1cR85GM
UGO4JHfUBqShka7RwsPnZmqdsVVZgG3WbcpLLlt1MdqH2rVRgtGbgwgbxVYB6y0voDO/6m32WaMW
60ls6rmKd/Zu+gZt8VT7kL0gb+FXoOheRtQpTZBn8O/PgEYklB3xWYPMZDVQ2x4c+ac8SiQ7v1VM
huOaKAVc0Lm1HPEDhRY5f0WyDljMEePSSCI1Vyoa2dmndyYKUwODP+KDss9mxOjXiuZPn3PQ+6bH
t4HjPydC3DhvFVjt8nbXdTlWm0SH5oC44CqGwbRNPH42lXaaCJ/qPNue0A10Z4px0JOL/tEnUwdh
hlwbpS6Nvm2cWYRkFVy9LhVdGvG33fkhapK1wuIcU2GJgtwFpSuGIy0PrBFrleBmjhYZ/yy72YzH
Jj94yRRvYIjK0fNGeafIwW1LAp14SSU6gkSiHfbnzq2/yq7CSZL9t5XtvM3UpDK2ypggfKpsRt2t
ndiYOnYmYCkvP9DUW3d9UKtGEv4Hc578Pq7OlFSzQm2uN53FdHm9K1L0kGeL/z8xcvyBGZDnAJhT
BEEnSPU2XuZjQw1OzwCG1EiLDZHKWES4bQ/nLlz1jFOH7yjV0hws5HjipShtVDwdFlmESNJa/0iG
zc2cZYvReErBC/rs5Z7VBmXQNaohlTQU2mheKeX6+lXtDNS9sJ3dnzDyFTAvEt99Tmxllj7IbHRl
Kiez+CzE9xoSJIfYY7atHi99aP76GnXgMcZKLkCAZ1j8yxAlGX5s4BTfel9LbiDh+AxQ4/iSe9qU
1hI9uqJcHRQucJdZKjyc2FRgqgpv5cqWAzLrMYLl5aRcQNi2LiH2j0IcLhOA71IZsNYL+xn/TAgN
tCj44BkJ7Zls0WTwu+VTiL/tfj60J1uLUZpz21vATYnhoV87BPqbMp1K3WSOI+VgGwAjmisYywF2
b+uRpMxCv+/ODZ2ydt6ma+3jfvfguQNWYokGSnf5Li10mCGx1hqyDP22bod5Elg6JWTZy3eWq+Vc
h+vRYYz2ql6sZSbKE5O2aWgk82LtRSC9yCCVR4CIVA/TmMyYaNaq4Q+XGYNzEwpz+/cXX3vukUh+
ADTD6q2BY65f2caq/B9boR26yevoNr7+Xkbg//RLRvEs0RS4jpHS0mGMhqE0I9zF9H5RuWY/g681
fp8cd7Q6H3UaT3zBJs9Gc6VW2y19SAjag3WLzrAsUH/eFRFdrQ9NC7sF7Yoj3SKfauq73aoLDwSZ
YFItjHsLVmeRag/wi+UuCg3TNVOYIktW3kFMOD6i7ZovEXYcZiFPSExHdtnsBK/d6/GovJtl75lv
abzZk47rZnOz/6ouWUNr/ck3Db7qRYTwifMNy8fy65KLJUYtz8u4bvU0SWVkl3sEeuCtDyD6WCUm
8uXRlrJK8yoEQbRjaCftik11HyxYg5MBQYdz/RP7LzuwTsSVVSOz2QbelBRrTfpNXUSXujoVOXG6
01AasYnZPZ2yNfL18RljZqlqjPta1kFy4J8EzxdqtcZUHnKpfU6NL9XudCBtgPXhiqbSNM6zgAuf
xIvuu5rJl7PCY1l4NlNiqSxDViWjGH5SSrzHhB5yWnTp1xWFMpnWKeejUIjeREXSq2qsFuQqK2fq
I9Fggy11lvnNiencuvzWeXq685OappaHNdXgd6CKRYhG/HRvD8ClrCpmY8gb0igJi1mK9qd7TWdz
CZY4TqfaGphSGUf+x4A+GtvhpovDv8Sj4oOPqnRbu859F1NidgH1dft+PnDPMRKhJonqNOx8zXjR
DEEzxvO97GKEbYKH5RLTmGHspAyeEYhwt/nnB6l003646JAgS+bSCZfNh0odod5yBPQ3x8FK70un
dVKK1oCImLoOc9Rdf9P8h51wVfSg9Ji3a/rWohnhEN6N3rEn2bLOW2rkOBT7GV3sXvCLI1lSDiJi
aYBVBp7SpAIJixy4VwUjz12tr/GAzxlxxb4ayjCkK/SsZoVQG72AppBO2P8SHngDsXiQo1s4WDKB
qFmLiLX/AMZ1BVIimvmMxZr7lcCZ2rjhycQhMphyX3MnTaWXEQ8nJVArGqTxB5jDTCXdd7z9YpVW
u5a0gWvU5a7TZHdYKwRL38ze3s2ZrxQskGAlLeEiiJEjCJtBC+hMtTQmP5FX+G5bsrl90gIbtu34
iK4Mav7W2+FiMPrxD4ro/aHYOI+v8uKrrrff5wtmZbgGPsaRH/m4zYLIvtCC7iKRCSsa/KHd1rFW
GbbpRxWxMuTZzEIod2pucgdTrs4lUvAwrFII0iwV9GBHOFmH38V0Lr+71U5R1HPx1DpMrOpG0I9w
cx0xlzH4JYFfKm8/cymaf5qlwERDSeSFlAWH8q+4WIEFL6sl4GWAZLF4ggafxlaGWoRubVgK+UAv
bEniMcuRIM0Dq9XzqupMrD+LzAk+VDpT5lMLW/M8DGj+Gkaeu2wd2xVe1+BWora6DIQ6s7F9riO2
RByv32AIuCcGUbYmkVnom1Tu/hW7hn87eH33lfn1WMn9EVwO+InXrLJxftS+0Nf8rkQtaFfFn/H7
w5GheIhhKFIL+NXTG69frQYvujWD4MfwnMUG9+cnH18LPaMJPimiG3pmcH61QdFQBc+mmN3xmSll
hfJr7F/PRru2lg2b3e7Jih+Lpsdet1g8ce/THpDxicHMMNGC2/O1vysLCcCHECn/qNDD6zFRot0o
Aj8QgM4fwcu6k3/P/uMeYGfljGLGBJrD4Q5lyg959z0++pI36QB+IDRLNHxDA+Dx3POtLOp0NFQb
Ogp6KgP2QtvWYaqUdW+CdYj+ev0yFLDJXxKk0yBsaEyp3KHHGRp0EItrgxZazZ6e3+Sb4ZRo6p7v
kSTbdAnrMdndYF6c+if5hF5vkftzeJeeztzB+MNn16sLGco/N33sDjVRh6tFBd2tlbjCIi/WjQCO
WDnT0/hY1LHWzdKnBDKS1kBjHCbY/+PCjwa60eiIbLFDBQgeT9oDdcs5nRxmRay1s6MrGJLBCMDG
1wrhzqmbru+B80s/CuuzYLP+Cs8cUj1OLrXBoSL9B3BV7inXngZtAEr0rO8b7DTdgjE7BPLufTce
itYeERGqiyq678I8DJHEpJpPez9yEW1EgM24qw054nqXzCEhzXDX9+RclYr7zULC2v1iOxU4J9NQ
nvJuP9ON8v175xk9XVQawsZ0sXY2hu5/yAfjxrbaxKZQ/hx65HArN1U6UWqt2RY1uRQU3dRhQMgV
AnsssMWXowvswtOSmHDmw5U0IVITXYrgHknpUzGQRNhqHDzgDXlR5geul7nQsy7BX7t2+8+jVOMe
Q7f927nv9XgjcTf4f5PIh3jvDbQQi95j5pvpN7Kr8whXT66745uNaN6n6jXVxbg2Pv9A8i3CNkU7
E1xBzpUGLoA+3B7No1K9CwDwXM6VMIMgy3d3B/VD2r5R7n7+pExTNRppnK0Ec58XMrYpYYD6GAw6
fkQBpCQ9jWuMDLGDcJMdp1c9Em5v+8cDvASaWqqhkxow589qThbALqCmAkWNp3zIRNVPjKMFXNyb
Cqq4wNcqrhbfzIR+I1vW3MXwoXySSZA1PTiAfzdsuctMfK7cmNkDMiHa7H31dj8l8Oa0nRO5bcuU
MGwQB8VkGsEHCDdL4z6m1WAvzVp+IMDmL/wVoE/f1AoVCGrB1T2ltFugw6FIZwnnH+WICKNu/liL
cFrS18I7xSL6fPUrRtAuiwqxChLrr0RDJd9fb4qBBY4zAAAKeUGbEU3hD/JlMAIR//TK3qnYM0ht
+b4ZcEq2E2qnf0zWSiehZDXZnJ+VVjmAyI1G9kNbesX5z0GaJ9b2+fM2wT/iMWx09bG2pYfuRxZz
d4LSoXpKR2V9rrBdzDQ3kA0rCJsiflZHPxgFBaekHHjC5MnJoX6JJEx4dy/knE9vhXmlQtU2evwj
7gnzYrcRSPl3swxKcPxYXcBvNTnukdlLz7Yusl45AydPVXIwgh04uKbX329NpL0BW6JkS8yGEK29
G65YG6ro9TUoypF8HPMaAzM/F1lBUebyUQpSyk+DnBEQgd4d/IgJWBfDjWxb0TdW+wdgByg9LhPv
oHx79LHDozPC9i+aTI3pPxbm7k2Cx7TOjN6Vf4sFLLIJ9VxVFbFJVAm9MmAQ25zUFYSmYzfgQz2i
oetE4bPD6TlYPmtF5GBO8ZH04DFGqc/1H7sp9UDqrfK70tEU9tRdrLnk9J94WYviJM1Wk24eiUg4
g6268EL95GQ+0NqcsRYSpHvfTxjGzCRQ6oHGfVuNbG24BFAs8XXEfzajvtywT/K04KcXQJg9aqSJ
0rIavcBZFd8XQqR3z9quK7Wh8TKJCq7J6tGcQn0FBnMTFWohcgEKNkeNrheox4c7VWv6/7qs74s7
webWeiBQC9kXw7b3Fez8j+NlXOCaDJfRSNlsTFGAvTRmNBPcmEPKTwKQBLJeuTaAUna5YBUFAErw
VqUJceTQU6koaUKxgJzFi4yNX8ZdpJ9CJahO99zYtx0p+rBC7THguYsAjgIXDR5bXwwLBPrRzruK
qRYvFbC7S1KMM61fqkn5Z/QzFYwYKUNRMwlW5VJTx75SVVJYofhtZlO6LbL3c+xlCptdfsyNgI1X
8NdolzIT3S4BUfpUBxJorN/Q7jvL4ZySE11VhPCzF3p18zDjqphKsTJRMAASE2R39a6RM38sB9ry
35psqbusPJvOBPi8FwxuzTV1rOlvN86ZkDe5KFfVgSjdfI+CjfEJnPuhiRbPLvsMK5PBEYueFgma
lLmBOoMf5p1MrXRUYXl4a+9zjvXo/f7wSHRa7xgxMILAxSx8h+T7Al2YgWi+a3tqpebPrQiUs0Qj
Kbed8m50piQuuEm5fwf3RJX9XzZgMXbIay73xzMu2zV7JbOjRre+23gV2B6cpX28s/qkv9QJLf3k
GPNUwMcusMP1vnyFKVvgo0PrY/hnyA36CHCDULRQC1ZBHstgMn35QEuNSpFc5IIIInfcHyVxtzaK
L+MO6jOI2mcxXgDXyMXNVEkTuSnFElqASEWPwi7A2UMCDyq9n1ldPIOS1as6p0HGdsh7SRERknz+
fgCo706jrsqYhJ3J/D/cAcWLZtGTFWVC1eqxB0h15U6v2LEHUjlp7PfVR5seBzv442+onxnTF3f9
EprRA7IN+96imCC5zC1c61uOCSP2GrkRGbZAvUwhICcWjYfM/1BucTy0XNtc/Dr65zvPEYFdP2yg
Tb9lK+nhavYlAXlu9EE3C0cigkT5vQSVF2kk24ChHmziCQIUhZp+yxML5QrZyR4amppgMms+UzhN
+h0CcEWtbTTa4APmsXPg3UzHHhdY38qTl/BrjQdQeBfnHX59KxCJSRwGGe16lG9CNT2Bubq2haPt
fe0qFG9Kquj5CX3tPcOKq/GcREKwTiOJh3/fVKZLCuvbg5bpOzZvN3tpY6ZJtn/DRXC3sT8UGVUZ
YSbTFm94Qn6QswzsaTuyyWxLNFOv8JCcauB1ToV3t0bIR+cl2zEvyC6HEibDwo37N9+EEnixuuG9
EdVIj50TgZZht0IWEhoTeIGXTwygLfuwZYoS6bM/a4pJJNMeWh1FxgRYg3zwxrHyM0EMdrtKoA4s
TCxLrXSwFbW7NUghsZAmDGkbIOLYx47zt2sOy1WVN/tcG3iK/GQ4a8M6BQ/t5nMbSEFaJBDYh69N
G3KcoKZ7MEYZYAvUfIGpt4Cdsoepr9Mwog89rx5FjtNodn9/uq+/KgTZoEqRUTJV1Sa0dXnPHlEt
wccxksQq1OtMipWkoHbzVo1W4cb5HaTgbC640UKJ8lBcKKBpA6PbjULlaNhQLXKDT0pQUSlScpJp
eTI9Vr35mQ30FtWQt0qTKooJOaIkTOz0glt/NviXscNcAGtQIgoZAdAb5+QHNgjRPWEzmimsxFm4
DrMsOqrDbrKgq+DB9DtgWDGrQAfZsCbO02keF1W/20+9Cop8WpGc79prv5WEhg1wJ754BwBUT74X
GXr3UuAO/aFqPAbSzkAAT1olMbxBdCmyxhT8awOaDfhByY7Or9rFezsUNK54pI76xnp9MM7aDS5B
b5gmvYrK1rAYRw/KXfxhUYeYgODZM/EpssTjiUrNO2KzmRFKSmFHU+sWAG5nvbyG2BrsH1gPZD1L
wSrVOTy9Y4I5e6g/YYcyyum8sXiCsM78wdN05smOzxYG31s26MDsD/c/rJrX4ku3au/R9t6BsqO2
Xl+AU+BmJ+MwU0cdGQMZP9m1RQSeXEZf+215eMiPFGwvJh81gvfgQXPeqFlfT9XbofpfNUrofwlE
SLf/YpIAjKNe+izEWqv1y9PKV3CDQMa5xB6XVmI6J2q44EcNBgsGdZ6DPl57HuZmmGjQm3JTBhu/
RVH0bEWBXgSOAV9YyHeAknTapbPmZ/WPbdy9hbAzd8QPOxfIyzrJAIq4DFrw5xlXtXWPtB8Zzv4A
2nY8YUUsRxIyDUWP//iGHm1W02VOMSAKnssRJc+ILVmZLKWMeSlC82JfUJug3o2g2PwpN+MtTFXs
L9uffEAa7sgeh0UkqxeEjnwu9uarwBvDQHnb04a6g/UkRKtWKfAAbKBdYOp/FkY9QBMnx3jCfASE
CdlqEjL2FB78qkZTcakgKKOF5xD3SLonEUS5YlE7WPV0WMk3A9aTRU5P3ThgUU0v+Acz10HNlJ3E
SlloLeGML7rt7l0OO1Haw6kiIOqBG3+Dht7rsqrp+eU35/ROCZAYRYo4XZjdIpY9hKV47ISv9mun
wxwzbpawcJ7y6a+5w6tLt8osc1tNFukOPBIIb1Y9W9O/W8MxSqileVNiHDu8fn99sWck/NupSCiV
RQTueYscjKGivMTGrGEDSLF9U+OjoWvTahYD/Uba94JGRobpEcsHQF+4q5+PqXMXVseeGFDSO1VB
EU4X12njYN/ZsA4vi9tzXdDLLzBL1A7+HVoyq3Oo7DD0uL3KgebBVFDejzCrm3Uc/5PbkPCiVxbA
+PVZEZQJecfLXsIU5B7oBH47675sYvCKduMJEHM360uK6mATNuVJec81SbijwZZTwzun9IF8ZOUc
gGpdDrre9lzTV9VQ+/fQK9fq3X/KBuPEuYGagKT03j1snQnkznLYsrKXVyJ/ULtkmQKiFHlS28Nd
+PCqSEoU5XbWFjS6aEwLI/c/Zz8EqxsqfxHF1INQbdJD2BPHxQOZwRwpYvOYZjoim11ruQGD+PgM
vVB6tp3nUmlImXNR9imZopBk0jj+IFB7sRLpxB24puT2L1WL6CjPO9Rt1qai26c/S89H/wvCuCof
5e8PpPeQpkT+QSz0DU93ZDgjjzNDTF/+VN9Y58utJcrOrDnSTmzDAAAI1EGbMk3hD/JlMAI3/8pL
lnGbATu4r2vktJwsNA03qUVxOphpe3Y6JeI2AqVBy9POfBQsHphjLCMOCzZOTL5+aT0wnRoN44Ur
90syxg2+er6xW8NDAM2atKofdvdiPZ1XR8iwOv+lXfo3obEppcSroJWRZkn/PoBvI/7idKFM6GvN
aCeX0MHTJ1pv1K3poNrxiQJyByhTAjrDo28Wp32tKUCAuMyDbvdWOAtoerrg355tMbWHvQT5aSmZ
PMBnHytCCGLo1dBClKhVr1mg+iY71I/I8eqUTPadeXPuifmsL1rS2pggcm8ziDma+PvMkcNNXa0b
jU1LM2NbLoVZYzCwTPdeHnF3Gu7Fx+Zxc9WrBYwWeD9GgaToBwncAE35Ieu5I1Wp2VBW1PuDlvNK
ALI1S5sdaWRbk99+cZ7PpoUqlg7vR0EW6kKwsV65MwlmEk2/aD1GnYqzvn96WbZwfdC5VYtKgfkK
BxAhq9nekgkFcCjAdUudgUbZBGJqLya3KvJnMmgmQqBO+hAdjOVXP4f2HoV8hCxS5ZgrmPkShCAL
50KHeIonBCTxu1VExKdKRwITvpOJbb0gbUrQaieZYSviQWIJPywY+1C8KWgY+DsnhQ/wzTWWzCO7
0lqWxyAcvUl6b1hjLUitHceTTdnQHRydwlNlH9JhZ5RL5RDlo+K6LqVHwHNGhKCYQ7Iu6MukDoFJ
c0g+kRchm373eS1EWUopxz9H94FOV4+NJvRf4Sf/WlJX+rTMqlRHovDeIYQz3KWj/7rHFZQnckeC
hljrvYi5Ls4PDIiyqFb+f60zOwkxmjwUVEqIaJ403ordmstmv5PBrDo6f+08shvAFiXyx4k/ZUVQ
vCSEegcEWM34L9XdqlcXKQCjzvgAiJVuVTzCmcknTFNt7BBUylIPy24vtrFAWeuIB16Djk7crj6j
MlueQzn/HGczHe5ywtc5bickyJslJmhJnJa3EfBA4s9o/ZI0CrAmVj9Fal+sVYrQGj7kL4yyvXvX
GZcS5hdAmSUdDsReNMCKU8+D1ym1uyz3TiP//aVEX1VaYtqFFRrQZvtAleVQDu0Lo3/qpdQPTC3s
mmTIZl1sD6N1xj/PLXqKNSQDdSblpRrnE4hMyewgfUQkwX9jqopTwMaVZ6ZTNYp9D+dJTChWTNdc
ejGOz8pQlj798sWB0vK/gLOujK6AlGfPfExCdKLO9beXzzkEYzeggXMN0x0sEWjN75uoW6VIopL0
II7zqkdSG/1RCwck0Rrq4/SjKreaW8rNxVH76zbQCBQA9YZKvt9cRkEhniFjVbH1yYnyv8WKOoDs
CxnEu+A++tp6bDmlCE1nEg4XcQKYbzYQKi3QDkzX3qyMoI3K+mCDMJUp6jf/npEkyhTAXbXJWS4t
Mez5zp5JIZQW0Uce8qhpYCjaQJz4z6T8t36HPQMp3svoc5gS9M9SNQpBCFMrDAXNMNKC9YQz14hH
l8mw9AOAGtUYzFEijY1S33ZgUXesXvISSKEnxq1Ms6md0UEMAr5KUJDtYlw/WHoeAgytPgIxvolm
IBemLsoFstlFXTwgWn8/TwlXMqh1n7oSMbe/Bxx4IaOaPQvooTUNNcvnRVBTsfMsM6bKT+qoJgAN
FxG0TmhLTl2NBtxyjtxKlw+jDicox+ZYMwafPQv5LTZAh9PXT/ruu8nnlInMw43DTUmV2TTnizFy
eT5st5gA78Ka8VEiZrbEHBJxOqwRa+1Cxmalx0WVN5ZT+RJQubuVzayWtLp8AjTJInu5Gx7tb+eG
y7JUCzpHWDK/wdbGXu816111Fj4qvHltjaFeV/pxRj6dwtlotT4uxlt9dhtjR9EQSFqcW4/NvXTy
WMe0//7NgcBiqLKZAcJFjXhIbFKjPIbHemuCAZs/deXbQfItbP3OpX9wD2Nl7tRFGoyjLLY0RwtO
MHnX/nnlWYW6zOBpM/BSUpTBxTT8uNNOgzmaKz1bhApVmFZEMM6fWct7+3YWxSDJQcSq6GvueDP2
4heTOFxwsSj9GAvbY45uU4Wvsie4rDRAydZ7NRVTRGkZ0K5evjPTC7TEz5kf79dg8tMtalP7SHdu
L6jYtVA9a8rw9qP1upCynbSc8rJ9EWzZIoo8dzxGetn2xntHjxEGAQNCpCRhxLLBNtlVwFGsYggT
XbmBWQhfm+8XBv7/6mRopICUuZyFjJwyqkesK+cNmaOHqV+ZPinFGwiXe3gF06JY09B5YVfY5n//
QxCqHKOTJ4YIS3/MaJeQBPIZUTv4ZR+/wSeTTa4LQjvwcZB1sIiLygQsUgV5ZOqDe47ypvyjx2+U
r56UAOfBlXdvCNnlsTOUtFkcSzbhnMa+LDhjr910j5hEOaKLF47Xr0n+IdFsCmZ0AIMlHuxe3Fk8
7xrgxwvle1BRx3hwTuWPSUFbSs47qRQaThxNwCNYUsGWkdFLEYhyW7X9ArKTIhqlA+c9fAA70UzK
EQGbZO3DC9nmszJKAecZTTHZ9QNObqqEFEkCB8KNC3GM3FFWhVo8qq21XnxALVdVl+D7GDZFQ09H
34gXS1vWTFHHN7qd2Y+cJ2Z2rIywMFPDK8bL7bK+7QpOFA/mYGBsZYV6B6UxaX4R+afB7fXv5qeV
knvyV6f00HCwjyQmMg3K9xoVUl6oEQUsqrrxML6mzedOJ0Bj397nfQFZZvaLT93CP2ivSRUv7Wfr
2YbIBHNlxN2ItgRBWXQrqZ2iT+gsIR+Pk9y+ibCujODGMd7Xn3IMXYaWJ/9lk+QIiWyOFGrdrOE8
HhmaGamp+P+FcM3GHdFyZq9r3qK4QhSCFaNF763aV+dN5Oeg7US0Cs9AsuyyA8cdM9qc1ZK0zNK6
lzPpF+lUuzee3kHSwLa83bJB37Xfgi5yjQ1Hngsbp2fPp6xKXQzlL6yyAATVsgvV//bCIhG7+guV
2+mI5ZM0M/E3y3iAZKrnJu7fh98rmB1VlAlfJcqvyur8xE429KVGmVymf6cHqRk6P6G9yWThwvIu
kzk1SnPkvR1w08gKFphW01Y+UKUQdC0AAA3HQZtTTeEP8mUwAj//6DCfNaIoMS76gYvCbayvaFxn
qUL+2MTl41Q1XKyjUy3ktcKkdxAi1LoWkyqkVCDvM9Gr6M1BAdDofz4aIE4eWeojO+GSCFEaCLNW
L3dxaIkPy2NAq8nC+DEozTHNpZ1U71EbU+diGK0jdOaDNgXeGONvEV8t4EP8Lnk+a2Ka9yx08J3W
8IgJ69QK1y8QvTASUh3RZiPdmRykX6U4OehAs8mBIfU9jQhlzblM7G2GoadLwS8701lDIybgql39
AQqEH/iH9IL9TQ2jLRXONU+YqQBhQmWX8wuVv65L3quhx/q2krbAW1UpQQBqLtVLqd9aSjNFUS7M
XqUWEVg4ED/9vQfuDhwO9P/HCUCCy+jbJtbg7Q8bZT+EC46rLeblL5FoRmyE9np74mwx216TVai5
DHM1NzQmxBlmXRBQyldqKhnYIwwVFHO3oADmr3msUSlWr2D/7uBjxSZPVu9LBhTKB128pPB+LRwb
ZGckoVjIKlqcF6Ki4pv4hP7yC6qYn05LI3wFvwxN6PpocMlM0KWgRhTXDO05Suk/c0Rz+4KGyGwn
f5A5OswMscXV3k0f/ekFidCiMfTp3lfTZE3++0l/LTd4Ch8Hh/LWCQfxEDuvUPr+qZM4D+ZHmYuC
yVSHrHOUguHMzNGBnBnvF6QsPGBRmUVxvKTl+DNJdf1l+7PUReqbXlN+AcEpaA/fas+rALKhzvc5
NDMfGSz0lY2Ab77l0icVk06ks6nlpFFCGKhiDBDfG5eo+u4BaW4WmVLQtlNt2XrGpnvgNktUIwLk
C7iCBx1VcwIb25UaZgg8XgnMEWA78DtHWzkGDSQ9eNnetI0U/z/7Tem7vJsUufRQbeBeengilpt4
f8L2QGBwrohg7m0/zP7XxlX7v6UdfFX172GJLWdWCWvQM48XZqvX2kRLxliIowYpRCKDdfum10p/
EHkjhLtsQ/27uSiDILxXvVeDzmyg1LBiIzGUVRAnE+ADqay7tg/GtYHhhm8GHO3Ohr3LC8XMH64P
LyDQOXVkiNAGvFv2jJHjYco3vzUIoEOenwX8AWFWw3Nry79oqHc4fblK0/H/S0glEbNwk7SqId/J
/W+96SJeL1Jwge0sLzlE50s09ChRwF1omgoQDKk5Ew/7XVXdhcfkmrtl27/3KpADIfDSJoMllYJp
mhmx0AqrSwZKfldqqn+L6fa6gfgwKgJZbzzASw63g8u1eGRnsrsZKQnXVFSmdOSAwMKl6HrVvaAQ
t9hDqHyRFGMElT2ed3pXko4yAFl7ToCLN8WZh8bMeYdEs7Q5FazPwKsnmfLsmObqqI0W7+131ZEF
MO5ZGt2HHkTCYou5uQDJk6yZ5+9uLBb5xj0XnnKSDgBXb2C9+HKw4BNp3YrLK7ikBZL72UXe0y6s
JhtTdKC2KQsQoJW3UBa8nNcElOg5UmTkLtj44/ZgYhxSVMuLuOf+A8NevkHGSF5bSVo6XQnhk1xO
/DbRUPj5pVfThf3/q+tFFMqlngFwsG3rnHyh2OSrgwSvVnEEKToXHNYvFDjHQc5Xeeyq+xi+NuUu
kgNO6H3j/nrPKHYrTWTttvju4W4UyLXXhI0y+yabA01aEEJWq5Jgj/6Z4fkTVwOhuExxtIJk+RUk
EcY1vXLMRqYtVTcT31F7G3u49hOiNn4uiH3GKJHFL3MyHbReBWfnotyvYY4qhxk2t5jwg6lggat8
ab53PvYvC6wo3aTb4VnwQG8rlfSJzHJKLWpXsZIEcphGKLeTPAxHROxEAqJaou5kKx2KxEtkLpBi
MZchtY39w6LizdU0fn7QFUYuJQSh14uh1UR6IEOkmYfJ1PM4y4NxnMd5SxaQ2td6MjXrhfBZZhi7
BotVIptDMIeFyPngV8Bi5QhP35yYjPeay0/lIIuEiq6xxRdssEhxYnGE6utEoUFmUvULwF7jJ+MW
xrkiXg9I1pFl0s5B5zX2eQaP43ZYN6CyixncJ4reB02rPrJg4NTSZYc1Dwx6Lb8ATBkFsBzn4cu2
G3gNFvRnGtGh1ymj6AJxDDCd20c4W3vW5yEw66twrPyrqfMSnBdqKJSsGCw1ZsoofAQOBianK8TB
GKnp7T1Bditb4ptvUxQqodZIxzScILeKLg3YdPxOYmLmpLP0OdnUgjdvwGTWNu3NK/fi2YW+Fag4
VQC/49lEKz3siYKYhzBVKYXUCPuX1XLQFwkfctTv2rZrMP1bYm41QDJQ/XW6+0aFW8V8SA5kqMsF
pfHuEss7KikmXCtFsTV91QrqSOnQ/pC0qda4Tncu8dQ4Gt78FGR4CNWB/RIoXRoANPWYcupGauaT
aHCchqWLFLcnvNBMZJY72nVCq96YGY9zdbdCSQh+mjgHO6MlEHYe5T4EuQx64Uwb/uHgeVogs+96
7cBzmKzebR5T0w+Mjo1wuW6XN1Z5p0xs3ZDV6hAP/d1nxrDRrOd9dcMKYw0uZaPll4zYhuVEKDQQ
bjG5tzkVrLVkU2YYt3rAzb28886bKtctYgxWwJa6oMmbn0D9X8rNVMWcJceWFICG9diidaKEZqx0
8kfbmSbnRaPSB0KLtxtkgOEKEFFvG3CDq21g9dwBvgti1rHJ178xvyKB3z5emglrI2tkCk4oPoTs
LApNpWg4XZeR2k3MCXCxprZKWoKlli3Em4tAKK0vcCz0zFf1mAIzwNMyFIueHHdlaMo5WLfClYy4
J2TIxlgfyO9v8Z7yxbvZQlKwPzhmabX/Qw/M93yXY9t3xkDCUTxuHePQoLcINxnO5ahNtcrNxE9o
O0hEqAvi0Ea0nctYG94B5QXj9Ds2VCtsXFxbDahon+zbZ+HpFATDDZMXGS4uT5FLkr1Ue27xNQPg
A3vvb5BFgkW9mZ9NivuOj+1Vw19AbKgxBDflqxi4Im4vRZCQpFXF6ynMouWvfHQB1yllAxPNZ+0n
5yPx8DAuPewqi0Vo+oE+NghO2E3mx7fjGxyEUpc4BEyZdtZh+VY8JrjOgxvxSRmfWMNnUkyjn+kt
hAE2WmsuG3O1uDSanYUg+/L6WPGCCUhp4AARaNo1P5keUFar1f+nqDz1O0L65qhrqoICPkUlirk8
Ch6MZO9zNp6aP8HJcB65+CWtnsaQMan0XTuNXJePVJD6y94sKdvMSKAExcQke217drTVrMwQPdgP
poaSbYZmY9ZXIqeCaTV88jucOQdWkCbppiC9euRZpfFn/Dgqw6NUK22lsLYOxJFEpOwBr1Vw2YoU
zqFBYquP6EE1LmDQly0voSLgiR2+vhxdZqXwiNJXOf+JzRey6C8uhkllP8ojfAkrTZ7GWHVT9bqP
LGcNiwjO6wcmHrVIAb6te6lPBEpySKh388FFAuHrnVo47kL3RQubgIsdo0qyc0GY5JIKHNzkO31E
B5dziwpJ5GYvguTmssRi0vdku3roO6N6ym+8BTJqefaqDLDmKMaFXVgaPbFQ5rYCuswzfMbxq0AG
sjBW4fk8NLG3ygkazMkCVUo7DwlIgoUCSXoLg1xTjjeBKFRJyGFj9TPO4gOEDjQMyU98YUBjB4EQ
XB5zeLDzeUFAoOARWsX+r4qQUxXHuKP6MLdWkIuCHQ5phbfFU1I9iNkgR26U1F5HL6zVS5lMbxsP
s6JUF6QHufr7UUUBx9y2UqRZFE/tCheLKnifQbQK/P2zGxVt/iuLpuPp6Vvp9fANeroZ26Vk2Hqa
iL3u1lc2EE3ON+GFb8adAGqHhyU4p8kfqeAcv+0Hc9U6YS5hA6D31eEaHIayS1wuiZxEd46qF959
es9r5DVDIMjU8CkeqWb0OL6zub34MWh+wcf13THvpH73FeUGFdaQVro9zeKTeb5FPeD8uXHS3J1D
cJrA1ga95YXIYouFljPF0/63oK+U9BtR4WiqWpHnSlLCJkd3Z6If7x0v7Z3az/D80YNciSCyFrRA
GDiswdn04h0nWb8ir5UJdf7mtqyAmV6eifRbAMqhHWkjdJkqDEN0T2oivLADen0z/D9QgWkRhoZS
qNrXhojGNJ1IhruRrjNM+GnmzMNNvfuEpc9cH7FAcPGDnovAvHecunLJ+1AFOerA2DSEfQQcOwBB
SuDXSDmHzDwhp/viLCTgMkEhCmmLMyDN2gkb7gXrQwuaqMfKru5Q8uJA5MXbBzRTFffz2bKM+xsV
suM/IhhEaPB3Rosx5/dPhyG5IhRXtegL/DaDVUbfuJxUD2IBkjIx7rA+ygOWiLPyXvWKwZsMF/di
WKpE4rig63tLi+wZzO70UPg/CzQWPC9avpwSnS2NMQRuQcIHFY2XReAizn9U5G3UKUxwiF5zSt31
HOLkGJU7Domj9dtcufTjvc8CqtFGLHaafkEVmmwjcv0xrBKHfynFMJOq6bpGxHY0fkkATB7ZAXNB
zVq1H53kuWGrXhr53O4gHiOJHLtoXHKK5c1uk4IlpwvpoeZ3FY7KJBtvii5oAK4nygfSINKslMlO
CcMvSU/HeIi2Dau+XsbrJRywWtTIBwlM42dQHfznw77KP9pkav2shFI6fxlgLBAWKPMr99kyPa6o
2ut0OReBqOXHdI6RUC64Lwq3YBXAO80hcjADvTu8wsb4amHb9C+ta/mCc9joH6sK+gpP4gcZH3yl
8nd36UFQgOWfRTksm7Pmrey+cykqD0EvNJiaA7K3efNNaL2IU2MO1S+dVTw1K2yCqz6g9sPgQE/6
2+ip8Rrr2Wp8U1SrmBjhDjycxOAAAA2YQZt0TeEP8mUwAj//7QHGYxdA5WAqDXFRyOIpiHg7ZkV+
8ryjJnPpsOyvhNRCXeziSTA/fEq36takMTuw790CSu5mLHDyKrsDT0y1Xmu2Tq9RXnpxxcee6F/V
PDvjfTUqFGnhFUL0PgQltR4nI+m7/69Zl4JZFqLWBi9B0TrbDJ30TS40WZDb4maV0zFelkfua9Ms
vJW7e+jw9NMwf0rYJm70GjOTMGDVmhle0sCyEwyT2GqojKCHuhUwd+jwKaKTJZTfRVjFHyrmffAD
5cdithiLsq5vEZ50wQWqWviy9SaJrAq59mJoNsWrcA9auloi2dE5dUuqtsSs+37ftLYQ/j0tHt4M
s1p/qgUzVcr8ZLC6P932/WRVyvjr3BKAjxlrT6zNWDb7/zSDGi8QRNP9Xxn5S4yKahhGSJml7+dz
jOcYX+1Emg6LoLm8KkCYEBQjM9z5yuEWko8P4+kLb7GapfRNoYTlj0WAJ9vG8agY2bhAFJWf+BuB
YRTlmmw6zZV7tFA1NUcqj3Sz8dkW9IuUxvLacvtpQtaJ9hvPACG2f79xny2UhG/TUtvubCPqi/Gk
xJktckRXNoxmfiEoJumo8kmQ1nrs1H4DUafByvHwDQDqyCU8flLjwRaznQQevIwUuJe4ZiHqlSX2
2H3x6LERU2CKKZ1OH9xYa5QlWU52VcMjiUE0vRnk3wkLUdilijhx0ZIl5ITve3md4vTRPv7Ga/ua
Q67BDbfOerHwQENnCteSyCa4DGxQoz2rwY1tI3BPLBPAYicsF/RyhhgqDSDx0VR88l0bdlX4J7f4
3qwUvcVPGzsc3aAcGt1/uaawcrILjzN6ZBXOH4SBDdY91HEKISUywH96lCnFv9ruUnh/mHMDnMJX
+2Yw+dPMqTN+LbzKWWmRzp8i/Qpz/Qb3jAKFTgkn+XU1WyxOXshTZ+IbaOJHRVDrGl4m0A1vrtKA
UOYkuyMuMKxEaJieVlRAVSELVi4bbOxMLv6ugeD5+D/hDe84qNUmADb2sIb0zCV4zQ2lPWVfXp86
WE8qlJ82v81tqXjpEcoStaPdS9qQ97lCwCJ2Ox9Kn8sf5K4HZn+BYEqCHeUHKzXNR/pAF6P2VcYb
UKbIB1tRtJPJuw/IuJurCt0Jz7VcUmTIjIogon+mmM1PHP1Lj3LYWkMw59F2TfLaLHitZX6NR0g4
kjY1fJaKQ5rvSM8HfR3XBe3LmxNu1+jk8skhaNrLwB7HpOmXdvfTb4JIO0oyiBFXJw1j+vUj0DVI
2C3UU4BWhW08p2DpNYWOrP0dvyWWACaYw6r7NalVtiBXvCi6UZQIM1GYzQwyy+ibojWylKC03ur2
+YAZMkTPpGLEuWURN1CiZuxSf9rDJ17qiRQcESwu7uhTuzYWq4t6ru5Ka4x8MlEOv3ppLDazlNN+
xzdCjvX41q2ITk76727pIrOy/s1KGy2LF9kwBbtwCrA/5GKFgLlb/w3ui7gAVFvaNmNQnkoDebNi
fkkZvaaDp+Wxfr0GN5cXScvAagSxD45UEP0zuwqOjCZgXVMvQwWjS2ddSIALA56LcX6bx7PL7SyG
wMDHK3GV1ycJ6lXuIIvWe+eYzJjA+91B51aNj3Ft3+IiHI6aZgl1s4RstxY/VlUrttfEfUrkE/0+
k90qD8IL/EeEDUg/YlPC4XSimQZmOO61sdgJADI6lSCyHIz2N4smAf5pMsxfeiAd5fZ77oJriGeD
EM3aCXT8mv/80pfj9UEnfGfirPAezZMkHyQ9J4Q8rvXiSlJ54T7ZkG3jfKcDpuiJZ5aNKXdAiQ0n
3XFSMY/D3Xck54v+F56Td+1Lr8NxGNEK+M8dc1qFp9Nbn6yjqliVZr1cMV+2yXE0tQzd1+PEmEgN
yZxYZxcdqqiMf++nB1yK/z3BraLQs/i5X1pmPtbCZ/+COmvPrjwir13CkFhHGZPmX98z8D7hIasX
8EtcoifpkqzX26MUNwwxOzeoep1lqYGkmy6aDYQfEoKpGbato13+tOe/vI8jhO4h3D1YnGLudrGj
SlCOFqoiCyUjB7GRdNOlUzANiF8mKftf8hspjPypcO3Z4FDV+U5HJ1p1lSoisJlpUbO53L5nC/XU
pAD1+83MK51+AZdEWkexavJxJGkghnLmSw3rlrDZYcPRuKj2yO4nvOxyc52FhbZp2tq2E6b8Bq5D
7h4d1a3SSZQ0jThlPDZMpLZ3z0MAa46Ye7h4Rzm0IBg+AsTlRrB3ZO1wEnD17B9r9Qonan4Y3dHZ
L0nfG9X0i9j00dbpVkmikgUdaTh2p8agJz2p3viKblVSuC9MwsGL/6vNwhbtNfD+myCPU01TfMYp
3JU3ijiKj5iHGiTiWgjc3oONhmdqcZ217HKiHYZWnooTLyLTBnjO+NDHfKjIBxeD+JI+qt1PUafP
yTucOl88BT+7sI4hl4xSQyPT15O/n8kl9gjFSa58WjrqzZmrQvGFEkgRJ3W0UTegFe49rRKSySKq
PHwFAj0IyfBN8hnXxkwmHhnwS75x6VqXkPNRYP2HZLgtlvaOQaxfg0TAVa+IYxZod8GxLwB0m/08
2bNvBFbt7bSamxB1YYghtDdfTHCg0I1G0A7tJkhc/01KFrcV6KeupauMxDmTEsfzMWRbhH/MUk1z
lj2jqkh+7XH3CGwrWnly1vkpe0WADH+nSPkHSns1Inhu3p4Y5Zsr9MUFBCeOWpQlbvd3mq4cslTx
sbs3HFOrdn/fsprj5QziH1UYrDUvipo33/uttg1DYIj+RUyuIbLvs7vWkzsdYvth/FYoioNx4oyf
JDW5bWxZr1KOw7EnIlRcEJSfx+ofXVVvswvsWOPJPQal9h2PRVHY4MqTxgWg4Y5RxJZHn/2t0b+q
6uixSUicncjsnrfsHiZji4sr0g4j4Pcn9W6J45HP/j3G7XU6u1Sps+5LmZWyqu3fdgwtQCnkMJeq
DLK5IIlnacmm9QtkjnrQ4nEuBZgoKp605TtdLajRlxelwxBtkmSDb7WkQZVV7UbUvid315j1fKdt
0D2iLyplLphHr0THNs5PjjQfY/kVaX4YyVyAE8i/c+IIjiIJVIGanxquuXvlIlwJOE9t+HNr+iZZ
aDtTJubMo2zCi+rUdfQXYJ5e31IQ8RnKr1YPrZ8yygKObmIduGRLjjcqywSRN+nx/QYx7B2Xo/XK
/Ts0PpvFo0Fwabv3D31Xo9Avpl0jIPaM7ita2LBCUDh7MLRma+llHlvckB+pXdoAm57qYgMegmf9
vTVBciNtNPRbFtOmdqkgqgJweHymTUWQoy1U+jGwPRhrKC7vLXruwsVkO+BIWL1PozvXUalatHO3
klCVxXCr3++CRRJoHivsgFLF4kKlgWsG1EDeUr6RZf9wIFuCJavzcnFO6xAHYckofm6rj9miFR+d
GU8nIb8QzZhFu/2rMq94wcGQohpBEM8zZiztgmVhydNvz1+qJiyGDN2K2sQDgMDgGmC7ihPlcaxS
F+wMRQG1yUiq6LMPABN25WrSnytBGJLAjf1CYL5HXHJpth8PvIB6pfTncxunr6hO4TNYya/I4z95
JwkT/pPll84XpMkAHvx68UeHTotsn9/WFCs/lQp7Z9hQeP3g+pI2iw7Mo9EJ9rPbS1TElG45ubVs
5f+0IppqOdX6tJrThJVbhleMX2n+qtt6N5ShK/eRiMLcPU0zkp9PRK1+/Ilo/yjUdVqM/oCIoeYP
UmheJOTWsdgm1lCRL1EwKK2OOzKbA37qT4eTZpLxiKRfFDHgOJZ2MoZ87VH92DECtg4RKDnSDqGi
YCEsUAKsN3QYiB1uS+JouALEKEqnQXj+OLv/BnvsI50XUJB3l2Wg2KLioyKz81zboIx/paeaYRp1
5uFNZACxc6bReNillmgDeuIL3d0h7/RP3YlWw9UAU2obO+tqbI/FycllGXgN0ZqneLlvlt3TtZGD
hR7vUDJlhErTm/0qtbo7f6xRktaIziPGLT9/CN+XHdphj6RDvSwY/ol6WhSlqxD65H4gdVC2dGSu
O2dBagIJAdUBNrTRqBLOHM3s3SSkIglHdnIEhkOU/yK86rIjojYi0dc8k0L9osrC9nr63ram5HqP
R7yd/yfZj5tRBwYIAWh/KYxx7y+pB3qm7zqzm8zWESnjS5Gp5ibk4jQb9yQVOH/4gZVfTz0fXpih
ExP02qjVmHtBmy3HTc7WGqxrNNgU2Mp664JqOc1dOyWmpWrPQpfA+MZE0Sf37m7vTtjJmg8cG4i9
LujGrWJvEoIeZHrffVqCiif2Tt+zGi/urz//e/Dhz+tkEP1N+3RKhmHuPDUBJvKvJv0V4+2eW5d1
kykKXY8Dxh7O0M0jl8OhNHeQrw3TtHms2EMlX7F8fJQfu/qbEhi+360CLPVQrL3Nx70LqDA4MWC4
iZALTCfRKvBlwzm5+tZpU9BeHgBE20/3VdTcpuTt5Rf1veqy2g+pcFOXrBIi1HBBHgceGx15DM/h
tS1BlvsStDedDHcJqqAgqpnz8savW6BIgIvCagUkrCTnYZjaIm9PA0vydUSr0p441H/YDuc9Jzy7
bJ09BXfQa/U2QRwBJVYhuBEGT7xjvc43Jq13eaG1/U8UC1idKDrm2iejHKRJE7dzu7FAQKX5U3Xy
EzM5n5fJUBgSsWOtG39vQOlhPjsUn8QCYODAAAANjEGblk3hD/JlMAUVEx//kpRCjhx8EaeHZSBw
CEpsB9rSgIPVMMz5/jhyNQ//kL88Ii0BLgHLNg4ui1qxQSnXfd3/BjE+8dEKcYaFvasn7tqCxnOM
+ruRvOvVwd/qz3IjA5H3+x3GiYGnhLGTVFM//969uuDb1ibcSrKub9Uq6zESLDKEMfZMyXXAICDP
ebisNCrTCZ5K7LInqo/H4PK3UU5ApcZb8cVnNVc1I9gkC1LdBW+BPuHeVvjVIYbhmM2gyaPpZQIy
wKLbr+nMEb3dFT2apNJGm/DYw63k+TPJJevUkHatDKHDZaVzFyiB+LrjLGSbeuNkXzG4qywPJG85
MWg+/XqmGCd8kKV4Pt48jVc/7TspCubp4Znn5uAPGQVBMvLUK6k4VnhPp3Gwp8LFOxV2xFUeaFyd
1PfDUUsulhHUlmmDM6w4kIKNYvco4hmZGVlIErRluc1NMFPjY1hMQo53dkEvJnhYQ62+Wxe2aVzs
6MdV+fob2LN/B9RK3DfbbxkRV/dTLoCNST3agGjdImcZnJpquOxay2I7PKJ49gzrzKvHq6oyhVjE
h0aONpBDGATTwDHHlmmM3eeHuFFIob7OPxJW1c+DWSpRQoISfB9+dXA8MqUVdmgonbgQq9Up4hxP
SBOrM2HNmIVhthBsWcsCB7mG3KZ2XpvQrxnmvcBdVuN1DV4dbXiU/+WZoCSszFgvX/kA56tzc3vE
3AdnZncFrkeZnsqN8utas9+bgBecqyIhhb0MWrtlkOk6KrWFvAJ8KDSpKlzQ9HkvOOLiG1qgZxxQ
e2qQlaiTLx5aX6lqYr5noheFcTpcXjY6kqD2cg9waF8owxBKKHfz4WJWIcPp40aWiGnj3zLq/MFq
5xm3xTEhNuJLvx4iTuW4r0ECE0MuWvNyfFBQwIl+EbBDNO0HskJSd4TazdI239HHU4zg8enbVtlb
DHxbXO8+PXJIcpaJxIy9o3AIkAyGYO+DwnWKNdGNjhasQDTcnCi8PwiFMiH1BKgsMud4m78dAOHt
q/i598YNy/1GpUA3goQjU8CLTpayQr+8EstELZiACbscUscnD835QEEp4ciRVV+A+n7BALY0jxnC
iYrSxhUlx9t9YPw/xMXsnaZwxP9akvY3IR+acacjgDbXxEl+p9mifHPXl/ZKrSVP6RHJ7ZYMBwuE
mHxxED2fxd3pDkLqXtH6r8ggQ/b6IF44MQgP/PGYpgLEDxBSE73+ZitaHvypzHXB5xpdkNnv33Tu
tw499bI0i1kW5W49A7bAsg8Xj55vZxy60T5b7rX9VDVVy1w6z+BK9hd7qqPtcZJvwePP50T3wZrC
BTZq9MBLJ2scngKWh/x7/Gjag6P9vfpMTlg2RxDCM34h+BR+OHDJwZFIr0qdL/gQU6hf6q9ny0bH
Ga3P7Oq3vis28tT3rjYBFcHLfqmtimJyUfRzm5mtWP/6BpbmoeA1er1PKtIUt71/Jw2aZnaYeNxi
vTlLp53caRLpTeDKcQ8IchFvanv7KIs+0UyTorLNmP/PDKcT9OoUJOHsysS2AT4JRKt6DC5rG48R
kzihpKG0p2BSnlOLLbTvSBYUjk6B1gFZvJtTWXZpMsPWhMP8w1zwNyTwtxHMQ+TFqv/nkUOp7EE1
naJ5QFQKt60kpNQY7ElCe4ZfbGBai+exYP0YcvmF86GGYcr0kXxzR5D9NgjpUXQ19zaB3Z4j1YiQ
5K/xlFSsdglOztpcW6CleoPeeIHk9we+IHzK6lcTMZplK26uSC7BNeMoqADg7gRy4CKNm879cZbo
qU+Up7SvCm//YI4lQHScQH6+S4dVyu0ZdAXqiWcDfNUFXSTRwwgpougoN9KJKxz4VcOGLIOK6M0w
WSrNn/f2NsXvVtVp8DpiAXb4385b8Cv/HHztX7ek9014VKSFkj0aYkdYtzBdvNHVGfEuuQwva5Qe
0v4QUVv9MImb9Nxh85uRRoxU+Q/kt9hEoqGjmoy+E7WUHDVtfKCeNosMmseuRmu2coMDfaSlkSJq
6OMfipKCwnGjqadZP1FtoqCY4zq1OtHe992Pb3T6fwuGjlUAbNzN8js3Ja3hVoizkhjgxo1D0LQ9
5LAaq0l5c+Hb4LWlVJ3yn+iC2a5uZeQwFx/WYsdrejbwpyRtlSzEsel3oiOfNP+PyTLe1wWge3nn
4pS3h2kdtV/CzEFsOYiFklvKaIJbwBe3SIVh2zlcE7iqk8x/BMhbPgr0DXlvoZz1RfhTuGLuyGbH
iu7DG8w5XsYurLuq1uxhzOVX+iBCAt8V5Pi7VC3cfTRN9P7d8xll4Cw9qgh1WObAWW4yAfPS46eQ
Z9M1tjLZvdaPBcky+8Jhg8AJ4iJJXXXwiAFz5m+NTucZHkRXH6Lq/0PDXJxp6QUnENg9J1vX/Vqd
QBQosGqYrpDBP2+CgaoU6s5bTCuItL0crVYbGM3OIsekqE39eSJl9Tx3jP46ZRDEpfOXYq94yNIh
GI5/eYX5K9sM95dWnCAffKNWXf1mpka1I9jPtgsFUq86ek8RkdEWI3ikkL2uTZuBQH4+b1rBokVp
QJa56zegzKx8iqjfNnuf/y1RO9EEg50Twv5aHdg8VPXGsOU5zdjveUuOXZKFWFvikVLYe/xEgTJS
jkkEiVdYOIkDNuNAX6tWF+74CxkiO5pUG3lM0cX0wGBDEjLH+2AU3w7s77a4d0NtTg/yUhm+0em9
p8Oj328a/+OF9hV22CkHCBjlMGb5J/mEL/lfF2vwFUkq7dh/p0TIQI92wWFWMNNsbCOu3vd1EFwG
RW/JNycH5RfStBtgrgqa5vTjTtxs7pOK+mkImKFHNh+5Md2hGLMU7gRv+hkPdcF/eMOwYHYDf74U
Qq/qXfSTsnzBA4IF32dFFRbrO+hutyWLWM0ZsAFEMBDm5skq6fBzBTZyQqpFwZIQKwkpsaYVkFeK
JJ0naPlsoFg065QEx7xcu5jvsgoB8V98K7IWjZGqwxuhKKLb6j2Gl08QIDl5V/Waxv/cbTprIaTa
XskrsAVlltSRU8OKKymPE1SJag6iREH9ohsdo/E5HPcUot4kSbjqfrMmhBqQUwddm0ldSZ6nHmqc
9BsmSf/CF7icNTxUjbl6hu7+zpvDyTa++mONaB4wSOigBnGnaDh+ttSIuMpMoWZyobMn9ow3ewSG
0I1md8xyRdPgNtljCWjP/eo1U2Dw2wM1K8UGdIp023v45yoEj2lG7eoqNtrBRUeFgKqXScrGKFul
BR+tpd3jZVDj319Ptoh05LeUKEF9XdmrBqVc9iHArO+wk+k14J4CYOXkKcwbUNEXj7M2P9+9tR/2
6p0/48nyfPMzqNeqItfDYwl9J0XReW+9nrDjZUz5lYBPg9kOH8GTarg4nkYLaX3Af1/c53QjoU/8
B+noKdVS00+rA7DjP+a8kSSY+C3aDLvC32PY/sHDOMjk9MjlXmC/44GXikgRKRfA+6bQgc1Un2P8
acJRNNmcQgRSZ9jQumWpy3alNbtfMnAoKyiDvJwdT5ZbTAr17APr+OZp3kld6PqmxRcMEGXegakT
hqyXUx7yVVv57z7zYN7/G8xFUhhV2wVRISp4yorU6+RXNOdVFXXxGm4GZoib41oc2ph//4dUaeZV
PUeT8xWFm07N914SmQ0Jl/XdldIOUqOhpSax96hHMv4SIu3up+nRnCz4io4VW1OFRDippQubWXj7
JA1VqTuEJC7wmvGDtYPYuR74ZHbRcxgXxZ7WbvaY1n6EtgacKAt3fIISjVJH9ki0AsZtlSMLWjPL
G6cBFo6g2Rx/h5F1Cg5N8r4MTGsTKWuLiv6O98Hx2oMVKR5SUTUk3Y8AS6aYS2o4DWPIZyNa9Y5v
M1HVdVQjJxJVenOJWZ5fSV2KlN8jsn8E59468EAwAJe+zlC77ykMMwORTEHXff4BG/Vx+ge6WA7G
MAo509o6ve13bg9YNDBK0I2tKLyQS79YrF9L81lvjPHWGfm2LkbaitNdpefmyyTAj2bgiU/4IK1r
esEB0PgR+663RLl5hYliN5MKNwujgF5+8jWRRciRaencmc71dOa3znUGZ41KEtHx48HSPE6rjTbG
zHI/5/lZu1HNL50l3cE7S7EgPCg4RVPm/eI0YpFijH9wIYSPxiggGNRnM6hN8A00KwbqeNpYUuBd
tI753XRwO7ZLJyEQ0ee7MMtf2rxLrkzr9Raby2zBW9cE/BQQLBxTVvhMkGqng2tri4xb1FaGwJUp
S+kUWg2kG1c4kpVPyQgaT9yXVVcca4KQAtT+6QdhNH5S1vD8Wi06/DtaKiDY1yT8c0PmfiQrN1hh
IsF4siKxSOes6RvmpwD625KAqr/kqoDZ+AOgXi0gIzJ9RC+0DPU0ME7OchbAB3bxB4KYj12PfswU
FbcZ27r+aSoRO6qlFTxHYoI94HcrdmQXYQfV/Dh1ti2gZwyK1BXHX/Gcf+z/a9dv6M0Glm+ppIlM
dfU0vRuz5Kj7BMQ0CW33kUAyD53IwCxc3p4srpznxk4xkKyDfTm8cGw/Kzn8TwUEaPlwzohN5eic
ynpIaTxAxVulflxp7Ko65PI/WT/eM7Opnp2m63e7XE3vGSN3sGsOTCeEwU1x6bg6nsuSPHFu9z+c
1w16PgP6VuWqQmZtmrtDvOy2yVfIwQAAAIgBn7VuSf/skPagcmdaMMW6nzkkEs0yCtKrWz7YsVLq
yH+8GpvT3IV+0/rMtAe10DNgh8U3rNn8o4vtqLSH0CGlgOEDz1rApsqsavHEPC8s67rwL/DcY/Fg
5rOsnA4Ts6k/naJ7jyGpxxdQIsoqEEE+MY1nYxl97sGiK0tzW22Eu8HK/PJhjQQcAAAT9UGbtzwh
+TKYBH/IGkAE1X/Mac4GP8kafM8o5jn/ABwI3H297gmy4V2swp2H6P+AGkmLsOinq6sti2mL88OU
XHwX3WdoqyWF/Voas0NBx7evqNr34CkcfJVKo/Wf1B7G4wBR0v8pSBSf1tew/+nhT2pPeEG4U2G/
YkvkhcFu+aSiIgXxHyfxiNVZ3ehgdcdkGBYgeIIJ3jYpo5D2M4BgfnWDp0IUGKjJlS7672NFtGul
1sEXLkYmfBNziqQ6c2BAe/EaROcO8dYciehrSz9CRhHtZqO3H7SyZ+Lb8LWap/1UcWqo6HXQEkC3
NtGpjHokyDZ5GOv3U4sr36UaCOsu04ECp8riJOuT83C4LoFZ743ZJi4VV3QTZmeI38Gy/j1f1KKz
a1dwQ/4PjB+1GhMfU1tWnTYQHhqahgDTjYTQacwd0Hfg+QO0D2RbO5QAX1afrRWorZnprXta1Vt4
7QS4djfqMsrJ77ixNFTJSfBlTvCyshJZvK9pF9HfV+rHJVEr2aCPjQl7TsjBlLgoCQDnKiWFimJA
8Qo7fz1GYvGXddkLRDXThNj1g/nPaTlSOwJbr78AFhbfEkdjUxs96WiuaGl19IaBV89HegimxTTi
BKZ12mdcB6h4bEZjIVfBtSKkZWL4bkySas/fU26k8YVcOasnhzoSI3ABvNucw1Yka2XdMRD88hvA
9FAgqxDI969ovNZMyUeZtdUa6yeb++QoI8k7xzrygmlG670jmvcINFSQj0HrWxDQ+R6FnIcxLuL0
c4WOdRpC0G0Irt/SIQC3SlzYOQIi9qAYvvBNVN5+r5aZj7U4Sl8sFodFn3HxnjDJMF0QNqZCRBVv
COW6sdfkv4Ushj10QqL/mj++W5OMegKV7x/wqmT7E92zXGeecA1qgbgX0jDTrOTa26spDFTE/meu
7A6k+CZPBs5wzZ6NuevMnU+MNAdz2r/T7MY7lFfzc2rUrOCk9NstGlNO37E+FP92YP765tY1gyx5
lCLmpMXbcH4KF1pWx6nvmQrOcUkfCD5FdS41RfKA4wScCqiIB44bsUgh02BPvzR1Vg18H80D+3Ch
hKQxdeAOyB0ndrME4CKOb4PzWLDMXIPxCdn65KRMSAVFSvPU0xUxjJdZCKSoB07CFX7DlGwM875j
ek/IG1wwwoNwW3c1DlYk6Kbchonf11hLkx/HVTfgK1A/tl2kPDIXypAN35DOL9VxwLrfyc3fBpWM
OqRqAgP0dPTxoAA38wUQlbWHOrANMaNnSmSpPH98h11HESeOdoWNLncA9bivcMQ0hxj40KMKHhJD
+vqnQGughwdPTvDHdaq7a94N1Scv4LOXdF5y4IDqJUo53qKgFIz3VJ40nNz6M6EtidWJKnrRZwdk
TWsdrkFu50KmOtNJOOuy1zJGfI/IPs+XdTJtGhiBPSMTx5oK+tiQNqsJ2sYGzQh5XBv1TK5iNnuA
zdaOpY3hN6N9CvqR/zIpvBtX5acuGLrnvg6JXYWoD5Rl+4r50XiyLrXHZXfMofV5bTlSq5vZZMLK
aUM/f7F8VBF52j007fCS2kUdZaeAj3lmnsoNRT62nIQ1usgGi6RbieGAK1QqktCtlO2SyxnE+ciL
PT0zhqcjSYAmUa1PXkmgGI2owmjrQB49I5hwO/FdK8ftI2o4biuq+2yYDozQRauR7wfclgNKVv3J
CfZJC0vKFwhug5c+hEbvsGsaNz1yK57q10JJA9o8OKodX0Q4tc6YOAh7gXMEIwLWLyXevCy/2GPv
5iYAerjB43TYojHGATQR5RjpVIWPSaTSfObB87fH3JtN70CJ5Fsh3Thx7bnEBz2bsVPIibiWncs8
Z7ETvclP6Z7/SxoJwe3z2abHBWrp249VIi1UhHAlPJ4hrg3LPhOs9+t1i8SFzBqXa0RvZBW3oXyY
xSrpyg+1YT+6cNmy3soQIs583QfeeeWVuMsMvGfiIcIt/dnnhB32ae9DnXdYwLL0Pwz9Df6lGEU2
ZaE+frcfztVuK/cpaoJ+j5Pj4LpYdmthi92rhyPdVz+GxEtIXu9ucA0dEXUZU7WaLW5q4CaDwZhv
PLFBawgext6P6lIBLumTKCAJNiUlLR4qoTrjHSBrMCEGiGUktdN6cHMjhJuqIrJs3z6WROhOk/1z
Gq4pGFim52un+aGYPEmLhAO9nJKHzygfiSGrS57wNEeIE0p7/IRpoLXUngHU7hsgjzi0OSlDz383
tTdghRpSSArPFP/aymf12YJ5hnKQ3MKYRe+fBMw3c2a+Cgo8I3XJA7B7KPdVcjlR0h929vpUO7BE
2vEIlVkXZOeQHTYP1eJ0qZsJRmgreT0uFcV//vM6JVqEoZ9ffZAzdMjzFB0/4sg6q3wn8zmZOZ8l
HkMvJ7x9S8zepNZnop9bGEPhBPAbjTyaWHwTJS069kOf7VFq5lctnoucDnpW+qmtm2TeGJUaVFf2
vXdpMSxYWUE0vRJyE8+B4ffTVDuLbvlLgfBm9/9PGq8CHt8paIkdSk6j5mHJKUfOHelT2crq+2wQ
Y/82zCo5MGUyjaSJLXiHfiqBnRvNQ03+Ez1KsOz/NWMq+enRwxtlAPoAMyMBmeRLBwQxJDgJfJ2i
CR1msYK21oLOpwXBtHuGE6qwz4qU+cGQr0XQur2EVX9LoTjbvgWpyhxdHt7UrcaqRTgpMnl2+3wa
mIfG7UupTuuTe/eqrE+uSJO4N6HxCvSZhGGiAPpVbTVfS95UyqwF646vMLOsJoiAWfsgIzZ6mIkk
78PO3Y9eZinzL30u6tgkabYmKIkyfpnkctbj/m3iR0cdNMuxstxqGwxmSKK3C9x1sApm8MqCsTNY
CbnaXgy7bltz6fq8xh87SiOUdKZ/DCKlPUrm4yaWZmYiaaHWbhBkcsQ9IUq8RZx9mEQfKNFy6+HI
f5BjKgJw+2xwxhhp0IAVNxCAayajmXyRbJveIU9T8BKpf31H8sXxvhFZQLzPwWNKvejNXlkxG4wA
eLV1/dVkWLDRItXSMJppHGk+dx/Ogsr6z3fHEadoQbxEX8D60DjHT60rPIQguhpcZlzFp2w8LbAC
lhn5yZRaeQzSZ2WxJq9l1ExKF1OEvFKBgUlzRfxh9/R2EuGdixvOTfr9keXOtJ6t6I9gLD9ohyLC
5YOyEknMXsxuyYnutfHgjmXcf0IGXoPNWKj7081bvvutmhdttukcbXzwsf7RZAywii8MyeYMmtp6
NoNSctEoIQqDSyq/zQytf/CpVpuOBo6ZmW1fRLujX/7nymPouNR/fytyFKnggFh+497d0XH/DmUr
kHKXnPbIUkUs7zNRlcqF6+ryAObY42Y6n/GD3X0cK3fK6WoQouJB+PWeRDRDVv4dbmQMixEaBcHA
q08F4l3IVUsZj7jxGAkMF4v1UCjXXQPYRQna1+S1vGtfTURvUOY9z1lrndpw4NNNZJBhdLga2QuJ
PWEcQG58K4oEwj8tDI6lsRltvBjIw+vz7RHf06U/hj7CdCW3pvVFOyQIdY7uFgdeOJnmjqobbxZF
A+ztvfkkaNWpvMPYaPKiCXQH5TUsPedlFdhSW5pnLU2XoZTkI6OSrrf/xr1QEz6vbK44SgyctxrE
HyFmZFXYNWAnlJ5rNWDMjVFsCBWwgoPH//K5DcqmDW3tnR8ZkvoQ7J4wN1+AyLKnUd+UgcW2PgE+
ySgn4r0f9XIrSEd9u/xrMhmuXNHiUHnDbfgabB+Ik+DJGLSsBXlLj1htGyOjO6IZnYj3dg922YOT
37kHA/+agkDpMKywZE7ItA9jgZEWH1BoH+UcYHeVaYonXMeb6MtHk8cAK9AWfu6E1bmsRpads+yd
PMOxOMMaSJgy/RjpV90WAELArJPKMtiNslnyN+7JvtnNNUWQE1zWv8KanfW2Cn0Cr5iyD9RNTIEA
EAs3/psoBoW+XEUgzlccACZmwISvFWZJJNGdRnWavE8ld4EIJ7olNLApF5PKSvfK2u0PSCuF7DIB
1JX9x3vtOWWqiOQUduaS6/ml6CTrQJQ5m1HcVKexMsrH1WngMIbYiC8K2pjL4fr5kIsG3cXAweil
jqKZF0VSjvf0mPPCNWK1yrUCWoPwbM/9NIzaISrY2QJAK1JZWBGnOUrghcNoUQwTni58q5BugIB0
TWxpUOTcHBcvW8R0sb9aI+T7KLb4V9yer6WDF/P0vJjZPepH8PToOgABE+f69uHqQA2ycEbu+NCO
oqjyBqBNpGUUl+9I2Ln2fQWEitEaBPCK10bpdOCn7uI0Cjn1cBBfu1NybpY/0uJxY9Gx1y8qAOBq
YCBU0sf9PDvp93yjfZv5TrOkewbqt5ceTBahWj9mpQ6zDnGmwkSushrl7cmDlS92Jb4SgOpR90yF
62bSzq3JmC9vkXa2inMcHTTzQ+5rHj30v8cxMBbVizbiJjMmtLKKkNJmgKANIL6/qqGq99XMX7l7
IEysywC268RF8NnQfpqcF3MJ79omd5hfaKCJf6PGmW1mhzblfajkHftqIOrvkl2fHTiEk9fX3Y41
1DtXoVomBcxqF6khRUsRff87VrVKC7kFv+RpsalZeui7k2QLfXLDUkIRnShaAnhPOLbDk8S4bQUo
UAyAIwDlaLKD5vql963XiyKiTJshf2TOSnBfZEUF1y1a2PZHRO5jw2JpNZAVqW7NrVcUhrKjkx4X
QWggsfgt4GQNjx/kjLovZVFzUOucLSQefL1H02Z151M3BY88cnvTOyl0D/dI2XRbTIS2THfGR5nE
RV2DwVPq0xmUXEXipNNIDq6r57lTgJSdeFp0WXNrBDHZBufkR11bQ4bEQfg6tnMwAZyxJ11N6MAt
EJwSivywjZcioNLoAWcqJw6C09MaH6HCghbONXlgOkyeUKBAKSNv0+h8gBWIENCwjqI/YTHEmaIw
I3PEr5ZsQC1gHAniHWreipwPcaMQ0El8F7V4BO1My4dW51E3sEdCFBUu4807+YIHi2IfCP57IHQS
8lnHb1HbccmzVxKU0ug6mop/JmQjzkRLnhBhKuNCkpjIfe4ro8M1rAS6MPgAac8dwwvh41PUSyFI
8zRe0dQCSj40m/UiEJGNcuAt2zxDK16ouI0YCK65c+BLkWVgSQQ4unDwYEl28H1NjR/vRFXh3yAu
O1SFX17Ri03kQtT+0b2zblIEQvQ0bUQaRo4lN9v8RCkw7XbCek3EJsNUu88VQ8Z9YxitLoMqqxBu
pxdo/Zar5BS5G+YiKjcSYoMZN11xtM94pL9ogHC6bKI4oe/Ddy2CIwV1mPHejcBaLYu1VTtKHoJ0
gx8fBVorMNpfdnQnzUULqs9MLnuSdov6uP6N0YvdtgnmXzDgOgjhmrW/wVYiRsFK8/gDHjeLmVld
uTTWWZdn4JN1wWXUnYT+u92fsOJJk8qj7UIVFClYLjZMR8BZwi16B1GRXWTWJTiXZ055t6Ukd5J+
ossE/PypTIQMEQxt/RZVdgnTYGX0kXtCzhKXg6P2rwAJKjSN+Bhm/WFoxnkgPSE0xy6oo/LbhgF0
d1a5q6P6NY6iqFelXD5GDV9D2oM//RdFp/yk1hzPjYfyST7mbXMD2UBlgtemmDsGSjroAyZcsyPI
gUqbUT+6XTuEVNakV3itqiNzWIaa8CElkmCcY0+zZPqaFAOSptbnmzNqVa1dPLoPngDLtdBfb0aW
a4KORXBx4G0Asn4mm5XXF4HPkyK4sSfqN+sO2QxHj3NztU1yUUWgxMq/MxWp6MeBIYslk8egWviq
dyvX+4RlNpG1h+coMy7ncC8LDWGl8DSMy2NEc3VIwwvlnNpqLbafiMgcztiZUVfPmFasqeGY2e+H
Jk6ezk4P7+zfNiiTDAUfuv7UTsl6Iu3BPb7/EwB1wmpoRQgJkUVyRe8ikg7VYuUkQ1Rogv2jqwOu
rPVd2EPaBrISiBcN2UxZqcxfyq6iHdQYuKdjCM4c4rWf1MQInarxawDY3kw5CyagfAzFuhDZKuEF
FJmAYjiEg0SOJdBbF3SerCXfWXD5vSLPhEFb4LY/59IqQZgF/GrGpd5cHFiMQwf/c1RQbQ+rPvvp
iEw8t1l3vngvbNmP/WzMiWnZWG5Nhc5XZWK8q+zrz5RUD7c6IJckgc4xrA4Jpucz0yuS++xQH2FF
xrtZ4/NNO/0+FZb83hkZGzD9wI+j1LFWBLyszfK9CR9pDA3us2UvdP/o+BMoNp6Iy4F6dtEgd70I
sKMtJF6RecPOCCEPlwPPn6ntTl/bAllzyRVYbSlRHPuCvwpz0kaouUTiQP+PtNRfiiUpthzNBNXP
Zk3CpwHWwH2U9T6cU4ecG/YT1oMPOryiOERXw+fgn9h5SDcMwlfE06AFiEaBvjCjpK1gGXY7y5+k
eY6A+WBrrijTdl6ifCZJtPci8618VVpKTtAs6cniUrOiNlrVuG7H+3a6dvAmHsexcDmPZC1kua7C
2JWQ7SXAnojkOGDFeqO+SGyebocykB9EAAwZspDIXJqr88PNtR9riLcHPKxa5MIXlHzGEk4Wn7BV
vBJF1/0yIetx/SCw+ctbSoGpid7ASN/WtyFKT7Fg8wT3ysaQYupmTCrlJOS+p109yv098GzASslz
8KhN3yAYuZ45cAx4M/R4T8JF6qHOdIQiDL6lK6TF5zsVLyAqrq4jJ4xysMykV+3aqIRd/94+sStv
nfPlkBWFmyhc4TZdCTRJ58SIdgryUmsY48q3lmfko53I+b1s1jUrhdJDbartHV6MzhynDiMOAcVV
oDFrMmi3JO7fpDmI2cU+fhCJPD5mytNg9GNW1W2ZW5vluOeWlqfgUfYdbM99He0bqLI2Qnj2jKni
GxUNGx2xvvrkfpuhBR4pn1Zt2uvxrsV6YMGs0jC9FwAABf1Bm9hN4Q/yZTACN/+5+AzFDDWzYE1I
xKWV64qCtRNyQBBt9wCsEqIL8zqjr/17rHQA3Vc3SHoO1YtWy9SEazS6o/22BSMhePFKruN4SNvl
gfS4S3m2PcuFTAfMJcaozWJebqEpl6MDsF4b12rUqBAXNOTTWuMUc+u0iQMycm13KP3Mwosg2660
+AR24VBFFihfJu1f11BI49jfEbHyRp7dlIDCaRWa5W8hlonGhTqt79nQas8UK28pRNy0yz8iIh3I
pKByCuYWIy6IlibCPBkQwX6hzh31YKD5e/HWEi0ZznmjzB4b1LNXwdbORyj6L+SvfzCEyEjzp4Bb
NHybedT5YC2biA18fPENtjfK+rR2p6062Q/VbaDxvmi58j5EmbODA4Xu7Rj3gcvptLahPeLDDxtS
Eb5qI4zDcfRT8AsLoVgizpC5nMXe2N5sW0YlXgb/ikYW7U425Xd0oMD9ZWxFJcuDxk4zshCqQSQ0
dDj51QWRNeQI+so7jkem8He0uXA/YwngQoLsMdwIhZIas2uPsrNPcOkvvErbEv7pPqmpSf1zCBHX
kSHFcU3FGWbLJABiJLkcLj1KQn+5eHgDUIGDydJjkMVdtiKLuC9m6YhowiBY9pJVgG3JAbHcDxrG
rWMMqiVCliXEGRkAJYv+lGQboYrGJxWH4UVEa6BojpvtpKp6jIxoWQI+C0bVcwYS5euaHsQ1AZ9H
mveMpK/nm0q8stqPJwmLUp15pRrlHZtdhJEdsoiEL6QOU0q1mhVgEQ1QPSvxNPJMreEsDO1rkifx
iswjRPqh1U3M8yZ6KxdbrvQIP6BQWEhfTb4YnjFXPgNNm18NMLPgPccPOPEJCijlIh/gFbuRFECh
70M2Fcot0EE2MQSkCXAmwHvBX2HutukXBa7B27NbtW5zHwbdou6fWKtgRojyLgp/AldDR+MqhCZJ
qCYXD8zZEUhQW9jpgrvvGJbcMuqXbB3MGnriwEDWWxtw6a/QFjAvVhqC1J9faWSzT3opFdK2qEWE
l3DqegPSiGfR6v3fkbdn4/vOzmMNRXc0LONP68qszXdqdPxIFsrPHfaNAiIN8myoSFZIcx43oehK
dcKMtm6Yjl1AXu7dPfvpUf+GVujSBnblv4VJreY7wIhT7jxc/b7UrN7E24SRvoA14AQExTrUUCnt
vIrfE66jO6tgKYWhTC+DLjZyxPdPz9I+sYpBfEvrHDK9DXN2jDwUQZjLJxz7RH7lvOjrVFTic15v
3Wafn+zCwhFkUx1RCyqqjz7C0KAIWm9FxDRuZ4t6x+y+y4kKhmjXKtBC9oy/ZScDS1rdnr0dO5/q
m9AwdtGXixzQVw7Jaw9Mttq5eKJ3BYt3TIbbV+vDYFMTV6UuwpyyfSebOE/+Pn1b8kgr4MXePaQ+
8h9WcTOXDqSQX/iMCsTByD5Htb4MBNg5YVI8GnEnxQH2KAcsp0duozunBjU21UGpSz6fk+Nte40s
gJsy2cKP8g4uP3sVn4anbNTDKfjCF6THNV5Zx2zBf4PKYimiLelfMFgpLIOkQvjFScJ+ZcsIUFH6
DZYoK09nevIi7VpRmytdN8dsFFpoPl0pVCU0QHBaNybbcrzBwvKq5Ae8p6ZnaivowjReZThPFuGW
SORG2TAg1xsjITuD6cqwMiQ8TdleyDaWdflM4VnBJl8JJJcfIdOCU5QpOmWHcvSw+6A91DYXGtQC
jaWzXbn5/oM55pu/cCFbcfxRBymUjzow9P9GyDqAkxg/pXWlfoCbFO8n4Wb4gJapLTsvUvrhdmSy
WeYNFrGz21hEH1NPZIz3Xuc5tfxjvq9BxmRW1aphNzPqrZ4HRMhBGL/T0VYdNw6F00hPQZfklN/t
V52z13kpmV2IN3pPnv83uiEaDBeYHypiXw4oXNmx0gnKKs6iBse6THXwDSGZ1UqtqfaSanOK82Fo
MW5INvRjm3wLu1JcAX6rz4AsGBC6nlg8rpc+YAQeNa7FXXU5maxowEdPQSKPBWvUm9tv/Ab/7T3o
AQRFK/38kyVbl/VMBIJp3LDNMP5afRQk1o8T82EAAA9GQZv6TeEP8mUwBRUTF//pV2gLGeF+xsPb
UwxWBr14QEEsGeDmkqaypbl7qgnEmsa8LyQZvG9OOT10ftUkUk5L33turtrVASR80jQpjMs2zjAK
z6noA3tRx4jusG/vrzUfMOJk6qyyAqeqyFqWqwtw/yeFT4DgjskmqwYN6oM2wlWYnB/uwgsH2xDB
39jLBmOEgMd0Afu5vMI1bKV9YQs/js+QJ8UretCGwsqugoyapRramHwApYDU3aLqGap7jIYn6r/4
fwkNMhcZ/o5kqniw4+7XMhXYplAtKbG+seuJEoii1xAK0b0ZSrVumw8a/O2TZ1X7pIFKuE3MSxmh
SJqtdn/7DvQ8d+7LtnZWzAhc9caybH2MIozh8dVMTseC3FFS0eH5MrVkXiLp8izkJkdMt+S9ToAT
wW7ezi1AxXpuB3iooeQbK2Mf9SSLGd55tmEH8sl0l8DzGdf1l/w143Jm2wkWIH/E2vInvouX/Nwn
q1fxhHUXE/2Wf8rFphNqQ/+wN1q7qt5trLRRxxSItN6quNbFniu8fHILlVHu+iHwPOQCBvChCB97
+4UuIObqJcymt/5nyDHieG4ExRNbt1AZl6uz1ZEykJW/CML01baVwBphKXofpFtWq0fvZqwjFB9K
g0vR8kHONaWpLKJ9T7gcyAUOIkzwR6RBAAjAUEOsIhZPalc6V8HjwlMeVINqJGJWRInRydfkkAkT
a2RkLLsknodHFOJ2klFxO57srBBDbuYFn0E7lxREQrerLFAvIhYuJFQYK1FhPv20k2nYcWIm4Ua6
3LEkXl3ZdiBdkb2+2gh3OUQtQtNJOsZpFS4mGLnwrEq0jHUVa45O5EO8WSq9Yym7SBfdABkhZn+s
Sa0dqpyloVquGjoOyex17s20j1tzA/l/itTaoK3dGE2SIyX1GdB5xT+o0KaGm/SSatMGet9C2lCM
IcwvMBsqCsNQUC9POziUxqnIrr/ZhypTFpqRG1Cd1wq/DY1s0Of4v5YCcdgseufrRxhUs8kOmHGe
b+8uUgSEBcsHgGNCGRkD/ape5BgSeddLz2+tL+Y/AsUDlWlmCrXah8hOazdUzUsdk3AQ4EW1gAmF
VndGIhB9yyxxfnKw2OTTeNLGbgVREMGulrNajfne3JLs607W2N13+cjtHYxavegnFQ9IedXZllNN
6FiuyCSkhCRg776xzTXtC/CgxVWs9ZUJaKQW4J8KJrMQh3EsXHfzyctwctYDXf8T5TUlFAnJEwwr
JjJ3jH/f+Piavrti147vK7Xw4WBjg+C6+bP3pOkOwsACTdTDHKVu9oGC6zUxF0Dd3uK68+J7mpME
WST9/1EmoiTfVjSfvOIuhWqibfg83pV8YonCh6/Cv/bO1xxp3Kixkhyg0SKHMwZ6+LGH4s+wE2pw
GsAs4XaRsC8V32nSFf/lvkcJyuWYCXjyprce+R5/fhBbZBt0Jh5R672kQdyaYF35tqOvLzHITzjr
vWOnenRC7hV19niFHbuHMKMovGfmQbUV9WopCOwKytar2qcse5nMlr9Y8zp3wvLK+mNYL9TMZEBJ
yv4114Jzg98ZP1PWDNtJDwDh5XuFPg8nbfD6ZUzsNsNWJOg0AijosXjHyBssVVN7Y+LW0/WeHWyV
0mYVGJeASwbuECbRt9/DPpMDXAe3LDVXwtTJvZ65rRTnjd67USmmMKUj/rN3CE+5wR5jbcfuPZ8P
dKnEwxQmNjzlU3C2WuICvEGd3bxQmoqwK7D/maiGfcBx1GxPHvxhjisB8HFHB6r6gT6P9vorw7sI
MfwcIcvXZeG6fyAWpMK+nNZ4Vzxvx5YMsXgeETethBhfHt3xvkYy0Zdkuc046W5h3j3t22AAgQAV
EaCRUubaTMaeXbh22FS2O2hW08WtuA5EuyFBrCEVzJmOplz/e8Flo9LR1PhyXP3LgDl5BbkSadGF
A4SlejGHuZYkURO5gcSFiy9zpuxNxmFn0/QU9X5efLiwiiQ9XOMI8kl/s/ODyIgHyUGmIzb/sN0M
jp4v5QwlxBrAxB3NoXpWts7QEhbCQ7OB/Xq8yj8IZ9JMIjPMjbVD/CNf3RgVR/zzdXtUPwDuM5Rc
EkNzHkGGdVTl84K82OuOG115LKjVsouvzrz3ObsqPwPvUy/rmlFI47FSQ+WBLI2dZvHZMch3hRgl
qp/BWZ/amzMjFNQrwYff2KYG+ME8GLEn5/yS171Od11d6iCfKM6QMRpZ0eTOPPaqCvZOK0h7q0/V
PXTmZOy+rFTtzs/SigkclSmgn5nmjR4HbRw74UQjGzWLa+OAWpgM7DHINhNtXIKU+eUSDcdvQUUL
SDz6RJS/HBsQlSphN6rDC0rnOQ/1izUsRWkHDjQ2mr0rfgpA2kfv2HsiSPgK5S6WBhqROjzMl/bs
IUw/DXjhlDpK9dbwxjqjM3FsZ0KcdCiXXiSERJ7K6cq2fTzBka2bATHRqo0/SWsDENN5wx8VFAfr
1Nyvky/F5LB/mGpRD9+hQRWK1tf2ZpuJepHke7IL57K+XHibMp9dzMMGPYjSdwgRcP/FMGH/jJ81
VgcoBa3xqukhqK3ZAQJNUKducBSakrSgd8ATOenn5LZDL4BAIoO0sfZ0dbpXHgLO06PC+0gdAtOa
yOXkvjrvlizLOF/Xnvbl8/5zqM9Mu7UL53i1uznYvcFHDmTYopQlfmT6RFaA9WcOUmpDYgfCOJPp
2kxufEFMnQ2y/5h+Af7AGFfynoQ5d9SPnP314vaqcuwYBGz4BkoDi5ZODucdSYC1RMow2ArKSpJp
HKCkgGdNr7BDTa1j7mJAZM/JS/mmqnF7HXdbQm+ZeC/ReKfj53xLp4AFT3e2X28zT6cbVAas0FEA
iOyJ72jYYbDSiE3LQS8AyzOo9LGPnu69StO6gmaVKwwVyqPWCYniBvuzfnobxVoLfzBYECoG9Hca
2ALn/swOOF2klVr0meu22if3YdHPgD+RX9JpIQBlgU9PdNvn0bXInziMEVIpqlxH/WBPvptgcIc6
ISMb74cDRGp51abYoY98Z9xfZRSNF/nZaNyRVCw1tev3XaG5WYvGunXUfIgRS8dBWfGB6CHTyxGT
goa/dkTpCXqaC0wKLKjbGy+eJ4sJwx5HpqZdqb+0yUAbOs/nai1CuiSbEBEYa+FXiivfEaumjFMw
9Vt7G84gc0MjK5R4CkKsAhdZVew/aGxVH4oQe1uc17V8AqKNpZlsw2d4p43dbMnEwfAIkVNAmxOf
CioEdKjzkCdbpW12LS75Q3FwD+qft13cKqiX9q17KCDHBH31ozRzZcbgIK6M2RK+Q0GVd/x+NFrM
OfKrdgaAjcgyU2qRJVfdWvIlH+L3rDf+zIDbnWgU0qTf5f1ScBret8peYc6l8tNP5CTOAPAwy7ra
C+mKKvFMgHCJE2ZrlDSAJ6pM6B7I64jgwFUsQuMi+OczJBj0cEr4jARMNs2XF2TkMa99t0Qb8nLu
7i2bPjxZNDN57YBnJg2jhGeT8jAdR1XEUtKVxvNYM8FbTb0YE+Jy1rJthpgzrauQCa8o7hsJqL3F
+ebTfb8t2/G3FmDdg+RKqDSCywyEpCDLL5W1DXs7IKhEYrTb0kQ0Z4bWM0vHPZd43ryZVhqCTqe8
EMmtzJU3xtWr9u8EzzWIsOMJi6s3V/ZTqTNr+izv69QU4lYfZahHgHgfvvdzbDQP1jyYf7GX+k5X
vtYa65zCUkhAfTIvJ3Oq8+8DdMr0vhGzBPQaYNiO4vsjXR2ey5ik8ISMPD4YWNNJnVsOWynPFGh3
1iO7RJHK8jmVJKvL6sCdIpI/CiD+YmPQyD1gP7kR/Lk98rWEVld+pRtwS1M0Kuq26UtfvZzdlD4b
Y2ar5DmAqTMEzh58IMfqp0n9XPNI1R1vvjUBJhM3yYghCVO78MQMQOyWB8LAzqx9NHpLHAKjflF3
ecLYUMomZI5jon5UkzFVEICtcWo3O70y22qY8UxbAYETZfaZet9KlkAiewy1wrQ0emHdpTW59uaL
YxKF6s5Ee4xel56l8aNQJIF0smhU441APo1pP/h+rv2n/S8U48RGas1VzqYSqOqoCcQM3IH8tndZ
1B6KOSAI3leXWh5CZPWbP7x2nYJ2O/vVoOZXemfwO9HyigGzEsdpkkF6n+hJtyncFdN2K9G5kY44
pvLIQq8rHiYZMECwGmOsVQYyhsRC9siNjlrWCRgAQ18UGhJuVM+UnVBrWqOXXSVIrMlVKN5pWM0u
hRof0i+wVfsoOpJZSfayyQYYrpUY5Mu8akItqDVJ0qyf26dhhBVlO3KgOAMHEeheIrznKvfUFep7
xCh0HSlFPeXrOSoGpBTHkSYRgvrRohLzMtjzSQASi25EEUhwwWcQI7u89nxm7bKbaAWbzjVNZB9H
29ZeszT95m+UvApT4StxdN/bw7ok0G/YoP99qJqFEf0YNWT4+MF0+sD/fdFbVMNoO5xY2QX55MZn
wVCGaARK9outpE8F+PmqvVvFywBrfZjojsuXUTBWJ0FGQD39rLgJckJRyB6EMiZO9sy+ZCRE7oAb
S5kuLNuB3OSpHDK3Uil0mFZoPiu3s83B/dTX8BhUDbmVwa1gYiOspO+p4Xa/TZL2D6ykJISCvixr
JDX8YOahXRWsoxiTbv4r0rqSNBWUn2+WwhKKgRzPTCXEAzmuPPXWTOR9f451qXoLVKMMUiDw1yWg
MXpz0WEdU8lWobC5Fd/DQgncZQkY4l1jyD75M37egGiGNZ3553F13fx62w6eAsgALq/bL3t1ZyzK
4dQidz3uybeY1HpVQdIpYZeSM6qRfGer283xoMh0us3Le7yqTHRFXG25NsQx1h39NqGXdSLzLWk3
1+7UuAjJ7mvU9cUgeVYOh+BdwSgAj6gRqYE+5opWkKIO7Y52CcfzSQunvEjcliswTovCeff8gnMx
iUFDU6Ve+5f0TWKlIw1z+UYruz5mwgJyqzRgEuN8FLJgjOdlhF6Era8eo39qykWP1Ud+S+0revuT
5VYEMbokbNRFBO3YhWh7LGhImA2OvHtOM1Bnlob3pqoVYr6oDgX6N+yJL01z6zH9mzE3IA7i55GM
RmTX6ND4KJUP3ZsLYR1JswNu6ZTYPQXAPt6wPhmnyMJGd/6hUvBkp/pXRf5OxoPsl79DPG+R+Rh9
MD5ZSUt6MuqhNULAsDv+qieV3pTSADkUxNTzssRQ35WCosBLToscl0AGQ31D0PM/bY5J3LEpz6JZ
i35VJsumos5QoCEalQ2xyWeQ2UAuEBqUxns8paaAAAfd1wAOTntXnX+F9TmlElrdlBs2z3TJxcwZ
i5CAcgzESYz0LMeYsxZj23kD+7/+P7v7H2n3AB4Tr2xw6/4Tr/haIBsaigccBRAOv7E8LsThAAGx
PCeF8Jsbr4AGxQDr4bGtMHhaJAAAAAfNfN/NADY3hfC9fANj0QAADwmxA2OHhbTB4UOEAAB14A68
HhOvh1/r3hQ8L1+i0B14OEBsW0AeFtIBEAKIgEgA6/aYOv+F2OABRYOvHR4AOcBum0VucLzVaSAg
LDhz58ODnyAH4AAALAADuAAJYBWMBWVzWKQ2YBSIBqUBj4CKAgD66nFCcVsKgTWHPGyA90ANt2z/
pyDbQzBtgbb/c//R/e+1/6/c+4D/8f2AZj5D6FmD0HMHX+Og2LsUNjH0o2KGxgDYvhQ46XkGYPQd
t5BtoAAe7baH/TMPIADbAAOQ7byDbfQNtDkGY+QAHIMx7YHIf+uYw20OQbZgRf8dszAD6T+xgAHe
94AAQjRMsmLcwA4nHlxAAPl4Hn5Dy8AAWWA4IRqUldJFZaE4gEpQEIgMl2gqwAUvrpbqhmD/IQKz
MdEQCECgTriIxBe7YGXkPIKJBsUPQ+QBtvoHu/INt2z3cOQ8gD/HbOQByHMYbZtoZiAOvAFFg69s
QPCeFtMHXqJAHHQUSDrwbG6/4SigdeAAAfS/N/N7bmPbNs9C2wAAA/6gHIOQ5g20AzByDMO2gGY+
QbYAcg5CHu+2/47ZmHkGxOvgGxg46AADr/hGvU7Laqjl2x1+1r9srug97Vcb5lbzrmtfdUVvLAz0
0A9f13rA+59v7gACgWBA5A5D48OfNw5PgBzHBwOXHmOYA4ADmlGl/P0tiigCRsoCs8jtVCcQCcoC
EQOCAUAFHx8EsA5BmPbA45FAP5/0Mxe7Zh23r/Xw2wAzHyDkG2h4XrxMAPCbE2MHzT6R80ADbOQ8
g2z0LkPIMwf9P8dtDMGYg5DyDkHINtAOQbaAf9AzHyH/rtoZiDbQAOQ5gAADkHIfdNsDbAAOQBmH
bdszAAf9NsANtzHtge6Zh9392AP8fQf+v+P/TMPIPPOyZ30tnjQ5yB5dO9dXch3LT3XDZpaur+Lu
BPIdu5YpPuj7YAPBAAAkqpFOno6OjnOj7vP0+E8N07W0G/cG5yNjYNzZt2bDlbANzfuNpL8byz73
1nwRDiEalP0Vi2oA2dwgFwgFTAQAP8gAA41xGqCuO8u1l+927lzKfu+m70IVDAT9kdlAGx6KBsYO
vhx0HhKIB4TwnhA8LsfY4df6917wnhdjAHXrSB4XYnCg8KGx/C2gDwvXvCeFDY/XgDr3X/CB4QkA
HhdjhsbwvXgAA694XYgeE6/14AANs2wMx8g23kO2cg5DmPMIchDMW28hzDtmYg5DmPbP+uYMwByD
MRyO+LugM5NmmErXBY04ajW39/9v///f/f/eA+3/6gAHLgDmAOXwOA58Qc+QHLhx4fA+HM4gOYPg
BzA+XIcQHPlzTlqollkVicVkcICETBUYED6exWKsAoEcPoAAZrk7mcjitoNO0D/pmH3f/D0HbNsC
fuopycu56enZyf3vaNq5Lkuv+E8IAB4Xr4bH6/17wgBsTY3hev+E4QAAH9jB81/Yg6+Ade694Xjo
PC7bmP/DbQAAf/v9/9oAf3H///+//vIcwch5AHIA2zbOQ7aHXQWxoFs6cGg2wFtBl/HbtFaqWuVT
Yoc3HzlK+swchzFtm27ZtvIdsAOQbbyEB/cAeCVBqwgAW340AF+NWWFVtuByA5AADg5uXDiHLnwB
yHAhGpUtnYticlhcticNiALhAQlAhSOAf4AgBrUsBUz3/D4Gq470nyJ7Jc/rcbz2OPIlyW5BhCoH
Y4detEG27ZtuYj+7+8/vf3/3f2H9/97+/+3MYcg9A93D7j7p937n3QH2h91/7fbB9o+3937v3BbF
sadp1sgAadbFt6fp4aDbWnhbIAAP/X7X233Pt/bDQbbC2tO0HTrZD/bQNAD/bQO/NO0G2gtjrj/b
T7Y0EOjwvBDo5unw+cC97XK6oHPhUUmQcFz9WJvFlCZbO5AFYZNQgE4QGJQIB/MgAYGnsgH9jHMd
5+gbZoNt5j5B6BtuYNszBtm2bbmPkAf3/3f2Af+z/307QA062Lb/u76YAAO+9U9XADvvVO++4d8O
/9U73vB9JdRXd9fRRX11dXd3fXV/4U5OX0V3dT1+eZ5/MAAmgZclyvxtjA5wUutAWcMhwCEaj8//
n+vRS29x2GRWJxUNxAMRgZg/2FLAo4hCnkCnrWdw7Of3HBQ/ij/vz6TyNrBMd1FK5diWkDMfu+xu
v+FAOvbZmD/DbQ957wkIQZizHmPQdAtsP/QD/1+6P/f7vDf0eHz8CeeIPuLvgAE4bYEdpuDcgDbM
x8hzFtm2/2/2A/vH9n/+f3ghiZMAhMwBuUY2xr7rnJkyd21b6vjXsK/Xq39hlEg7uFtrNqjsUf2f
2D+8AAf2ACu+8rBRbBOoFEA7QAaG47CArJAwKJAKe3sMXQcEHUArrLnw1uz8EjWFMztB07QLY0/T
gg01mk/Pz+9abR+sesaLRafRgeuB62MnkO77/PQfUA20OSfqO9eQ5g5BmHMeYts23MYAAZj2zkO2
cgnM5g8GDr04AJxkhp7WXRi6ulfSYcw1vVuksvDmvY2ksOHsrGuXbVbHeNq6kASAStXHcALBwCEa
j/27P9nBM3RxWJx2IAuECCEDATSQoRBYe00OEXxxZHDM4UvHLBGxfJyMxRGAovEEqEgm7UVJU9B5
BWpds/68gSXBmDkAbbmDbOQhyDkO2Vuv3UMmF/xDQQ0G2ADTg0/+cNsANszByHkPu5KGXhC8dLgB
Q5DX2YwAB/a/vH9/IMxBtge67byD3cOQZg20ADbAf3f2gf2gf2gA//gbbyENt20NszDmPMWYMxBm
HjpCBCcITjpCJCEyEJyJHHCAHCkAA+5937QPuvt/cALijcltANic4DcIEEIGD+QaMJow0ntAeTA4
yZk1E+o8JkHCWxoIBoH+/1DqjkO2hmPbADMPhPC9e2MHX+FBsXMe2hyEMw7YAchZAH/9nVwB//B7
+sndlgAH9n9j/+/uH9z+5///3P7P7z+//+A+390Pt/bPth9sPuD/+P/7///tD7X3B/6fdPt/bACL
ByEalJ2+R2Jw2Jx2MDCMCABFBFmD7vXT8DMOT4ZLfdMIFvkIfBSfTKOTcaSynISDIZG/qSUq+Qh0
f8vu3HGeh+ge67btux+vbEDwgeFDMW2hyAOQ/5OQbbtm2APkT+6h83819JsS0QUSDjqKJB16iQBs
Tr4B/cANsDkO28gzDyAP+u2ch4QtbF5AH/7/d/cH94f2gAP/4Goo6vmy3zYFG7YNe1te8cnIba0P
+R9hrY8znlQU2+l/Azb6/scNj0QDr1Fg4RGx/C9e68AAcwACYE3aXHYpJYZFYnHYgOYwID4LAAB9
+dPoAHa79xr+nqeQDhZWAQ/+mY8xf9eOF/6H93/+f3jr2xuv9eDjoLTAD5r6V819IAH0rwvHAdf4
QAB82ADbOQbbyHkPIdtDMW2/41uXkHHC5j/x/v/uP7f7AD+7+3+3+0A/uH97MXVOXMpZa5Q53pTf
+rtb2z8lu/OfumLcR3u57L7+o3wz7beKchEAD3Q4IRqUpapRYnDY3HYgKowGIgASwEEI4/AFZCIC
rkdRzAhgIBKRiKK0BFAKJRxyGStwydeaRxMQmBHX+OA69sbwm27Z9KD4n2f0h/YT8h+G+n+Q+m+m
+RD6cfIn9020PQcxZj2zTtBtsA0D+4P7wzHtvIeQcgzFmLkGYtszFgJa3L/l9AtEHXwAAAOvB/e/
/AAH9r+/+x/c/sAAPCgHhOvgHhdj7F2JRCOvf9v9/z1nitjrrv/89bPf+ghoOnAAUA8fI8vADxeQ
gAATAE9K7Q4rE5AOIQGIQGAP8gGykOL+4P8BJ1HjHzDb3phN7P8r8QFtBp9saDbGnd/2z35bQafb
IWx/2tgA08NPtkADkOYA/65hycX/rmHkJ/YAf/vXtidfDYgB18PCAHXrTBRYA/v//X/6/s/vB/cf
3AB/aD/1+4/9R9x9sFqBcDghGpT1rctjkVjcdiAqkAgA/0IABB7fChS26snM7dz62tV56QQTfzYP
LQzYXm7H8J18A2KA/sf3f/n94BtoBtgBtocgzFsfr/XvCcKAPpPm/pAD6YNtDkOY9sD/Hr/hKJB4
Tr5ACNj2kD/EOQgAByAA/s/t//wH9oP7394//n94H/8BsbwgeEANjhaINiWmAiAHhfdv8oZi90zD
WhaBLtvoHIcx5g21QNzGtaRHgH+HmAeLx8P4gAAPABQWh3WJw2IDuQBCIWT/IjAxA04+9VABlPYo
AeTHHM6jyI97t/kB/+v7vuP/f/0H/v/b/f/eH9v9gH9gH9n/6/s//v7v7f7wf3f3H9v9n/6/uP7v
79t23kH/T0DbAANBC2dP0ALYtgD/3Pu/cAZj23kIB/1DkIcg23MW2ByDbQ5DyEPdgAUJiAB0eBzA
dJ4HMPDAAdIABEAA4CEalG2+R2KRWeRANyAIRAFjLIBXBlHX4AbFtKgQkQCeIgEZGY2NaUCikcco
UUiiaFoIJgBsa0QcIjr1FgoIvoPoeYPQf8Q93DkHXg2IAcgzByH0AOQZhfI/IPmgBsTjgPCccAHh
eEAAAHhB9KPwj8j+E/DzD/l5ByD/p6FtnIfdg5DyAA5DyAAi2x+ynZC3/i0D53vFbYKf54h740Pm
vbuhoTuabdG05MXI193psmQuzYFua29AC2/zoBbPXHfun9daB/34f/P9Rxn6P1GfQSuaecZ+j9S4
6u/f0PQegAAHsvZAAKBAITxfBV0eFzPCeH0J6eiXhc7n5yukRUSVuLOgPH11RjRJyAjbc57MB3IA
hEAtAACy/1b65HIa3YSLR5ByH/AK1LtlAl/x5ByDMf+XkOYuQbaABmLbA5ByDbOQ5jDbOQ+gbaA/
sf3/2v/4A/vf3f/v9j/8f3v7v7AP79t20OQbYG28hzB6DyDMWY+Q5gDeAchsDecH22ytt4ouR1wt
Rvbjee8khYWjoS4INIXGHZ5v3Hcm5UHnOmaSpzbnPtHOil5E5q2nCAJAeu9soHrntvaPWHrgBznR
zHMkEqkyVAchGpR9zkdocIDYLjEgBcgAsLUP5qUoGRbTATxEgnIASBAtOASADhQVqX/Pk9lAF46X
0P/rmL3TMf+AbZ7rmPbeQBtnIdsDMHIcx5jzEHu+Y9tzDtvIQ2zbdsDkAAG2Btm2+6ZizFtuYnyP
0wfSvpR9KP7CBsbr3hevdeDwu2Zh5DmLbQzBtoAAZg5AGYeQ/9f8Q0nPc8vdxaZfEh15jjsmBYV4
tfc8c/7TkbpjNVO9B7R6/1/r+xevcIALQBsfhQAGxfC8IAOvh1/Y3HQdeDYwdf8JwgP8cxZizGAA
AAAAG2g/vP7P/0ACz5Pi9Wrs10491gg6OY5jmdPOroIR4HRfB8Pp8N4HESg5uhz9HRNuAAHMcYzR
nRIuARNwATksQBsThAzBcYCEQADawNPH++bdASACiQEcRY2KAWgjYtFyCQJAAGxqIBaIOvde47AD
bQzEGgW1p9tW1bNtaDOIMEHg0Fg05DQAtj+w//v7j+5/af3f3f3/2/3/3h/a/v//A9CAA2zbQzEG
2BtvIOQgAQj0f0nPulN+x3mXMTiee1OWqO1b1pTs1xaqLjz7z3iID7z7/zh2jq3WHRvWNav0t9Dn
DnXfM8N087aABt37Tl79vLcrc3AjnvPcmAchGpR9vkdhktjoTiATlAgIODBABaLtpY69aaCHGEEU
UPekogiSEE0A93wApJjOELtv+fMf+GYeQ5MZtn+bbcwe7Zh/w90/yeF8KHX9s5BmD0PkHIMxZh+n
D5r6QPkH90DkHoWYgA+IB7MP849l8R8SPZ+zfEH+U+J/Lns/ZgGnaAAaDbFsaBp2gWxoGg9dgAW2
AB3/133/+f/P2eK29A07rjQAoJzgjEdA859dhetc9qj3i1ec2+qWrfuMZC94qNt8Iq//f/7/9D+4
H9/9p9v7v2n/v9z/0P/YA3Bt3AADYbgAcwdIGw27gHOA6Tw3OTNxkthkdDAhkAYiD2Z1DgAZMLtO
jQGJpiAtXUFCe9kgDNx8UhBwtAM1Cchh2Ytt23MGYuQZjzB/jtvIOQbbmLbNt5DmMNs/xDbQfIny
P058j/dfp/kHyPyD6Z8i+R+R+QfND5t839JbFtB/20/QNB0/5p33e+qHfO9+a9XA74erer/Su87x
3/e/N3c/Ff3V9vHrt4nLq6yviNf6LumJprlzxjtnIa/sGExKhPIPrpTkqxhMdwO0FxOge493/F/h
7x7juH/pAXmAAwchGpTVvktjcNDsTiASlAge0vJI4gQPHl31Q9rA914Ta/g1lQCnZ61B+PgQXmyv
3t5/4PfafFMFmuHziaY7g05nIByENt5DtuY+Q7bmPbfpD6T8gB80fIv7v8h9MP7v9OchzHmLkP+X
beQZj2zkP+OYgAOQbbmHkIchzEeE8LodPhouei5/k+S2rk/9eTV4XdZFr3zz5+uLBhWcS3Av4M1a
198DUk1sf9tPtm2fzvfvfv53T+uQ0C2e/NB0/T+uQ7966D/tbYadbX3fu/c+4APtn33m+/+//t+9
8484BQjVAg5vhz+fw5HPhxAHmHgOZxOHLgA4uYceHE58CNtUjdNCcNDAqlAgCCEFN1atJfsB4Two
BaIA2KGxOvf7h4XYvXuvad/2tm2PpD5ofT+y+JfEv/z/8//v7v7D+z+z/8f/n95/cP7/7vu/a+6+
59w/9vufceR5Xn8vm8w85d7zFFO31/d3V/6/eLu6n7qKJ0A6fC+Xr9bsKEADXtmkbLiXtwr+owlg
1qS8Dofc3mvTnrr+dn52fnZ2fuor6/BQJKcnEPly5DgPmfPjzcnPlwcOQAcObmDk4cAORyEalN2K
luW1yIBKUCAH8iugAKMl9AIef7qQ79FPx3rzalk/DMClnJcltXJc//72vaIotq566u5+7/tf2/3f
2v/x/a/v/vH94HIdtDbeQgAchzH/0DMO27b/0ANt2zbP8Ns2zbADkO2Zi9B5ByDMQBmPbNsAOQ7Z
yDkrxeEV9v3ZuS+VqserC5VN5s4xfrkfkgY5vR0gHf2gf99BANB/76f/toOnaDp4BpwBoGgBp+n6
B1x11oGg2xp+nW134Ft6AHq3ed93jve+A9UPVe99W759y+l7133ed+7wAuEBccXLg4jk5cnIcnzO
JwchyHBzABxDgcXMRgCtrjoLjsxhAgkAoAoADgfb9wOECAB/t/v/uHhNjhyALangL/76/z1hoTma
wWCBOILh05CCweCA8/m8vnPIDzX19OX91fged5fO8oAGOQnEFg0HnE4mgTicBNAnM1v9tny905lx
PY1GRos2xiumHbGcILowzZE9bYAZj932wMxchDMOYeH8OD+eeb/w4MbjADG43z3ugU/vx/LqQaZd
pcVlPw4UnzvakaDgAAACHAGeGW5J/7oXSeQOaQWnZlpzr8d8VPwnj1PRJ5Vc9+mEqC9Pqc/fzbgy
FOUAXH7DLCyxYEmvzUQguD18y4+jOYX40L8v7K4edlAuHu3WTeullflCIcZPjLkgnFg+8K8BuF+6
4zhbXTU24w2qt0hplncImxDKZ7lZssIyc8pjAC2J7oBKIbc+HvbfxKi7ED++guA8BdpbsFt2M6hF
L4kSXPcRZJcZrCfR1Ovv83mSFp6m6h6P3TzHvvaab9QevoQ8Ut4x8Dx27DMLz0YdVQR0QefJyhAq
EuAv2tyh+FtqdCxBNfJ64jUB8M6h1d4xxSWTOdjsnG3nG6KVYhzNTBdpWKPG8Y4BYMKL9bghlCD8
A6U+ja0HVO/jEYYgrJxqT5nduD1mvSsCe7bIQsrWrKzfxQMhF3iAnmH9vqH6vXOTw+eaTcIL2sVQ
22KkZn/eVCLyZvP2ZqsjUwh6fX7D46wHE3LokmOavoP44rqWwz9IJyWDWyK+kN18toTf+j+d+Zro
u1JmDLMZOO1YZjNz/yXYVm25oieDPIzAZXWbHaQ29IiCS8goObsubuqzgbfnQixjq5lUCdHunFtO
MJrxCnMdxpsYxQnDENB2Php8CXtfE0OzaCC+of3aYCbLcEaMkHVi/L1ydywQc6JPcT4gKiEuu3ZV
WNi1NO445hekPwtnAH+TU1++/NIEQR9slDI+F00QlIfjmGwrZTaciNIakQAADkZBmhw8IfkymAom
P/9StUE/Zrnzl/64vWXexmQrujgM4Eo7ZXUEaXU2nHh6pQ9p7dakM/PMC/YKonVi1Sdtc6vvz0AR
yWpSMvCby5L7e/5R2IpzDqN4Z0jqjkJaTkqkBbkvg5EgqNzqa0irtBSjs8F58v0mUqD+QDCleidQ
6BzNvm2ums7EgmXmpomEWkZcSnUJ5K5HOKDbTaeU44gDzLs2UJPNPlJCb1F/EHT/tMLKoe7qykQv
7R/CDRrHiIMT0sFZYGZb8wprDZriyiSLuqCD3fUTe+gaewEWMtxtJmlaDEXe8haQvEAGc5X02+8g
VmrGWBQ0gQU/1o8YcsH+UO80z0fVScPE0Z+MvAH8CX6rFI1woEHDRTfuR/6iBpI1J2wSjzvW/6QZ
8BLzBdTtYx5vPfOD50vAc/BHYRfPIwJTg4UYLBWDpekyS/8K+Zs4m1EC3/vEXa4gxPk0jrj8ace7
PKFpOzqsmTZX6CjgIu4d7qyrx0FpJgYKptMAPJZ3UiWafllBW9zoEcYgvYP6HX2OiHISoR9JAARs
K1zVefXK0FP7j0pIkcsXDhvZ6IuEYH2w10rbNKoJ3d8qEh/Cn/1hsu/mdVp10jpfyJhR0sOJTg1p
5nt2Lr51RzngOrVldYHNehEaW8NWlqlOq5+bsz5Fh34KOwse6p1ceO4/eXRbAoxKsG7Oimmcr4v4
gPyiocEobO56D9Wjy+258thfJNBFbqXhJyFo9dctSFx24u2ISWLxCBUBOFWn7I4SUpRAnancrqCa
Va3Q+A9xhoPj7IbKcH7n28wwfRWI9MvvkUx+eX0n2bz0ph43ipS+cjtDSINhaMVYw4q4HBYvi4O/
2KUkyXxKI2KwY4ZOfqKDKnSrlPug3yTdw6rSXR5C+IU5N+/QUXaFGjVuHt3uhFY0HR3j0hXv2o8d
8KxTSsLauuL96+s+jLANCvAbXOHqgIEPwyTUx3hZm23QFuv0LO/c2DNTGDVLABau0l6KEbVMFq/j
pOFQmqpDA3mxT/tm85bvtZQqD6ijQ+VBt4Xkj9euxXOIzsMLI4zvi2ux2tmuWH2ZaS7noCb8Pgg7
vfTXXGmVr7Qz4SPRlJgMBDtBw0HCt+g5rWBPLLigWYfwnvI65IBiI7pTNsDrfNKqVIxmAVyXuATo
8J1bfbUBA1kFxMdaEnqzKDd+wW+XSKzolxh+RoymaVqt1HQ1wMFmQwuUa+L+KO6gMsPET8frrCgb
i8OBMTUU/E6d5FRduP9EjJ5DDZ+3V79b+KtSiteAmwSD6mMgZ6KNm+EZ+HA1dD8bag2yDJQdbqkL
yequVftprsVOpS2tNJYoJMf1mvTZthiUnE4cZMGHveoL/Dm33zut7E8ZjZmplSFdDRsSXgq5AteJ
paAY5uOv6/2UP3EMy/Fo0ydH5IJyM5zq5JBgSRbWyGC3aMNBZmNo/0v2ZmIeQRDPT61e4+Jkbh/l
fsljr2tlYeGrDFexo0CLgHjL4cUN05hzWYLA2SZK4mPa+ksiTAHimFYGvQkxI2PaW9NeSfrQyphh
/00K6DmvmMDH/hTnMHlR4zADXjTV76CUt76lBYJdtbUHZ4bdS5OWt/uNh/gsyXGSFibGd0s5OxTT
VMcuzRlL1zKmS7rhBG/SR9iVXhlU4djoOc3rHX/dpxcOgCnSwXbutqtBOlXLGqbM0hf6fUdMVAgk
MmPofrd6yHBstU5X6UEqNlUcDgx1NqDh2JHYlEDvr19UDVUUugquDfbteq3zEk4ifLtj51Hl3X+j
wZigH3QK8xHTfcgY4+r6IxKJRC0tvABvUP5XKCjIc3ccoeAO8cYrdrkHVXxFaK2bPa6dSGochzkU
xj2Wz0dxBaqXunP2EdGGnUlemv/aumi7wWv4qLFx73FiWxHEbsKTaSaYr1ZZEnvX0nZf9iAd1TqV
Gwl2BSC3s5qu92PLvW89Q6nrhDVwYcmT/A34qpP1r+msGeRPAznCzaONQQ0fvw0bOlGMiDnjMhlX
gfk3X8sh+fbSrTbVoY2wY0/sVNUYYQj3IqlHDJJWfLn4A7oVZVw80UNGWYht2Hn/62Fu7EKgJk3X
jJjHwbo7yGu+AT9cZuY5A6LlI1xJdZ3F4g6tVP90znfBWE+oHsm/GMpiQDMa9iVWWQF6ivZ5I/fE
BwOVuvKeN94VTjUGc9wBfbG7uQtcstzp1aYXnx9LrLKEKS2T2krUkQmwt/Ewd+Ynbe5xTuxuyneo
I4776rC+2CPP30cEQax0IZXuaNg5amrk2bmqgutOqDUq/+ZG0MTqvMvfyiHoX+Z9zsJshzF983SL
/BHNWgdPu4SVxpEW43J4bS/kn5Fkj5AFl83HH84R28H59re8A8osOa2Xcj2289FFTOqSIK0LKkNt
14BHVsXJ9QBV2ZnwAr2hiRRoonKRXs3XkPe0gRo7oMB2ZO5DsjvQpJec5bQDiZiylVdc022AEGvP
Q+1aZLhKdNmoReWQRDqvAj2n9BiGunH3WvO3shol1wMeRIS1ObBBRw1roCxmiMEKKFNuFa3o+PV/
4T+htVxOrO0g2AApljsh6W5l8lCWycaSVrG/yam8RWmrJbrFvp42VRw4eokwjD2mFjJsinNFXC+T
a4WdbQTnHb8PyBAzMx5UqMAzgeC4uHOfw7kRClRxpgwpwFYq+y9vixb1MHF028rL6ZjRlWU6wEzq
O1QSIcWe53L6Z6b8zAMulr8tu9WPI8NPUuM2Xo4WtESL5Dv42R35UydrK6lM9fA8kACIxsfrZY39
FGrfxrMTuCof5yz3veUE1C46ilVKQb3dS7lC6ynSy+TCsDjS2TTnlEwwQLQGQPz63/HCV6hzNU25
D75g7nCq377zEJXxxRxUJOQorHgyXmldULGYQZcT56sig9Nm1AOvZswRQJ+rr3IrgwOeSWHQk/3i
y2BU7kLlh7HgWB88iRSNGl1kW6mIIJ8jmUvx7F4WLGoB47t0AYvO80HUwmsu3FECd37oL0lcBUmx
GHBeTdXU6Mnff9c3LwNjnna9OHmAHnAjBM1mNyrmddbbce5WLD3K/gPWYifNvxV76dwsfTAQoWPH
um2Bu/tLtkccczFkXbWPyVWuOTLqOqgoug9oX8ARbn5hJFSeM/1ZWhL16F3HlU68TLD+omdRL5Vd
oAfK686HUCUOgn57YtaLD6j6ljCDIbOCtUMFIF+nlB5HrUnmZbiiYYXN0iRXaXgyHdPQq127l+7E
aV5vzpABU6gQevGAdA5qqr/IIdkIM7PkAHGtQhTgDcNSY5LuuSamN6V39ZDyVImblL6GsHx2QUEB
oDL2GDUo+qkCOQ3cb68VrzueAlNLptrxZpBssfBBujtz5pat3vf5tXz36obLixlx6yhXO/i0+uog
EQ0D9kt682EZTDB9jg72Iy7ZJWKhK2h5dC5AoJ+Ax2R2LkCZA9/w0BgxJWhtyob/fVv59VD6DPZU
rjzxqiLIiAbeV90Psv+vojVMmuInCvhlOcM3T/3t9OMcJ4kKqbB79U++kOCzoxGD3w0AdgrQe3Kv
nbVAtYzQ/nusk+RtGAil95CLaPbxyKTaV3Wg4Pj1hozX2WNM6op7aRtHDgbng3muOHIYCXOHk+9Q
XxGFXwt2+NXj77MDZrzql950KG13FsdDuvCLMk+oOUYcV5BcBp7GtBjYmfPu8osnnvQRhgoYUT92
XBNjRTEvk4GtUut3aP9R+Fn3a0b2W2s0i0qv4CvZpfcYXi100uyqte8JpGZe/Af7BmtwDy4rBAZc
hzJpiyNKvOCLktBSfDz4yv8Zzz5OZdYjOvyKcwiuggrBxxAwf7J41wADMxvaloA7mKOwF1urUf1g
83ZMYPvP99CGwV00kmAj3Y2tlS3Dxu7sGv6xiBaa88sd4/+k1lTpi35oBoHAWFgyOwMSDDaf5y4V
/kS0wsmBw/I52jPR7pxKWfKpUuMdMzKnstf2RrmDqnjow3ABunlaQ0mY51JbeAzjVBfh+V/pgxoz
3Us085lVr19LKsKLtkeW4sbW2PXpE+CElUejI3Xki6Q60bMMSX6iiCjJNKG1JDe1tf4MLKwgwoFq
5dspmHVC+lQE5fb+Q4KTFDi7kA7V17+r+GtMGcETZNsuFDS6d1dKZn0BT4Q/hDz4OK6A4sQvYlz9
nl2nnoz9t4Pz5YHlPNCI1QRz5Bs3uLkdd3wAZ92Su/C1LXSa2Owj5ZjlJL+YfeTpwGGsxhxsHOZY
O9C/fkxVMJJQ4ru8H4h+RPLoLvxYfF2evN3+p9xBO2jAULYcWE3bjRL/Khhw+1W1sUMsOkERFz0T
wUdsYUgD+MeDkitSjMN55uTY0WO8HZZqv68724CvDI1yR+egbu+tbsx6zMQmZQaHTy0qbW9AJm1T
ShgwmZrSvxGR5MsUv+0D2WPmOhNM02v96E1VaDtaOaugjz7RYGaAlvaW4yR3boSMF9GC9wp0LSKC
+GPHwKBi98J1mb7ALbuh1sIY2O0MfTEehnWmMCkLyc/rFHkEZfkQEpmp4ONE2+6kbJzLeWD/mkRE
LvisDM/cNX+OByJ5Je2I6GCIs9T7o/PdI6Abtq6sCRunPIZ3adv2esxfVij3VZydOckLGhNWRoTg
Tcofy56zkmB9O6u/xomRz6kJ2z/uohNWOqRR4G6w+pcEUjZmFV8/4AgGjtopSdxHFjtaoDS4IsA4
t71z2rEekqnJrm6iUGZFfpSttfDtqpJYdUJK3nKKHAoKRCrxzCxYLKla9uFfMgxzwf/KwOjwQtl/
wrJ8M7ppsxSt71jGH9zcuDsvltsY9Wo+Zvd6TcA6GE6nYw2MSLaywt0L8V/NiDXC0qPHBWeyhwLY
Hl9b0H78gj4pgfXeMmQTdVa8xKAI4vjh2xmkXOzrZ2eZYBMMUR50rXVnSNRmj2fA1H9PIvAAAAC8
AZ47bkn/8uIwh0ko4DxpPbSZKGtSt3g8FNyDyKMyAmASh8JVqLnvSsqnZpmyIMSWGxKsL/1X+OYn
5XmUxVaRNh3ytIP7i65a16//7yqXDF4h71QGbt1QW3yAn7rrbvdWK+StR8a3gsowoKcTtM6Q7KRJ
KMzk/80aJXwINYncQPwnL2GiK9SjAw7G9s1YR1jerLHSG+TJW8Gv/q/I6PtSqM+ag0V83VvKyz7h
ipNuQ/GcTubOwdQZsJHQL4EAAAxiQZo9PCH5MpgEI/9ovzd6TJ+ZnTLiJ1n0yvKzTVaQGR6GkjLA
snhEz3jNUyWr9xCRw3d5SQtxhgHg9D6yNJYIQy42OPFxUNfXWj1wq+kkKFOuP6yvRZDAC6m38sD7
x3lNpk8lHU1XPiKTp4N6X1r2yUkwiyPENveXXeolmW9XvKJTi701vg0ZjHIIL4Tgkqw8pIn5Cp7c
n0UdP6bdeVOJZ9yL0++1a8nYGtc4mmntKU0hXDOoObVguIlpZTAKZ/tda5f2i2bhcjxEQjbQhau8
5WhLOdX39ZYWGbe+VMoP2I1+atCNQNo0P6A2a93ZtPhduPtnLKhv/O4Jkqd7Yjwk+ML4OkAHryPC
AhZKwZgdnupP0pIwQR/uX4Xc27s/oqj6KXEQnNpJ3vr+7o+TCV2bRCindJmD72BzDLUTE3dU5Qw+
hQQRkQMMG01Fqw3ptiUL3XqMtT/I88pAO7xWV8xfSjP+aVOA9tlZat3vjE9CyhGh3fBW1n/BXkbk
ltkj/2qk5kFeAX2CnDp592epRflNVey0GSfvDxpWKGVQ8PFv3TFaSDgPxByeqNUai1gNJvFsdXhR
aaM7FyQtmH2r1o+Mz8XkX45Z+8P81DBNvbwpaiKH4IMRd2xibKOqrXXEq78P6o+Cpm9AiXOpjuHX
4r5t7OimOhwrba515Gz0svKxrHsvv3KaXa8K7o1bDlWAteyHXq/nd5xWTaVx/+U6OZVkvQ8zJF+F
9BchNdxAOXNPQG3tOPqR3yycKi9KPDjkdZb+tqPYy1Z4Y26gj+bRkWJUnTGB1G5nIANypsOcbfZd
FjnsTmejh1bQf2TNvHgL9ziN3acm8Zvsvxaw2Dcq3bEi001uUwH16vYjyV3pM2zwWdz9/8lMsujk
bCmVT3SWIuJi5FZgo8IkhFYPdqVU5wAlnKK5CJzMB5u4KC+bXCD0YE5ff6uDyfNysLgzikmeBHZt
AigdqKYSKLQnJHp8WJFQdA3fo81NnYwg3QdYMS4DsP5S5R6v18ldiuRdjWu8U2pQldxJ0wJG2zxD
t6aHfIG7pCydh2SDfmaBqT+MQxZZgELqxPGHOBFADr0pmGgTQeTlj8JpPn9NZrAW0dxfvqviIFbf
Q1hwDQVkfmdTUeootp0mK3kviMq9lAzGyK48a8+2uCj3J9YhbqHTUanRVccxMgY8TgTgGfSy9or2
wmdHOT9069CXIofz+S6RYTXrTjIrYOpL/K7khasu8sB4YwvHJiVHjO0H+1YNwGr6pGIlNnTJM0z+
SV9klDrkiFioer438Y6g7qFGj6ctldwAgPVhsPEDOh3K255xXOI0V2ZztBiziZvH4somzDHWZ/C8
BWrHil8KtUkS/7/pZGG3bcnn69fs9TGU/EfaE5mMJ1Ni/hPMlbzl/wouIxsnOkyUj3fJ0x4pnERm
EW5UMwEqarinHjF0B8/fuCutKiHKkBq3getyiF/p9SkG6pSjlTHJr8+UhOShgD+nV+hflSVGJz0X
3YP+2mEHaZjb7Ad1d2RhLFjPW2BhnKl9my/mguQ9QETxWknbO9E1I+5VibuntLpHWyUidsB5c9f0
/CKzd54pxx+TsoBmLSVG6LLEZHAic1HlYvjiuNZtz43oT+oHeDU1eOQCVmG5uSymKvFUfCqsEb36
S4pkREwwYsgUNj+OFuAlQdYvrFcdWw1Oc4ovze0XLi02LPJZ7tFA5RuGkKtx2yVKze2WzNyHd0wv
/PW2vShmPsF8mG2kShSkQRWjlh/Ls0P8DLCp0vHGj2e9jwwJt32p+OmlWuWzj/KvyvYop08egPOe
ib5xN+NRQCClzAk6vr9gUHN0uuW69+TmwuAwT0ojG7izVIauvV6CHs1LW8TCmwjDqu7PCIP9tjya
priEFBacnFLnYhtLUA7AZ0uc79pGyrX1m3T+RWVMe1MoE+4Boj6W+R5djiEffdZKGnyrPQ2E8hpj
Y5AosEyX+EB0qc9V4Spwuu9m2Hp4RQod6jvwSgBjivHKGjC6+MCdbX9rCaXszXwpvKbFFqFlEOPq
wQtHJpRbnCJ4h3Z2BSxziny7axQ42MGykj4teq/UWeR+L8jWg+eslpASFF9/hNQAxnxKcKCVSqYk
1MPJwPWQB0guo1W1pkT8PEkMJUEkcOcxY8dNDmO4+5r0dqxt1R0RAezkti/Qy+B1TA+9BwGQ1QCJ
WX0XlGQX95gVyMxUzyr9lUyd9z5njlN2zU+mGHZsVtF03CzPAHmCcD4l/LPN6HTpshTbXDpgMKZe
SFuluuYIwkERireM9pxHelFwgBXcyAylC1esGy9WNzrL+KBQn+J26qdG/+cMGQNWn1M0Vtw5TaQO
JFkig990lASXLw0xtc82tq4/wM/tjFLRzr6k6ZoBoNMMvUtIVxJXrMOKltgQDSnFZ15PBn89DlDy
fx4twGaAVN2Pyp7oXQ9HJc7hckzMt/f+rqttFqfSYs+c50DQMnzWsZGQ+AhFVT+Ba2BZpweKS3ux
QF46W6gYYokvax8wWxQdiNzItfj3/Sbhwj0CNSPbp9nj7IT7Eyjz4v9C4AsKW9fsPncFOmyAZncX
QMPEO5e0xCIpxbD4/GFmnWHrIJvoSPQZflMB30FAt4hCyitFuT7FkUrViyLNUfIN8gxhDNX8gyrM
D9IJdfq1Tul/r5+tBS1Q+NCX+xj33/Y3wjyO5sVuwZ16RKeRBUNUuqlQE54kSZ4mDxMQrRcsq+nM
zvxuB2cneKuLGBUl73DYOZ36GZCotd1PsA0N9hdgfJWDl5+U99CxPwi3H74SVgKOObCKt9yMdKx2
s8WsEVmuul97HfcSwt+cbIQy7UQVjjH9+E9gOeSPPK+3dH8y9N8Sf9BIpn0aBOQR4Rr2dgsxb6nY
2kGTq/SnH0zaR01wxOD0ZNAK6JqierhVVgnj5x7TkznkB49kxAVPEegErJKiWzJy+4nYZ8GX6pdE
KtEH/wm3xGZjg7A/H12GgnCUM7MClLFfED5H5ki7wXLUT8ydHUjwW/9uVBbiRFmLgs8cxEWfTpt5
6zF0E76JVRQeERAPHMRoYZ5Z1N17/ckJ5WIx4LFFUwggljPwMo6TKN9Qj9aZl1niko6YqUl5gYKD
COmc8YUGEKLmavVp51lFdB/g5kYDWHd3D0w8HVoeI92GWesUXgMLD+plACJgwPoqZJbhHxIYBTCY
fCmqhAQwekB+sXEU+EJL4rreLGyHGoKnumxBauta6d3ioULsv9ar+R852PiDosMmDTMQ4RSVneF0
ACihElZWF6TF00qY5LrVP7iLrKVX0cTYbpgxwxrpk3kRmpWGlNeVNqYoYSkMETwCtAIMVNE+PyIZ
1mj8e+6bzZXs9GqKtdNRREZpaHd2pjggRQ8eBMO/WcBjYKB1JHWq3YT26SQhQURafKxuWbWGM8Vx
JV0Qyehk3m3UKAP5DJLpeO/L4TyYKLcvBfm2H/uzwCT7zuGfQ0m2eplJXdQe0SJaLCUz8mPByrCX
cvepFEZGdX1hbdJPU7x2bf/2YvuvbeSloEYBZ0v+/1DG9vCCtrX4C3ng/uXG0qFCMuWIS3kO44Iy
OzW9u/K9oirvBXJWccuy5L+OywEUdVn5Aphet9U0auIcXH5TaMPbl49l7UmLGsS+cqQ8gcUU9w6l
pEabhEjYuXo8+SvS5HnakSfNlAj0EDuKzLCLE1ikCyeNhohQvLcVac1p/FK5Cvzd7d0jP9+kj1yo
nh+AckuFNB72AwirmAO7U+WLZUZzDa329eRUu0u4bJmUI4JGknsIhwnmZRe1YQ+Md7P7+ykOxhGr
YyHFnc9SO0m4JhUpgxlUcNAYV5l7HMFeg60SGc/5AN7UYoAnPnN9CGrtqTNV3QzUPJAs/OQhO8Ef
vvadX8HnbElt1Bawa2yS7G2QWKY9d0u2aiQFe3eli59MlrcRQtEYorHTDzxlnTLQMM4Vs4kZH2k0
VhEAbtTvBlEtoRFdIMNpMA7jPiaYGUybvJgHdTHtLGXrvU1oiIypTuIrfLQhSEuTA0D1/F6d3YUh
BO1WMJgSjPVZMO9IKkznU5sT7jcfqxX+ql0C/EDhTwZJpXne0F77llzwiEmonC7Tlynt6EVOYhPM
jgwSmSR5PYUldwdjSfPXfSNlGjlxpYpgcIrkFjJyJM60LzpMCuGxly/r2J4v2LQa6CIkSNVIDUkJ
j2t5UK7atyvlkg8DtFiHDJc6P55hThgPfgwkZ5EAPzZnmPvojOQjkylUrWibeLuplK+SAkBcUoEA
AAKkQZpeTeEP8mUwAhH/WkapA5pb2n80dLsACe9DlKX/NEd/HcoaBRhL7clm2PiZmfU98Ln5r4ky
FrRADh7Hyoved/CzysL+7/wnPFdK/yH8gCTefE+t8paUfWeqFPknk2QdWdaum7CwYIm5U8HmlX7z
PuWfxkFBuFztuj1r9d/Rbj9UwW76r+V8Jt9Tssj27yHsffXFBaGKJbR0oXqApUgouiNuJN7gskpz
9sQJBGumtnw7LbWEezhkb1PZuV2CmIM81mcPJUteQl2C4xmhx7a3Le6rVRDeUmn/kBehS2q0lvci
YZhutRt0OJQM9el/J+2/6MoDwHM1x9XirWTL+5XVz17JXbpTUoH+fnE8zHhQbAEGqi+2pQ0pMbD+
0E0y1e4UT84js6I+5XFlXjne4YQB0+GxD6jXerno8RyJQjiL14ZNfAxI9VPBTojAeGkfIP97CILy
sHa0EVkihO/uH2Y6/3SgmKtbm69C5Ddu0Jms7xyhGgEf/T6CUE8yiIHc/1kGpKZs2R2vJ7qh+GAc
uF2e8N5AAToqAtOcfE+2UhLpZY7j3/nMVJCoWKhITpfjpGnEJwc32YkIyTMiD3QHhlwDkTeWMFJy
YLzzQqsVEooDClSmZFqA8T3UW70OSsji2kHV+4IzUYqSqS1ZxgFJ4sWFgsTz99nRD858QgaNunfV
GUxFhZRPVuMbwR/EU8FbkvDQZRk4MmKPpRxlQPI5fOfranroTNXkgAub6r0XwfMN6wrqQBz5VPhe
1uUYU51FTFtm6NYB83lPV1K7qmV7YQ/wfNQ+lSGbEcjcp8wjLHOQQNrk1oihzq6K4+ek4YMtMRhj
sq0FdeG87vOiActgcr755CukmXBLOyzOUUdYUc1bxHRYl4HywFQB66fn/GlD9MzVA0C7wAAACOZB
mn9N4Q/yZTACEf/qA7I52U8yDKTDhmWPYr3DbRY6CslgugzCaD1s0lvzasaFDekoTZJu8wk74KZv
Ay4Dr5sXWrSH2apJjGeXN9W28/ti74Hd2iE0a6on6avWh47eylGTyn4Bdv/0aMPiL3o8wjKs1pME
C4o/cIv1JpGCpy3lNJIm/9agbG3O+acsfvUxlG0JI7O1N1ZbbRHFqFOHp3rDXksxTiF0hWdDSMIk
3hxIYjCO+SYiOLcyaDArQJkYdO5GnMSvyYhbok4hAjFjIMj5v4QCpessnCxwETOq0BocFCdGrdyh
EkjpOIbVGi9/pz3PhHXQPgecWMuOLSIymp7GVA6i3tq+7onn7Sdm8AGDm8Ej/mn16V1D+jh8TyBk
Mo0qZN21v/zrTsAryC5RyP/Y4nEtikrBEK4qJ4K0d3RNbIRoR1XvB1qrc2mfOqy+PBw3HKXo/RYE
wEeBTlDmQWsOXU2Frr1gJLc5PywUmeC7O+/ilc2we2Pn4+B3MhnNZxqnt+KkPSb0WV9EYajGH7xd
02yPvkCZfDFrxzcfgq2RarUeYA6IxWvgySIoi3FTeih1I4fBO3Bu27WDnPbP8Jjw3wYJJrc2JPp1
AzYDiaIha7ahpFeym4AkXbb3Jla4FLbnxcpEA5gukNMevSexTAm40jMHqNh8yspd36nKpS/ssWOM
TelktgB9Sn/Loy2h9naN5gbXrWTv/KtVYcoM/u/VFl3IFHS3KA53h2+Vu+ytoccc1HMRqvFVDGZe
qaZoGE/gZ+ss8egW3fl0bPvR6xgGsx4v0UwZ6IV9V37+4iXeQl8SHxxV7N7vOduXqY+0pLiIkkyh
GHcFHWMPl7MF1uJnCtHkkqo1SgGimxtbxL9X8pLSiciJ7rkzi1/ly1yUhbWJLy/ZtdgrtPkCGwOv
wo8xqu+EhLORnVZNh/jR7rgVi+t9O6DLBOc5/BvCy7936Aou6MrXUIxiBgGwhocddwgghp1NXStE
b3h9HbjYdt4lHxqCjR+hWROCghDbHMBk+LiBKEl9doRwNN8WdwpUYAjBCfbsRsc2TT3CyZh99SsV
ggtNLGNJVVTYERM2+ch1/BNCZVQE2McAxmwV9CC1DYSgmtxQLrIKzYiwXfcv1mZpAA3rGXHkEbpb
qJjmySugarEuK/Z8M4q58C4WLfI17l0OPPHaqvivI907l/9KsLbYAicApBi1IliJfcKKPkbd8OWY
YbYc1anYj51TtpZqMuuCivuY8mQs/ad1nSaKGehe+KZ8vAkuLkultd0Fjp/ohzt67825cdi6IiaD
+m6HVpagslk5rWKVzyHOys3xVTUNHmZPeamwozlCRqq/TZmXrG/IYnrDcF5IzYQxalINHiFTeH5r
7R4+ZJ0YaRc+aWVq4cAvBmXaTjrIosrqOCvPty3byC/Jtu+/ZrldouRcWKVFweqGUE1/d8NAS4pl
aAyxNfhnjpJQ48F8Sj2un08JDq/nJ1K/9G2AnAqKsKa1mGTIT5lpOgGG2F/FwfFcBlTSww+19L6A
/Y9GDuLXOwN1NfkoFSGpZOWkl305XsbJR/qYYhyHD16f6jluB2wz9f/lPKh2/Tg+/j+rC2tXn+LM
h1/YIp3jNoEkv0l2aV84aDj5mnziPp1Ku4OuKZwk57c7bpV0FN557Jm6gJPTd3Rh9JxHaJWnmD+5
Fh3u51merh1NX0Ji6iRv5p4/EM/6CcBz3Izc44IjwByKQ64hkvDaDXZE71D/T8rwn/btil/0y5BQ
Meq+d6d3TlmsLHbmfs22PvjEHEdO3S125c0GtSYzTEHPwk3GLhNV0JNR5MUxgFRgXnFk5DYeh0DZ
df0YzVKW0/RZIbEVQaenrIsvEKSjriSvFkdn+zAxqAs73Z/3EHNaZCFtlamEgip5WuM2AVWb0n46
3Y50642p/qWIGMmt9awr6rHMxitIuFjri9Id8zRFR4ZKYF3wTQBh6wujDmNr25ZCsLzzVcWYYVN7
yNPQu5VWlGgZo6cWF1Y5Qdzqzuj3B2GLs0yOOCEtXNHCHOtCx2rS9flFHuP5l5Ow312r40bJvIsC
XnflXe6grU40JUjvo7vaTGMuzbWmFgOwdsjDpXcvC6KTWe0eOFgR37sq4cVxVwC1tPgeMqSaEt3D
zJAXlSTnyg7FQ1yLPh6zJB/QJomNFD9oNIA91IowBPFa1H2nxOdlx+kKdM2iRC1zrBJGiyI6F3dW
z/UYxOlgbjdlyqkCDJW1dp9WVALT8CpuAHOVY5wcY8pLQJ3XBajqxbrqQtOxaB7T3NZhsLedTGQ2
ZvJ5x+2XfDW/RgkalCHGscJSMfihC2KYrVCytNL6roQmybk7Dz9WwzYBUwoeUm6fNv93GF/B3lvD
++MkdjUdmcL8EpWYglYNFoJpuJzvUXb+DlEyxDVW2yu2sxKnCmuiqcJSrpi5ULqwEioK5Dj1Wgls
Dp2KWFafTleskg/13nwQjT0wsyI5PYAq46TFiBHAbznU7+c/ipiUO9b0/5y+2WD6eAFqTkgHB78l
OSfSb2xMXoR+Bk5JnNBCkHEXvM1ZuvMLV0IMWXB/ExTkWq6/J+94tp5vzLEBO/X7i4jVCFkDWZPR
5aAykrj9e+m9kNP89H7MAJbR+jFPgwsmX7IFdJwqMPSXH4oI42zYcgZYLDmpC7KotWZxiqNVh5cY
tEvIxrm5NhkkBkXv201EFoNPsBDAWnNxbsHQtGL8vXeZG4LJ0/ZIr984sbqaA+f4UFns+6fV+Ocg
G3AITC/rNGnkkU/7CZi6D3VM6NHOHjfhtq/QFZIUue2lGEbH7E6X/WYD82gmHziloYQjKC1m4S40
kXuzBKDHbEYrLIZyb9vcPHmAX7DELXhp12IGQ0KooXQNv9xcbiJ6RZeCyabkApN50+mouLsx96Lk
7r9j6jj28asENUdFjydnbtoD+v3Kqrjh2SJ4ohh4ElRZcpZkCNkx//dLilIu44dwJ93MnzqY7u6n
LZkn8n8p+NI5H238qherysSRsptC4v3S0AujgtAQlVHPJEqurxUXi3O82isxXOqj/AoOqBgQAAAM
uEGagE3hD/JlMAIR//nBb3DEytdX3FbzFM1TAInXD27Q5lRQxSx6Wmpq3KM+mz/vwO0+O9Abl1SH
fOD7JkHmUWz5kiYN/tZ0JeV9lbsITxDu6fayLYkzEtdxpo/49PokMjziSiyzruGwHOUGN9knkKfN
Hv9rgHoUmv3wp8eYIg+bwfd6KqgAY7cOAgtBqwP/V7cWkTl7x14HivPNwbp/7+/nMJDhB5b21j8Y
GBtzEklehOC6QoBhnf+ISTVhHZgA+442WtfFNnTVhH8ZHDfE9wgtMhpUBWLiXju651G91GMvYYUY
aEzSGH7qPKEm3xBv/+VEfGqiKs0g4wHBPSq2wtKX20/u/IvUtsff996THj0weVv8WONE63ixm+aa
jmVoLlCR1sEzag0rjdtzNhpcJSrNHUuz54bEwuZkeUZcnNru+973o986DSjqNYareGQk/kto3R2z
+4LSXiLuvzA6RDvZYpLQ6Kf6wbL4+1GeOqwFl6y1PKxllNPhCA1lOklNFofScAo3hZOavbeVfWyv
17i53NfElLMDk3s3VO+fqOJJMn8fioCHP/BN/xyDVqv6Y66lajT5KHGneklzWHr7CJAzxv06AsX3
wi+CvLibRlSJV/4nmoWVfXn0FpsBn4FAwwQMZ4t4xzoQx8DKtIFZ+4gWuE0ksNahcaFriSomVMsD
MsWg1Q6EnYCmoN8IowzW0yXaWEuoFqQj8femi5zaLPETMUkwzEDvzntlsxGVzqhFDte62SR3b0HT
/781jWPJYSl/HM/CWbYdmm4p/IRf273EsDKv7pCkmT9S7YiVDVVLwRU4hpy/V9kXNNeEa4w0oNCa
a6wpoN+P/m1+1nOYQddBSNalLHU0eolSRBY4WIVdMgIzhXyjWHoOGASaEXcw5T8rGzWTPaDys2r3
Urfc8gNSi/I34SgfNWutMVk0S07efDttA9lmRrmMAyz9B2kR68mrgk1qyTTniirHzQTyeGa1CBIh
hocFBO61+DNZlYtaMQvk0u6/25gQmYgMZTTC0FP4PwOc90IShUGyf51/3sk6ZX837pjY0eHlZXm6
AiaB+cTegGoMdfmXi85jMim9kMzGbMF6VLA/t6jTXB/z5C/cZuegrJ79zhcdgCikTKMQo7LJBkqo
cc/Snp7INbCsXInev5hy19L6vw/qnCGVQZeVXY1AWlexKqJ3qYD/AMaQHcvguMD2RktsdC2qEyQe
EaNGq7Jz9KXeGey/bEKnSMzHwVPFLGaSugJSu31XXiSD+ILxoA2We7TIPLfUmydrwRCREKOzipua
AiI4Bo75emw+MxpiiEKQF119fFBPRS5vvn1YnfFDWjAG1OrJbT4fS30QQVI5UJ3UWpx/POrwTWgw
HEKB4ktzQDL76zwZQy1e9l+X7uN9KfwjeOMmxl+iZ7YSwlnGTgpg7jaOSzPdhVo7SfeXFf9mEV89
kudiR1/JUTOs2v/oUAThKUVVhEttOHQFBcU702tGxFb6ILP+vsMapuZtMJ1zyAtPkcq3qyrA7r9q
GxS2gbWFsc6Mb9vbh7FtJe00JHKMGAWjMqR9QQl+poUutRmAL9sUeriqXIimr+HGWk9S1U8o49vC
A2qzNSYSINwIMG2p3bvZh/xLa9A7P5Rl8yyKb4rObUV2Sr3kN2hsIAaaVyqsN64hRQFD0zKoC7lT
FxmmDOuKTiYTC2nAkoYIJGUYim2aLowxf7Ka6i357FqlhJeq0yRVIYZpWuY2MFHRJx5i6k1lWNVh
0H0dXFVINwR925JK5kozi869ZpmcPn1/P4WnOpkdXRmJOSyBAlO+YKS+BTEXH75Xi+FUPJTw/oCR
WwmbwHs+p47pCWr1VYfRVbAhefxIXechTGZn992yP99Su9AN2iH2UBuGHFKOThoHpH1BvLhSqtJd
WxTtPygr2SMM5+QtEJfE/IEr96aDD8/3HsK1z2lLSGUoMis/X1a7vrd0E6DnsSjuKKsVQpPvnuwZ
EgcsyrH1BHesnBvNyNYI80zfKR8zKFr5vnSjuPPhXxv7xOdr/jyzifim0+TZfFL/j52uKWego5jL
W6+mvLVn9oOI4yD9VaiT0gyIfZj+cxf7lAtDh4MSvZHJRAgPTbVADuZqeoK//b+XoUcMCzs2FCv3
CfIVhu2yZ8Oj74XLRaFZn2YqkNWC8zik98EQzg4nZr0btuezRmFcPAwFIGy4ObFqEhs27kb0mwUX
S09/gswVXiLSz3SFoeMW5O4BMcRgZfybxJWRHBMgSnxZE+8K3jBPlr2tOcSxdJV4WqxPISGvDzQD
cBW5qvc4I8UNspPVwKak0UY8bzQrX5dm1WQFLdq541nM/5led8JqFz/c04WntF7A8w60S8cBBuIc
HXvj4C4rr8hF3vwTf7NBBHRj3gb4XVFCrz/tUDRbEtpAmH+xRMyJ5gVWplGYWEhb6UqrFXA0taBD
UGOBhtTtXfkY4DqgtNfNHYud9kSrOIRqGzy0DtNqdXZamyCTt4OIV0b8mcT+s/7s8GcBsI2ZwxVY
z17p7Xbt2WMp714WtC9+eCtgfuBMuH4rc8cybqQkJ9HFdtOq2p5eZslXQOZYoPdUiStRP0Myw5Dh
IJuz+jU7g/bVFU/X7ZKF1UGizglfjPujNWI/bjKRkkF1qOoMSCJJyS4q3tEXWvCYW9dKb7MQNDt7
JvvQJAaInADsSp9bM+KBUSkocdt0p4bsCwr3+Bk92ois0MLlHnYvRh294nmMw6uaipMFKW1bOL8I
v9S//4UHksXOLWW1tfSjmXPWBLI6maEkPzSM63ZVJcpSt56YGWaOn4B9MqR7KrtN85u6OHXMcLpc
dcwar6K+gu5VpVbjDaM/OGOGeytvnVmK1LESnoDAdMTGJHFwTjcTuXlZe8qsGfWQfLMowyVCHu4s
2kQ7G64gs2/1uDwtQD49nE44CZBS/Z9jkcI3Dknbuc/xG1KLtGRUj16itkqTI6AsEM6oucJoRL0m
1tWQTCh0zBVAa+TkLknNaIJjhxP3YUkfc733Xfvx2AwrJEfbIbynGjYTin0Wp0l4Vm2DY2sQrCn4
XHPRpiibrMngExccJtVflwBVFFTrzk91+nUNjbxyXbSLRS2CuHPY1jvu/o9wJ4yp0m8AUrivojHq
t0G7pPrb64z6qcetzZs091nNjfaAFpM2XOQo0WuZ/CDYn6NUkicQTYqRVbi6cGuFQXmgJXvKupZv
+GOm6K58N3v4uSYdu34ceQP7PW/3sexL0eJLgAJU3mMqn5NNpKLKvexSKxck6kyHgwxKyjg4LTd8
zctvQaNvu2tzeWqH7j7JOlZE9I559ARnJdRCQtdVV6Z5cBNkecezirl7v3wOO33/IKqnCEXP10fg
UF87LuF/IuLOOHU18tsFrTQBb93p4gKC8Cwvgb1rY4j3aIuVkcKSq28dncu0Psmr3RWBTXZf6UHq
SU1ZQWoo27XYj4PUnfx79HVbYVKvuz+dZ7LZwrfSS1kS3u50D5ZI/70RzbW03jS4G9et+Ldy1bTK
oFtXj3XqDARwX65ZdIEea5wW5KYtn40XNw3imcVNaiUs6n5eNCQ4YVjpQhV4d+OhWOP2W7JP9e37
BZh0txHhPfQ3b0CETUMpy+3trWtAxZKvWX8Oq/tuAR1jGj9cygfSVRQUzf+An1VK+cQHyaFMWG55
6YBDSehwkKQqG4wDUaQm+md6JFhSwpw/9yS5ZmDDR9KLudPuo1mrQ8q6QyBg5gjo2k5QYsBqKw6A
4b2u+qNR9K3DVuc1y23Avocx1VWFlGHbm7mp0AG1Eb4KrSpsYvTPRSx3L9R8vY4HdLR2um9mjq7+
5PtoIz/k3KCHwC1qK3pB4ueXqgJ+DW51Q62vPfOs8NcyL8buCVDaXIpoIrin9V4Z+78vGL/hHEOP
k1yrEOrZCPzC9gNOsc7diaBaNbJo+ZzIfK5qw2skYfG9IF7AYuc2L6gO09P2cAD73GCPO9gFamVL
ZpYZsd/fILZTk18G6BXrHTdoSDXdBKJG7FELP3U305UfPUpWqhRWl25xGf3S89GeG6wh79dlCj0R
/t/KRPYc8xSw9wXQFBxdJZn007pJDDE2+a13UXYHfqX8L/cQU6qaPlm6SyYETG/snEuM24sRbJLU
XEOfsk0gLpECIz0oPl7lHdzWYavPLFUM9DGDsI0NnX/8c+0btcoZPzl0cFSaGjFeB1S6kL0GcVbp
Aj30LGUsTTxifU6FJSduE5PdGhWs7QObOg7sXDo9YH8rIbH4TTTTec6W7YYini5CVvIsTfYzLOBG
tIJH9AlhFs1wZedUE/B5tNnrnAVPasiDZgKOOfyaWXrBpCkwS+nabmRw4pt5LTZ68Ms9Dafd9idR
AKDbiiorX9kAABE0QZqiTeEP8mUwBRUTCP/UsIqMD/4gGQ5PNXQ/W/JtYo9UZ1fVIusmvb4rk1vj
GJr2Y7iol8BtS4HaQCCKd3KK+tTRMz1h50yTQ4y0//qGkNYop2EKx+YNz+ZCzaTaq7cQs6qPVwMW
0U8a/+vePKXIwyBR8vPeRjvGgLaYpzq2tMTG04bzwcjD0+qhyj+dSU4zpzeQ2pM3ypNIOhObtZH7
Tojv6dR4wbidjuX0a+fDmCGt/B622IBMrb5Oal5OE5rAXm3HqOpxT/9LuQXRIHufSaIfd4cDA+Kl
fznRnYvGC8qKxxozk58sRd0c2h3bRMLdq8j8YJIhsd3/bQmUQwvH6kt9pqNcS2bEKcFH0ttJho1B
wkdvbhR1Z5VinMT/l9/OnALXtCLdgJGX4LZXt7cTgdhUzriihKw9jWf2SHapYOvls7sEOQ1B6Koo
WdLHHHSRhTnmVQd0ZB5S05NYtDES/8Oylu2dI/L/A9/t7urEY5b9As1COAnRi1wDguv35UzHInNr
ndCOtQe3bsju/TpQwAVLTtV2Wouulz6vTkb/9M7IsTGGhe5Vl5NiR+zIH3Tkm2+0P1JPLUAyU8M1
YTgIwszy9xok1nfIfuslu5Hmux7UGOh6BvBfJrhX2ZBR5rOQhFDaBniZsJlt1C8GrU/BEWfxzvjX
cfP5AaSbyRsQ9JfUx7UgmOkxqf96YP00AeomuSaEtj4o1L28feE9IihhYM5AWvYWRmfA+7//3iHI
dG0vYdtlZtSh+GfHvJZUAi/N681SY8MZJujdslw0o6fKsh31wXYxyHu3qBelmfXze+x5/W23zIyQ
jd5krV77TwEm5mp0WnGBat+JENN5gVSdy8al8h0N3ZyfveEOM2rGeomgG+F2PgTyDOOlEQsM2r7B
bCXamqURIY6xiHt2hXc3cC49BBgb/1Oc3092wBOrUSI+jws6gbuvE1qKR7pZ4oK6ijYcIdImbFt7
AJPcrJMAtfke1sihKJQuO3VGF672E5EIhD1ADAg2hcOLljfxjJZ4Es/0jHGiqBdyKnFs7bVYyqGC
S3Eoi7Im5Hx0ktcsx2i52uv2EQY+aVXiu9XxTSDcnx/c0+uv9s6cZTn+E85SxVFUDS5e57R63NuW
QwGjkInzBlVtgbxzWLeaivQKzGvy4AbE3TaEvsZIEPrajUDr8kyiQZD1fEfqIlTloUxoLvjRau4U
zdu4xL8sTfzLvkT4nJ6ltfwY9MepfVSWGWklzBfhoNz4s+N+TL49DDY2zvwnql/X9x/moxRFttDe
dV8AW8esX+bO7xkwfP6KEQ5OfciffzdbIfqpg600HNlxDbXQck9K8D4GduFiBD4aXzQDANsrGOWp
YN+qXeI/Zoi6LGbbXtXBVd7+d+JLHPZ4u9MDtDtDkN4NLHdT0d4LFhSsLc4PDwngeh0x02UuH30Y
i+OTDXAjFElLCgiuajBbDFEq70f/pD4j09ROLFNtgbysT57ulk9/m90X6YVWu5Amca07fFUUeVaj
825iT7H0bv/WvYVZ0nXi3CEfG5wG1ali+T0A9wjO1RC7qZshziONt5RA2D0KZ6ZMhTMaMUeP4g3g
dQMXrrcqeP+JUmr6WEymDJ9F9TlFBh69UiHiIqVpKkhvsK23kuwok3a3lV9oKWuOt0s+WUKo/70s
Fj6OB2LPu45zJMTfEDCJ8IqOypaMMRmXuA/gCMPHMZE/c2cFncZbfpQfCPU41eYlM4pt3B2RocGX
OF1NLJRSFdF0TqKz+BzKVr89deRFD/lQWhKn3atGB/MMtQDiM9FOZPsa3xDGRdN2OD37KTAYFxyB
UlRFb/BRiwvf2MkSGtq3Dfcj9ALyJcazN9nWzF1Uhi/N6e4d3Og0QEOMnAYcJKhuOoCWSES28ido
2Z2e4dUkvb6TGAxf/b7rg/qatMj9NRqksQXSWrj7IyRHg4xpq3CGLW5y40uIeUPuGpcpMo5xSSFr
y3IPtqzLoe5+0lSjMDOk/2mjhjKjtziRktAWyWl+0pSDW1UPPoEJ2nGJ2svcF9KTGpLhq04ujsME
25QVSlElLhYTtbHUo9WJiW6d18qWySYQQHpCnpKCXgwmWBUJEoe1p3lfK8+zqaVcJ2p1KLv8CkGM
mFwUKeyIDv69y4n2cQV67lWYvftsGXtkX/5k8XU9jkVPt6QRcRoszAhN0TfCDWNYkyg6vPhcYTdm
gze+/GZEIAzwm9qD28L9PXgu9Znw6mCrlOBEeNnpCCWhhY32361X1gJFaXWv1MmUHyugzmkK0FCY
u2zxMpWApGWSZov2P17tZ5gw0qjPlYeZx1gRBa4mRFJfOu/dccIOFFdBdvI6Pm0x6fyNIYAOX2fS
FiWIQurjzUiGUNKtNQ8wMcs8UHGBmgGTnx2PxkQojXkZAwKRb1YSG0NFEASZ/k59xxXVGVkDYoXr
klcwq9lgbftyqHZF/0aWfCE4cvEFN7qAguSROafkUT0DV6qalqIjVduzFr+oh2AYTWmkZN2fX2vo
TW+LsYtZhJm/DA0ltFjB+YNZdj9utfM+6FB1sUu2gS+nsZbpTNnwawww4JBtrFu1yaxQW2niPdJc
PTkIGJxVSsy4RBpcuawLrvBX3XK4Qc1JAp9kFONUvuAtefOSGlVtaMZAmp0GtPaNMgPAp9mYjAHi
3y6xLr32uVyJCotG+9HoP1oXObJHEI3xYOEVR9BMIbaj61U4jBA4nCQPV3pZy6J6AncjQtRmFR1A
i101+qn+7gTKiwlXx6ihIgFNtPpWJbnszpi18QdMxsx9kwt9EVTHC5PZvYX3bXWOSec8ZJvJ4JEc
oKWgEpHZD+pEAh7M9NaMOa31hqEnOwDjay2fSJ9a7894ZyNp8PkBpgSWPgwRZvrLru+iKDmKqeoN
yNvUtKMnCGzsB52EItWdzdvkLfQbwRoRIUq4vOb09Gn1zoR5hLSMrgdlQZ14h6g7DTXyKerY5ezu
xgvI5uUas+eX4jrnBsfYhohT34kohF0zkVEJt6l7f6iSc503wfK02G/GLVV7JshNkqpFh10Go0Pg
nQC6VIFLdO4rKL3f+4yxBXIME0LHa0TeTqJzlTlLzCKa6suMCdWNWxgC6C5Q+gYGZGkhx6iufBRm
w8b+PtX2MOdWFjVJJAbqyN2qOaoQolw3TplpuZ9HqbJlrGH/qWpspTVxHmlUk3wB7n1NhyvGKM/p
HrBpShGLByVxPmWnDOhezemHAMZTebehwRZpoLjSfcuMoACRrCMBiFM/0yf7eZxgYldWNTYw3523
gRO/nWAKgVuzau8sYj494hQkyKC5sZd+3PWgATI/+i26aPSz2rHoAMsPNf5bu/OMNwgJIh5sixQ/
VOdtV3v0CaVrVZyFTGUsP+NHdJoClch4tNWh0AHTCPQexMX6zRNni8bWtfPjxDmgKW2wFLXlHIFr
q1rTLMOr5XNJBa0WUE2Uy6rBViEqeXxaUBpIO3rwcbh/V57gheXSHBwVP/21nHJ8zLLSQcjWF3Z4
Vs184bcuxgSiWO/ECS++MOz1wKUc6YLOysHfsaK1+L9Er16WfxspDCjo9CHp7mEsZDRsAvSNgEW4
F7/ePqzg4J8QbeQ7PNPiRRC53+I7Af+PXoKiwanGOD3Jomile6kG9SS4gz8XwMYeVfOBazZOoOY0
PWOpliClRdvcceIBS0xp9RsODBrCDIcy5JePUimAu0qWx/Ofkem1QlcIuUfDePjC3mLwErFccjop
MlvqXG2kDDWy9AG+jY4a1621APgLbJYYMYE9JKNOhBjaA7NtpXkcU9OYjbq5Azx3Q5anWfj28+57
y+SB8FOoGmlFn7cP7aCu2VLcFO8cNZawsWt29Tk5PrFKh3boTh/Me042Q46OBGSqCqFR+VK1JipX
6A9Cp+8P9qqPLgWjM2HxLLGCq9yGBbCDj1fKZxbagXxHHnsamArbA/Puu707aZAjniWGPqJeu1gS
qsHBKb07+nsznrul5i7wD8mfPtL17THstxZzztfuQeWKiee4TgwHX5s39KSD0wjTB1D3R+QTnWol
2YsD9E0mVXDitWhU6GAK/uJT8Vv+QYYwyf07SDWNvq6k4pa56DCOsioN1Vk5yq0z1GorxBmy9QCl
s2LFc627maMDM8bRTk4ep27pG97BrOR6oiySr9KkAM6ZYH7y8graBcyyCbxXSZGlkkrzj8jKzwzC
hYRKkJBRpQVMB840ZSE829pLiouIpUdHEOAfSRTxUzLEbdOIFkScm8NY5inKv+uX3SQKIPRJAbtt
GzaC6U5E2CuXItWaokaaEjU8Zw0bbA0P3OzpSicFIkUGlYS3mA2xEHP8bHeJ4dZx3bdGEfEZd6bb
s/lCUi2TDZMcY8O1QBv5ge8mDuPw/Wv+vlZbVzVjq98I7AY9A+qTSGzAOg5K00n2l+nkwiQaVWl+
/p0tdmc/iosSHlnvDJiRrUVeY+9x0uf1R6O+Ww4/MCnK1ainbA+59C1QxUwwZQpX5xEjnw0ZlDp5
rYWlD8D6lgkh4UsKrSvAEBmPJMmkxyF2pGWAGRft47ikwkQB4dMZySrRaVcwnOmY2JbakCFDleg1
zaBix7l1iEjA+jEBM4TGeN0bgCUxFl5XaHVyPNqCG+QK6j7+r3QT8uWzKAUOpONUr7qtTPo5ALCq
EOO7k1YiRf28RKXSHyh8bsi71hX7WwFA1tpG9JkfRlAgUiyeXpbQpeDWzX2BCJIUgnuuYMXqnevF
JMPYam/j3wsHvJ91AksO39uJGuuoMRkB3Th15RP4JhYVVySvrIhFwOL47+SK+zL+e/ARtwKUSiti
3IUGAo2B4dmCSp82KHbVSVKXGHp4rzh4s8jelj/AvI9vhPBY8/sL+kTw6V36RbkMyblt1dj7INPf
benkAFQIxameYnpq+T70v5562GV8v+oMrOq6ZE8VujneXhb/yejwX8rRE1/QoydoO0Jf0AgEk+Hh
vMADqQsunhFVHHaJCw1dMyqHyubp1QpPdPIU+qJCYm+mhdBIZRzyrrQ0mXNkUU687LmcF4u9GnI8
82lGnwz3N3JVWAbXcxENr46qN/m5qDZZGGKWNgTuroCYsh/9JM6UkwB+DmKG0WHjvyLERI/iGxU1
FL7a6asS79BBHvgDNBDUXWkhY27TOSWj1V/o81fveif/+a6n+L8O7jbco6v6L4FPnMYMDrKB2P5Z
drXa7FR9uB2xprw+U+0I/k/d87vRj8Vwx07TZA66WEpQcw8eKWnWMFnFM6SKa/QnXSLZYuf4CodD
+Mf9iRPOLZZkMVHUYP/YpC1Eyz6eXJ5OanEGahsOcyI1s45kKsHPHa9uJEC4Qzv4Ly7+bV2KIJrQ
gr+7/zmc51Lt3MLQK3XecYKh3ih+4uG8tYcliGK1dkmg6CCbmZ4v7Di1oQDMghpBPQFvY+i4XkhK
6I7mTP6H6qE0Bfxgovfi7AD0QXZA0hIwLxRmL6z/lS/xoxAEjUjFj2X3iQmTRjITNv6tdm40zJCM
jqE+jOYDzXNO8sUcTnEG3GWc0bt0q2JuHVzTSOEW7+wzndKE5lKRckNxxm2PKkxYl9+YfhPrFQW6
AlwSyeDREk6NMQ2qNdvkhrYkLbGBJX5WEx7FJXR+r8bJwO1DDs3Lv2ztivsh02R7no9NVniCR4EB
DvQqCV8g7JFxU8tHQH+TXtk/i12BvyJLzr9q5m4MA5cuq5ncqzURW/i+c4SwX4PGdk9b6vPW2s+q
/SpUNUrqNic2Z5CPXmFNuS0wTDha9O5D7D6J43ldNcFXbGr0/yI0h+ZQarILbeVOFz7SKYqH3fQW
DerGJ1zRdLAeB6T4I5BKM05EmS/qrf065/tm/VdCZxSQ+06aqP5s5Dq6+49/tMkbk+/s+Ut7YE63
bZcRaV5tGFcOVWWwO3wbeTNeOlRt14PTwZWgAAAAhwGewW5J/8+zY1SI3ZGWOsuEYiJ++PBMUi+v
ULZlJWzzNZ9+grWKHoM5DyYQMooT518gAHO3AhPuYzFTTxI5evnrBy/ITJyUM41HkyE3YtxxRx+1
N59bD3mgFQupU2MsS2PxFnc5s1sTwbT9U363tH+JoIJD368QGfLu8+et7ap0YHLXaDgVHwAAFfxB
msU8IfkymAR/1sKjPR34ELPqLpJd3akxHSl/0AOt8aawNiwsxUePwAOHb3g+bV6LBeiq4IarlvR9
Gy/sPUZnoeh2sZBm9UgBqUGHh3vm55+DlR/Vce6DpZIipriEwEq3Y78oOJ8hqekl+4k1n3CAoG76
bG9L5joXwoyEo81MHKne82HompLdF5hfqUp8ITCUJix+5xIkHUs+4CfJ5trbScuH9EyOb5qBjMaJ
804qJRmf+mmPIuHl9sm8xu9pdlBArlwKt7+MFx8psZAt7XsrbnAqzeFnPOJHYf2Dpuem2N/RHn96
YttzPkISHsD317vOht7TqhwmqpiN+n8vOSAywWffD6WN8ToAEDTqnZNcrCPQsdwJrbdbTWAXfrVL
NWS0i6Y5ZTT6hwQZ5t+mt1/usyIx6xx8BLN1gTiBYiy/ispWgZqitJ+fYaQfU1AqQ2G547+kiXe/
/gvwDgqGa/H8kpAhGgsUSbFVEOQVxjdy9NB1d/O7biPYGw1V3341n+cd9h+SgZYKzaXUCa1KlAcn
gIUm9s68K6fdveVBbu+o3JK861WhYbgtriB6Y2mCca21eLhGEUxtZsRnntXdiDPdinI+q38gfPg6
VBBs0Oyj1IkS9gufCmPuwQ8oWX9GirzXWfvPTikAIq21FpWB5qqLWqomib0ygi4jzC+i9kUX8Wlc
WoOXriK/7NxUQ3SbJkpluUjtKkKsbiIFqgMCTT3hAAonhQIsQ8Gv8LoST9AKEOmFpJCrhcdQkNJt
DZSJhp+FMv2lIg9WrjFuDI1j+AeElhH0yvB29ammc1RtwiLInt/Xv0ByWW2fp6ww9PD3KWmSp/YV
fNkKpNTuaeAQgQmg+0ZQs//0zexHGf4dt3aP8+Y4mjrX8j8IIzn9uY3UZ6R+LDKyQWP01Y9Ufrt+
46x6OFudjXXPVFpyXUf/KpG2gLceJN584igDuVl9UAGSLoIKfd37w3jtWhJqR0bnO/zCy9s/roF0
k4ImFtS3bjFVL7wdUGqsEdzKmi94hbtcPbZQ/bRy4gDwdawN076qa//xV4o+0BRPHe2GUe/YJeTr
HyjQ2eeSVqHVJilZDutcmhMkD+HHYmOUDkWZ2gka10MxEsMFtvh6pgWV89hfalTX/EI91srHGk83
dd66lUgCOPYdC70+LdHy6eR5b3viUCdHNnbHzFokTLORNZi58dEKLYL+VYY2a0+BHV648v+xmzPC
PjEFGCTM/oqOqOouDo5J9VbrpKeUTvDAqbl7miSS+GEPOSqb+mT4glMe8yhYinpyCot8KZGsucjE
CxbQ1gt61oErg2b+N6fA3sQoRqZ0nT2afOnF9qx317aayfDLKPh+z0ixCJYyNfeNlRsuOdfnmJfp
iPtm8SDRltcm9eTKDTHXseTFWt3fcRsKDxx0zOb3vJL0A3s2akqwYPZMxFw7JHpjO8VJNHQvVe2o
M5+kpt2nNbXBFBXdjGFdUkfY3/Te1LE2iW9E+sYX25KJVaZ5RCJZlJDkofcV8KnZHSaEmOLq3Zrq
Op/869H8rzf+Y4AzTfDYDcDOKBfPZBqnBtAx42YxVwq+Ge/TjKoJGMJih8bmmgNMu5cQn+YPO1va
cbsopj+1sxwDg/ykmXJpgn8fuAbqUgl/Yv6U8a3Mzi4QcNcQdVYV+wP1uoqQUN7pCFaXjcooXYo1
Bfuy8UG8bQjEAhBg+jLdEehrtVd0IU8ZynviHIuwovFmGj/aTnGMpZcW3Yv1h4/jQop7SwXSn07x
0WFGg4o54idgbQ3poRAhAyOrcwiBX1be75kMt24/0H6dbzPj5e1HW/FAXdryqYMP4YuwCyxNpUXV
u/IkmHlZ0+JazmXreahHcIbPxfRFqss/bbsti5wERBGTQU0ndodmiUd1DFlwrYrzTE+RSKrnjmZS
tRApelRKQ6fa5k43eeg+Vua3fjfbkLXtEHVHyeHC3XQFqBEa9rf9PUMK6WnYn5ET3VnzLDV/Yw+d
fLbmgeOj9FDx0vhrrCsQAtXITp0qK76viZxBXj6iHNcr6HVXDum4610AzGHLaSc1pKwRKw1vRKS/
WkW6ARLAOglvE1Na6A3h2rFnnlNvrnvRrRKZD3GkpHL741dhUAQcfC4M1AWcQJE+kxsqhQMwNJAI
D4KEMC+qTTVVjKTRWrLfpgU+9I1oX1KvBgbzNTZ3UKylD+yeeZWwFRd62JL79vBdcBB8ZG0rmkqE
VG/7V+LGaRG2PgQFjzn48h/1GlmOwoiuCYwyRTHINEw+FTXBQSnxMb+9EX2zgMpYfC8gelAGKHj2
xTMXvq4PYutL5TTI5yEMda8Fqqlt7DGQh4lrJh6zA60u3vc4Ik1HocCJCJM9jFeaq9TygmwYP7Rb
yY0Fkr1b1daTVaeKhgoPh09t2p90iHDAwMc9UI/KB4bUGejYbF7+xGYsy3x/UjyoEcgEgSOxJf7I
pAVVlzHGmJO4p48Ic27fbeVYrlYAv3TooPc6nH5sjtU06wX5yPIZICK9gKnxHgtYRcpSpi0miNbk
vcb4OT8TA69GA3J7eiOe9f6A+3EIqmcyUJmHCYLrfKUzOANL0zCyo15gHLb3/Ugjgc1w7pF0pYaV
ijEAEwSlRQFrnwUXQaUJSP6Vjc2KcJt9E2Gt98OBYVc26Efieqjq8G3yqOSc9ckGGTaFcMqU6R1M
EJu19SAeduq8V786BsrxeMkaRKKW3guJL1RSG9SMPlM1xR9ofEGNVXgHlpWVGxVDKGsk6J5AmdMy
rVI9P8F61+t48g+t8lQuSVb71mhYUVtEGOcCHJqOQUaCjP7+rrSRaKgc3/expzm0gSUedPLNS7RU
K4J8JlArJpU1iDIM/mrebyZzYKU8OAnT3wNj33c3jIft1MddUEl43aGZqUw6eHfRhMPpujywbNDd
/qFjHb/O5qIJnPDCdP7BBGn94USXAK9RIOZYDmTIP1o5PmiLv5CwQS32l5J2JCyR2+gvl2NiYe4G
wjECklyCi+96dU+2t8z8nPesNxv/TzwrlxrcQIlSqFtF7jCoXV8XevjC0RjJXwJ/4jeGTK6rRJzh
gd+doK7tplYWidMyHkZOb7kibnoBnZBvdodTeYa3bu9kfQh6AI8TbPAKVOJ9ERWILoEzUqJ1PRQd
ePtkq1kGmY8UEqAcOma8gOQmtCXQW32T6F0nvTsgPf7mTt3XSakXAVwMuBOAZRzwKuubltD2B1r7
hWMDwq8Up5h8nsx5E8m7eCr9/TjxdSLZVzXMCSW4YdNFKuimn01+Zp9Hc88lgUBc/Mr302icWqGb
B3k2QCBLlA9u3jciQg84bY6FqBxVcAuDbSdpyuPYdSnpRWI5b/BGun4YJ63PH6kNctCkDKqIL4N3
RiT3beVScuFaK54dvXaqKnjIebkDng6Oqu7sePOLat3JkmqA5KjloQfG/d2i1hP0sRz1oPTtPXvG
Y5WCaLi2ew8A4gKgyiyJXs0wyr1nkMVzKwMG0AlOrjTzkmGll/lxGEeDhnmunjNUSewhJUTRrkMD
yIZytFRn1o09wnU6H4a64eBDbcqMoncrMrUWUNB0GJAzXOTsUyztQPVSP3s1d9J8l7mpQiaIK5zh
k5nzFijhxNwHiqqYM+6r5tVuaTs/ktuAg8WNBXyeUjzvL6dDMJaXL5VK2cLgBH6jzrsTwTHMaL6D
vWxQ6HEEtC0Y7VdSr/PGefh/bPDSc0uVicGuThclx8+In/VxvbjvLQgi+OJI1cBoLTI+vkHATNdX
9eheKr1yOXfmABQTwlTj7rM2yKoAmAkqR75+TcA+FNUvKfW47nLZ1BDuQsvycEUdFuH5bhD193dc
s2AMlgMpes3lqFXWL/W1hBsNUXUdbCP160xaPzoAJZxu/nRFW8zvRcLIlnsWmI/oll4yHfLLg32Z
hYthdjCQc8JiVkZ0I+9k1HbxKj2y5U7gWFcc7ailfWPDNEOkbThwbTwffyfhNmMt36kH4RSaDUVh
UM9KqijIv8e0BA7ik8VHPk+MwwBbyBhh807dc+uEaPYsL5vUUii1LfTufOKsPdX0KdUPHhkTpctI
VjJSBGAh2eC535m6mIfICEaaE5GtaNLoXtquZ1p3ogjA8pGPtmZOvnv/uzf2gdColIgkVPPQyEKG
qm9+B+tmLivzTmnUTuC1xqj2vhGIrmj6rGRPIkPEN34+BuPbRqjdBpct6Sgt3vfQpTTyiE+PrnsI
0ZFvH5ZR5oJM+I9e7S+QbftPTXoWALrk+4/UgEIq1HcCI65uDx6xmzYdYbys+PrZUVvy7FsaIiXY
MzcTFr05Et4HRin6LXFBc5CK9fXCZCePjN4O72Jlh8bX9foyHtXlVgyjDYK3qlAbj6kBpjjtwuo0
paCYq97j8qIexhekBC3fIkAD+/nYryExTCk+ekF21xA2XgE3P9dczEe16VCPYlJ67ROlXakU/EZt
CI36Vbr1NF29k60YAl8egqzwLX1gh1XWZ/Fr/4Xev13TDQPLhCJAxDrrx/sr7ibgpklun9+l/hor
helE925hUjbvr5TQIjMShYZHPUuPUOKFjSPsmOnUokalhoBTTt5Ou+lWj83HPx2beqotY/YUGgfH
0ow4zur1e4luNVsasq1QHg/BGK7oC6/HiUPArAkRwNZFkNzvHVjnhd+2AWix7PA9OU5+A9BwdqRM
uNWXTELTOJ2P8SO1dAevFbccuDGXSmubvKUOvLTb63SitgqU8We4mh9+JXRBMvjlCaQTGV6ehOn6
R/siqfBrqYR7Q66bZHJPCnOGcVkyNdlNdD/dElCRHmh8bcQBvd3zQjLQrbpjPh702zWCuO18nmT0
ia1D5so5VVNfkWIQWpRi385nNN+srKz2+DUtOY/v0tyGdBGKgs2H4ky9KObnw+MC0P0zWAdpjSDB
u0vfBjFWwhmrxq4oiMo0+G/xC/AYhAU6v44BTvaiz2pSZxwYqWnLUjLY6XvhBGX6RutDPdt420gC
CXFHv3cuNf7z6F88mctdLFLoIgE9A//aDj93X3XfSfZGP6pnvts0e1k0JHyafF5hB3mRrA5opCxL
6kErsyUrGQujd8nxqJdttPko5WeTgkPW6r++o7lcLGBWBpqknwvTV599WFOSbxqGFQAQX68qok2Q
Yw7CQ8PSpoU0oO6PwVfXNUV0eYPdTVVDM/YTbN5VNNnrZVDBygfDmgQm3oatoCObBfU//YpiyYJo
qbv0EBR3pAq5xCDNU/yNu8vJiavsOMsIeTkfzIuPm8urPez1nn41jYOC1/zRY1Ii9ybIm9p+hv0S
1SmQMdrlwbT9J56xHg51BNeEgVFbxuL93m4XcQVCbg2ZfCcfDpPxSKFmvKdvEWBO/K5hSeRnYqfT
cvvCetpnweJhbRu5/HKiVYi/YfAYgk8bW411TZZMxQ/y5P4+c39aY1EJkN7XHeatexI9Ed2WVW4S
qUarOD891h030SGRJK7DwJo+7yZuERNkMFdVtlXriO8FP7VWgzXEZj6zG99CLvhlCiPp/CHXhUZa
XyusrQoT6LOazmRkn1gQl9MpmfAYgEF5dOoLY9261cbQflwMa4fpjqznyrovbbL46WwGkyZ8IZ5w
EKInUjG9gs9ZNHCp4oOkhT0GoSIg6oWh4mLd4crFeXwzq6yi3ad3HANwpIm3FGfv7FjXLdP0hOlj
5lMLChkd3anMqIEJp8oBOTw93hu1lr5hehPHbk2TRCw+2xx+4cIMkFP8D8fTifOJYTozveuDxFkz
SYfM9pSoHlUWo+6771MMeljM3tJWgWVql0ueGJ82+L3bWMGPvOYiorGCUq5DlDd6Vi1xKcEo2oLD
4fwjv9rCBgK0g2Qb3BpuZCrAV1/9AssuXBcSKjB1i/WH9UNr+sE9LikeLpLjFy66ufJFDT9gf6Vp
w+4Vo25ditXXfFBVlA/siiVVgyTM7uLVfRTCzwLCvN7FV+0es53U0OSFr9ApffKovveW8HVyB9lL
iKOQIDWGevGXO50HX63LsVUUkhy50uElwD8kk70e26D/xigobI9yDyeXN+6tZzJXQCw5j7dSeEl9
tzgSn+T+ESCRzsSzluS2R286J9hFrunkMJ2L+bDmEej8k51Qalr0BuqjF9qCXWO/wiXfi7PVrv1d
dZ0qmUwBVPtCH1DbSXcc5NAbNU6MfQ6D4OwchxkFXpTuxaPhDjTE/+g3cZpfUZNVltopVEZjxd88
okdkzqFxlKkuxXbj4Q+5sZEx7acYoyoyR2Ej+wSt5BNA/bdAJk3ncLBZcY4KUIjD2uez+gCHjdmP
4kxWzqGLKNNr8EnBOlpySWjTDdX90tT8jh3rxpa0TwegzpMoQCkPd5j1bbmOQyfpTU8c/x9qHHD+
jO2YS5ltmwGr/tLc9SQtnFWEHILq2J0VGxYbcIHcOOVUQI/bfHCpESFxTKWxlm/+5497vJoNCL7n
JfRtilngsevJbExXn4PXOG/Ge8jd4ejgv0GQ8IYKagRbQxVNTwTQCtxiGpHr28uUwwj2esK77YSe
dlGteOHpQ/fotxCnzNq7FUx2yKm4dARj4sUBkAsiceifslgKumKy3NxceCBEAWhJpT9Tl+aE9T7u
qif0vUzeXv71oTstnppIfMGlqxeLMAEgVZWPFIlPrynqdsT5Vf4fAQQoJfK5ZzAxQPeRKvlf1cVF
XrDzmSVXrZpT9N98ub4lRJxgi9QLsr9ptjnYZEpv9+QMU4VJ60fWdtpPh8kCB0kCFIfJdyJ3yEzF
YCIxMl3ga4HSo4CT/HAxnWvnpKXJroaIhKYF8Vyt7EAT0DwwafYEmiEMs+87L/GtZuRUJy9ZdZVj
nxI/G47x9PquKQ9Q5ua6Ig7lELUxXBf9MNIJ0RkL4FmASQHNL4FZOLqYnJPAJjlewnyvKQAGq/v6
0JEW9nV48W+Q+oC8px5H3eMdO2fc8nAe3+tCZ/t25LKTzRXklQofIOy/unhtwmOi5zyejcs0viTC
3jXU6QYOF+5UqF/YLKuhnsTmk/3kHdjTHRC/1lTyE4GWmUgf5egvGc3AgIMQZajP2HALdM24ZbVW
kOP6UauJ6M64EqxMUVfzOzU/+/pb8Pbqs0Rb0giobDP6u0xqR3gkc7FPMtxEQalCfGTrnEr5Zan/
ZuzSYpkltVdH9ZWsAHizstqldWjAfAiJbV9LakwaAFZLBuqxC/0D7FmBxWNv7Ms1uqTLxUeAVpKh
uxxWoYvmMTwmj14OnCOV/VYx6VywI2MuJwZohaoy2xA8xJRCi0GO40OQS0WiPoBUlH+ft05jR3Vp
bffRK3GgrNkotCWs5wqFL0utns9I5t/aBG4ZpceqY6GsznirvIjNCl97WOLq11A6tg79FG0YWBo0
kC/ms5momkpCuF79627YkppX/LnzEbV2nf/lhjGvwyB+4ybGZbDbjHGkk/XDYYCRjBFL7qMhJWcw
U7dRSbfbJvHN4p8EUBPkYVqiPprKf4o93MjjY2ZoRcdWGNjM68wS3SD/cZbGbRhb7wqYBQoOJhms
/ElLCFgV0tCPx42f+KYJ6SToYHqiLOIlpnwgu/GYs68Dkea5NPgP6oAhGpTVxdFEcQCMgDEQf4AA
OSKi0W8tBEYqRUrSZeEaM01WzCLC8KzkNAlDbcw7ZWxQzDtnIOQ/9Ns/6eh/4Zj9A23beOl92/68
g5DtnIcwch2zkIaCGnacAf+v3PtHk8z7weQebyPL9483lD+wPvPK+98vnfefe+Ueb748nnnLqcvr
6KLfJ26u76cnt6vrqKKKKK6v7q/nd79ffxbxPxX2/33r7qfiiu5++36K6np+KL737953mfe/fPIe
UHk8nl8nneYAMIwCDBA7h7p63uu8e5/IgAAJIC0lzyFx2IDKUCLIEADo8gXUVzmNoruK7u9+in4o
py73men76/nrq7v/N5z7zzHkB5zzA87yefy+d5X3vk833jv3f/Nh5PO+/8ryeZ5vM+/8777zPO+/
eT73z+TybEAADwmxeOA8J1/wnHAX7+biM8zzPM+gnviV//nAAEKiw58eXJwfLmAA5HPg4HBwPmPi
AHEDmwchGpSdxc9EkYkUQFFHWS1cIBtHWbDR0GO8PJtDJjeJ8S/eUGb9Cw8bPX4vYX1OaTiabZ/h
oOnBbMFg2O4NmLMPIA2zkGYdtDbcxByDMHoOYNtzFyHkL+0//v7B/Yf2f/7/+D+8/s84++efyeU8
p5/M8vn8v3jzvKinp3eJ66nJ+K6/J/eUWadr318/I4Ouw/tjovMZWh6RyFNNqHOLHmT01wje9V2d
nY63GbzB979e74+kd878He9533enq4AO+AAAIQEKCIYjJaLD25nM4cgDmcHx4uPMHORAkMc9lAil
ApmkKcjzBwsrQG1296r78Hj8fHt9vtuPbu43cX59rvcfFv8XFxuhhghbc8zvDZyADzj73zg83keT
y+R98PJ5vL53m8m2bZmPMeYOQ7aHIMxcg23MPIA5DyDkG2/9MN1orxTefJOWt4c7qW6OIXxhel9x
sGEyJ25FueLk5nhfKOt4dsHJEL4165+H1V+uw/3JMChIHIAcB8+AHHlxcXwHHk4ORy4c/iHFw+YO
HHkfHiEalNWyTuigyMAqMDg49ugAN1Ato6BUjzStUU81ZTRON0UZfsd7FtJHXvQ8wYEXMeYOQf9M
xZi2zbP8T6f5D5D+7D6T5v6V8j8h8j8i+mH075EA+19z7g8vl+/++Dy+bznmPOPO87ygfePP5fN5
nl8wH3vn+983m+8eY+88h9953k++urvw4rucvr6K+8L11/dP876T1f1Z3x3x34+R/uv0z6Z8j8j9
OA73vvVXfgABC6EnLg5gHFyAcORz5cCPAlodlDAqmAgIVBAXTToBBYJBYKDxyJoLwGH9eCcwWcwT
Hc0B7Xrnl855vL96eYDzfegAeceby+Y8vmDyeUeV5B/7fdH2vtvtTk/vt9FFFFd319dRX1/fxb/d
X93Fvm+zu+z07d3U/vMUQDBIHLkOIcjjwHLnyOfLkcfhzHNxHw4Dj83H4vmDgHFz5czg483MOCEa
lJWuiOKgumguMBCQBiICJJVgAA1qH4wbb/8wehOMHNmDbJz0j/PvCy4OGHzicY57NnvQLaAL6K7n
Lq+inZ66ur67u5y+8nm8zynknpy6vp6Lyefyh9+87zvJ9++984B5fN5fv/J53meZ955x5fvfvn3j
yeXyPv/v/P5gPP5vvvv/K855HleTyIt8nLveLuK6u56Lf7uf8vmPP5zyDzebyfeeTyPJ5PJ5nmBz
unnPB53T0A/3DCCtNGBIyVntttMuHMC2XitWXaQCOAdoorrAThAYkAYiBUsBx4FJU8o/Aaf1w81U
8W1bDVv1okdq5Fetl40L9Fd391dXV3FfTs9PXV9OTl/FPz/34eT7zzvL/f//P7/7f/7yeQPL5A8r
yB5gA848n3zz+R5HnPJ5n3jyvvX3n33k+9PK8nk8zzgG5yN3I82zYCgOJvNE21LsReSvDHENUI1G
zTYDByEalH2ijOaguahOEBCUBCMCBChDAI+sH7gmlkeZ4K2tBEzNINF9DLhvav0ek8NlwuxsPnr7
9Vsf8t36D0M5P3c5OX87dzk7dzry+Q87yeYecAPK8488/PTsV9dh5QHn87znk8nmeY+9eced98eU
HmeQDyg8n3v3vrp2du7+K6u76fv4p+K+3q732cu7udvr+KKKJ5/M+/8n3zy/egZUp1pgRAP+pqXS
0cuVfnCGWqtRWuBGrBiqQeuYBKGOjuWhOSguIA0ICioHSMFNDQHsYPwDvl0bnXWu38/v991a7365
NwOnwWxs3jc27pjVo0mzZbR4Tw3T4Lp8Fz+fyeQeb73y+cvru7u5y/vp0eb7zyffffH3w8nk8vlu
pyciup67v7+cnN69dOXd1Oeviuot8nLomyitULB9NJyh41vrjTce/xsAVmkAG/t78PdiAy3AOCEq
lF211AFw2SQgMygIggEAMhYAEccDyLMSQSIhir0zUSDxVCKZa8zxSUUWg2eK2CaU5BF35oH/e2tP
/7/zbZZdgzWD9fgsFmkFgp5/M//P7/7R/c/s/uP7wAP7QP7gD+wP7v7f7P7T/9P7B/Z/bbUXqzQb
nPn4cjaHvbOQ7YAcg2zbdt2zMeYuQde2PsUOvAAeF2NsTr/X/Cfnv97a0+2uudP6507rkADTnsvi
H+W+JADPQTRPyB63c9z8r/3d0H/F/wdzuj3O73u8estokWwJ8Zkz0IA0F3UIAuIBqQBiIEfrMgBE
A66OgO8cfRbredj2C4NWzbzj75968jzA87755QeQAecA87ygAH9n94f3v7Qf2B///2f2iWWyKX2w
9hc5/b/Q27xovQdU9B40XVIur+P6D+3+0P7X939gA/tAAoAsYDifLgABy5c+Bw+fLiHL48h8gJWi
yreaFstg4CFMmv/w3dK/9cPafCgVwDZfXJVlyBEgrNKXaCFgdfkHD/B/YB8e6Ua5HX9jk0p2NjmC
c6TR/d/aP//+8/uH///b/e/v/uA/sH9o/sAJRf0wVpKIMYRACigWgCiAch5BmL0DbOQv7DzP9YD7
Z9t9wAIFogI4ABKACigUQiiAEgA8JsbYvX/CUUDr+xevbGC0QUSDwvXg699J9IfN/N/I/TB8j9OG
2bb/m5BtochzBmH/HkGYf7v/4AL5fMbrJEQG+oWNAJgBfTk5d7THyMN9P9MH04fNgG29UbZp+Kfz
fzbFAAtEAdfCFrShQK+TlyYBFAYb02BAHHgDgfj+ooafo+sgdew90vvl/Qb3dXU7fRX11fX0V3FP
T8V3d3c/d38/dfSfS/SH9hPpQAByX6VFF/P+FDMHIAzAGY+Qcg2wMwf5PQNt4QAeLAPd9YM9S0kU
VA8J1/wmxQzB/htgchzHmPMW2bZmH3UADbMwA+afSf2MfNvmw/sP0h82HzX0v9gHzY/sQASvoMAI
CxtucJFnGy/KH3o/tB/c/se33HteT82q/tH/8AI2NrL/KPWOIXqP+ef8k/8lcnRYnEAxGBBEAgAA
IR0f4ClvoKBbyHkPVcni+pWD9HvP99+9g0Gw4IP0nYc4nOHzWDTWDwSDhOJoE1gk5g01msGC2dAC
agEGAIL16DTX77yffecH3ryPvfN5fK8vk8/lB5/P5A+9PvPOB5zyPP5Hl//H/5/aD/9f2aDbWn6A
Gn6foAaAFs6dbFtaDbOgBp2n2yAW0D/9/t/u/t//f/1/Z/eH9//6H9gf2A8XkjPFgtSXVv6FYqYN
sSPVMuASQDpChooCorjALhAQlAgiC1SlaAYcaD+QuvXX87O3c/d8lz38uLn7++vp27eZLmTWsTXC
tL++v4op2eu566nrq7inL6evrqKdvr+6nJy7up6+up6/inru6u52dnIp2+v76dnYogec8/m84B5A
8zyjyAH9oBEjGKeL0gqCmCAtMX8MLrr2lW7elfcmHCEalH22iuSguGggFxmcBiMCAACEEeR+AbGt
KASBI6/xxBFCJ9BxKepVBwoNjX79H+eeZxjmc7E0ENPtr+YL8E0AJxfzs9PT0U5dRXU9OxT8/OxX
05d3855/vvvXmeY8z73z+Tynn8/k8nnPOnLudivp6cvvvn3nkHkJ6K7vr++vp6duj+0AH/qH3T7j
7Q+6Pun2gAPd9x3HdACxBoClUJQT4ji0UWHU1KSS14732cZR87fwzTeqzCCOAdsdNDAThAQlAQjE
ydy7gADyg/AMYE1w4OQBZLS9BB2YJki4GiQXprCcwUJqATiDQYIKHm+88vmA8zz+Xy+fz+Tz/fPP
5h98++8z7/7x975fvvN98+98p96+8++8gLqK6v7qcu7qcnZ+duoop+K6nZ27vpy7uor6/nZy6nYr
71/aHrh7T1wCm4DEoRbM73xSYEyHXmFFqRCx85bSNNIcIRqUdc5LRXEY1GAxEAljQ5FWLsrhYe2D
zDBhYJkZMkVub6lYRMwtsl4X8/1CC9UTSDfzcO/R4hjQ/n/RzEABtvIOQZhzDtmYADMQZhDbOQ8g
ANA0AAmsEnM0nMEmsFg4d+DvQeqd73g793j1YfS956p33eh6uRYS4RSuelS28qKKKKL0HjX85rs9
sdfjOOasrfE1tqVeh9vywPjeE8pyjaHjKa9b7R+ZSZxA6/nFpmx1ts2O02Itsh9+HlPKB5//5/cH
97+3+/+5/YAFlzWw7AO8HMHx58RwcXAcOPEDmPjycuIAkonOgsEVYQFanbQwGJgEIgDEAG5HW51g
18YNj+FAgAAAHX+uNPDMHIds6567gk4CahNZxBZpOYOHm87y+bzPK8zz/ePJ98Aff/efeff+Q8nk
8/m8nneTzDzPJ5fv+Z0fouk+66enmBz9HMeHzPC+ycw8D7fRzfa5/DXYCZGR6Gx9Bntd6HRo1tjY
4oSOuRdNpNsikI1JAXUBJrqs0eZJbDtarHHNUE4KwWWp8oZZI94EYVh2F+cqwFyJATDgIRqUVb5I
A3CAZKAXCAXKAhGAFrUYA9uqJYOFEQfFJJvWfesyWTeIkkROXFJpFkJOQ02aL85oAadyD/N6F/jf
r/9SnjTrZ0C2cwZjzDtnIA2zMO25gzF7oAB/YQfS/SB/Z/cB9OAH93HyIB8gHyL5r6X5v6X5r5oA
B9IPpQ/vH/6P7v7wAPIeTyeZC1vvQ8/n7LzA8y48zsvJ5Hm8jyV5jzeQHnecABZQYZyheCFI5oRl
rTCUUdulQCcICMTkEgD8HAobAOreQgOv1AcdqiUzHezsEgkG8JtnIdtANszDyH3fkPX/CAHX+vgG
YuQcgzByDMOYcw7ZyHMO2AD6Z8gH0wAB9OB9IPmvmwD6R82D5s+bHzQfNf2EPpX0v0o+3/7/+gAA
O93AA7cAFefz+UW81nk8pA83k8zyiXlCgBYAHeca0EN23oS7WygcIRqUXa5aAZMZQIIgISwAUEaQ
ewcWE0QCegoEIFjjqCKIHHIBKBA69160EB9SxuGeFg0H5DtvhQ69aYH0oPpPpPpP7H8182PpX0nz
Xzb5sPpAPpAPmwP7qPkT5B80fSfSAB8380D5sB9IAf2L6X+wP7Gf2AfNfSB8gfID5H+6/I/IPpny
H93fIvpgB3nenqveAAAA73cAHfDvd13vW//8nr+73hEYQCXMdwcdhkgCcICMTjAYiEfHUIQAYL0c
aB/DDFtmDS0fUQ5CH/fTticKDMWY9t20Nt23kHIOQ5gAOvbH8JtuYeQZg5BtvIMwbZmPMW2BmPMG
2gG2ZjzFmHMOYf7H9z+z+7+wH9v939g/v/s23MQB6Btu27Z8i+QA/uw+mP7ufIn0z5B9M/un93Af
Sh80f3H/+AAHe7gDuNm7YDbuDfs5/CPA8Ln5vB6fC5vCHtfxPWfwHtgEeAjQ7TDgIRqUVbJQApWA
VGAxEASkAAJ0sPYCIAEQSCG4xBOhQIoBaYCVCAQAiiQcdARADYv89jgv/ELb0HbA8L4XY3heveE2
KH0r5t819IPmwfIAfIvpx8j/dT6c+RAfIAB9OH04fTPiQ9l+W/Ej2f5c9n8R8QPZB7P4n4gfEnsv
+6fT/IgAHxHxP5Z+WPiAPiQezABtBu3gG4N4N2wcOPM48A4g4Djy583Jz5Hw5j4cABBVWd5gENYQ
HanKAnJQgE4QC5wEQQCACigZq+EDoBgTKDLgZcDLgZa0ZmD/LmPbMwhmIADbA5AHu/INt2wNt/6c
hzAf3v7v7A/vH2g+0fdf3gP7T+z/+A/tB/YH9p/f//vXRRTk/PxeHOTt9f7RtG18/tO17VyX4fPc
/yR5vvvJ5Pv/vfN98ecbAb9w3gDcDdsAAOjmB0A6egDnObwg53OHTzdLmc4A3m1vDe2cs1Hv0ClL
/CEqlPXKXAJSAIRH8rNaAAAOnAaAoTPd5e75OL4TY3/X3UmAuCAD9GohaB6HmDMWYNs230IMwZj2
3MfIPdQDbcwgAbbyDMe2gG28hzHmIA5BmLMeYwD6Y+lAD5o+a+a+lHzb5v5t80fN/Svmz5p9KfSH
9g+lP7D9L9J80fSvpQD5r+xnzT6U+b+a+lfNfSgPm/mx81/Y30n0gB+Xez9l7MD8tAAA2Djht27u
KHAHx4fDjx4HHm5/Nx48efBz5uLhycj4/I+fBxcT5DkHHmbGFVaoBEyOzgGhyoAyICGNyAIRAAAB
SdexvSB+R/DCeOH2OD+fBwYy/++x3OJp4ScQa+v5ycin56/3m/vp3v3fd8+Q+nHyI+RAH0wAPpAH
zb6QAPpfpAAH0p+WnsviPiR8T8RJIAO93AAcx0OnwDm6XS37NgAbeS6OYdHScwAHPzpHNzt6sEFw
DgAABnpBnuNklFRNf9OZG1gwMmA7DltL561o0PCxr5ZHFMpp8Pz7KUMgyotyQjAPJROdhA1g2DmE
8HGo11q3iHHXopPDZ8WMBUtwZvwtNJjXnVc1ppknE34NN2voOdsHdsyS514lYM4VgGzn4RJDn8w6
sd1Xum8b2rfO7Jz5FDU9F9iUTTPlIJ/XXgOagaSHxdOyBmYiGQZ+zwPUa49Cby4BLe5S3FCVzbKb
UaLRInIseeLYTxUfDaM55OnQtoKYOXBUZX+h+5/2XEtTYxhxZS9obOb//GgKlSl4IQo3Ywxomu4A
I1hDe4HIydBWM5mHlPA26ZPZ9UY6sm2dQR8gSMikBGKy2FkaN1MF6+WYKCXKbDuWyZmV949GY95J
fD7OtTWbxzTqx++FhNxwF931z9wsoULtAR+LjCLWL1pr+H4vJIvemFKohYKoZOEc29xb7uu6WypJ
Q9aT6NiK5s2jbxXkH9eMgNJLajiLL3ARoNo0+cX48VNLsNxhfLPzR8kBYnJ+U0wSI0wUVaGpEWR5
R9LK7dqrK9DWT0l7mlIymS6tDeiB9lRgSjLBur+4mpR74c3OGo2qpeZavWTSuVH/eReM1YcD7Znt
u5DhMZQAAqnwO4VEPfxGITsEJ3rs8AOBT0CYjX1CwpdDaDIjYT5tfbjcAP8hOBns/XDKEzMwGUyw
0ZlQe0wHjcJKZysVlGSr6yfOTZO8R8maPn8YBDtYwMUn5EFr7JvAXecoyoNoeArmN8uetx9TgaMC
xXBYkQ4yKZqgnwxt0vmGWwGjyWRekL+3zW61pTA9Mi6oIF61CLtPCpauqnlknpJJ/ceCvbNGfO6+
7vSxG7hSlXdgYm9khTT20TcMcWiUuLs8sMuJSr4kqCPALwKME54B4XG1zhW/JBwWnvnmLfqXSUS8
FSy0Xr4BRltvYJO9TvrEJnxv+Hu5DJUFVyoH5g9Qo/fiFFvN27EemdYfbrMO+FH2UW3VdgDkV3hQ
hF5J9wrCZtWj6IoOhHiihse1yEmljl248Gkls2QTV7RS44fSyoW3tsu9m8UNQtgroDtdCBKoyrV6
yb8D7n2CNY3rrg+xiIT4vlwddmeBKkdPIa7OTClo9j1Sra68YrGMw98jLW4tTrli38EW6NqxGW0k
8XRuOJTijqoAjk3z9CTKhuzdaUWKDCRNY2JwfS9ruNBjEkpzEoK6Ft6ZwYnd7nNj/dK2g+tF9AJD
bWsyFIuWbwCcukW4LhElxVeFeHhsj3wqkNFz6s9fWdT9AAg609BvyXZmaW1zNFFksw0dfmRMkHFl
92PaDapDTJuxcOp8TieXKctcaaBXq/WxXhs4XCJ9ZxfzyM0jnnspar7Pey1Eo8We4EbXuCwTXsO9
XqM+0BHv5LfuCgrANKezXMOZ1ayJ8rsIP3W8TNwflQZL7NfJt7l3IC98mXOaPGvLddWO6EGvu2f1
FSZtiwzWfHDLQ27iJDGLP41zcRDGZCkMNWTZ6dF/cImS/IRnrZ4Vwqy48e7t9CE2s5QUcnqBMYcC
P/RWJLMMpPei91gaEId+7ljmAJiTSV4dVl4ULxOZU0Lvd9rbaUc47laKJQBzab7b76Ym6ISWTtH/
U5yB3HFqlHICcPYYT8upPmIzIINYLDAB8r51mNsnc1TcK8JT2eKxCHf2YYc7h5d3dbNpC8wUiluF
XXb9sOoC4l/rN2/Dfi23blViLIvB70jtnPCbnVSBCB3BaOb38oNU9EzcvRrssJaXATLlTshx3IPt
jWQXOG48xqjnVZsukysEh9D2JbSUR04pYsrgQGuMB0LvOC4D/F5X7r/8qokmK/ErSdjLArGl0tRj
k+SEDP06fhIqHpD2oMW8/zYFRGyIfB7Xk0emlucjyU/hUzwnqpo4XJ4l4Nu8fCtiMCVq4iSV9o85
tp8ZRp/pB9VcXVfUkHuGB2Z78nnzW4bXHtUwmOSuLJcncFvRJT/GrCqWAmNbZx9fHmo9QidZdlgJ
Ic6c2y25uUdNFNCq4iOXvHjkvF89F0WN42mGX1ChKxssCPX/z4FkW8xgkEDzvAgnIYKFfDKBw0DP
SkZ01k9gQo3/Yv2h7YXo5xGBh0liWqWAAEm3yAM6uDM2EyMPvFuxwtCbvKnXVAEssk6wD7w7h2Tn
lWPpX/L0JzT8x8TgmRiUHXQocfzhRejReTZmCuGjm4sDjSkbRYGXNKQI0BPI22AgyHsQkANFjxAZ
Tr8ETLaAeEhuaQAABHABnwRuSf/QqzVZLqhPw03eN6WMYtUOvOCvSE9apG7LbgcEQIDDRduxQF0Y
EdY/lgMc6hp3c4Lv9A0A1XO24OBr0EhcriovFPkP/Cc5vouBnQf840eBT+gmR8mdao+FAbysd41/
0b/vEYEUG/57XeMoM24oiRaOxgu9URhSppG9pnQNzkC8A9kmduwqdV79JycAEjdY5M/8JW8ibo+G
Ilse6Zj9QB238/NEn9GLiCgwwH7POqXnQDTIlGqvjw2fDvCRDjvYlM1DpvRm0N7kVOSrFThe5idm
RRVyCKp5XYbyYZX12bTi5r9M/571IQVcBSkR2FoGR5unDoKd5mlfuoSyYZ8qeuMCwgE3pv7nDZ1M
l8CNPayfpOC4PpgklCztM21Zng3sjnGbppKWFVEO1WlUeoG1IDTRC/q8v2LA05MBtAbaJytwgO/9
UyRY1iPx0Jf/wHLDfqzyllKCPs8ckWDV0HlO4R7RZMg793PwLlEQlv8jAA1b6W/wN3MgP1MsMxNH
X3DUnxmpwOq1L0MbneM3bUz0Cc0ot40mGUmI5IZQ+xWqzts9TC4nVJxTxNOYLKDZBGCDR/M4Mgze
6sqG7bwyH1zLpLAIu+Reqr6EeUMch4j8hK9z3G1fLFMlMM1O3UGpH7azBFskYgek+W7GS4bNl3n7
tXVAOcV6S2PuKuGFuE5ujBi09lrObJm8B/pZYqb8zDnGpfpcjCc7JqrE1P6ax4nr6Pw+cOlqo79D
geklmC/Nvq7ZsBM/tYpkIoVMfhdZrbdotLL4GDuFWbVOWO9sJHui7SNlLvZUnyWwHeXosXNh42Z0
WBPq3jtHHr4ENWxWgkcH63aREIRQO1mDff+2H++9Isqnl96pLpxuIDC9vcSQiBFJMFnn3MxvEgCW
7+VOgrXuzCwe8W96Ahiw0YK6fGjvV+09L8pU3tPno2QC+AAzQBOp5H03iYvPKt8+4UkY0apJFbkq
S63JjtHuYWSitW8z8er9GMobG/8o7eH4/eAzn4M0pWwrCZ/EEcEJxMbyjLFZ1Ecp+hVF67iP4YWm
dsSd+AN2JPmmMEwzsk9BBBp9Y3Onb5CXRCpHg74KsCIFKBtT4YwrOaTdxqykNg/Kc84uV+RGiWQp
CIpYibFd02vYzziBky4rtSbjGP2vakBi49eiDpxBl3vw4SAJ8b2vRvDeOY0jno5ySc2kHP3lcXM7
dTdMrW1mt6Ya7b8DihG5TLE7Ne5Z9C+52vGUTj40e/9UNe1shZ/sQJ4TqgCJHAHutXUu8Ehk/7Ql
5R4oUyrxLSu1z/Yd+hLd9PZB9VDzQuLk7MOe5epkg2Y6XEKFtQGUfLqEYD3DKuBBlCX83fD50QHz
d8RB4pNiw3sf+FQp88IgHt+NSgc2l0lpbDfTmXsQEg3ocV8Mm0MOCvM5dulOPonBaZLe33kjHeUG
FSFCW3H4V9VMZLdLof+tTacY3ylHdrUZcZBcZGq2xlPTlMPrACjorWaCrIy8XVjBVvj/xP4Zx7uy
R3rXhs62vV4j7QAAD25Bmwc1CC1kymAomP9T9PK70qmV8HqjKAqcc/N6BSGe4PX4upuOz1svI27V
0OVtKfZYDeVU6UiP3+Hu5njWwo0XsP1Qqk803fGlnymW3gHGngbuv9fLBnNCu7GHpvD7iEFuSwxw
ng7HJgW+tDy+9pqAMu4Eoh+DJ0qrwktcWFe+CbmcRPdL7iC2gPHyZPBy977TozhVVCUqVyKv4+oc
Tbd2p/kqLrnZJugRv8X/cLnv7eFmW9aZfj6pZuwHqXkm3AlVoY/P7iR96O4J6KHp1JO3GaGplqAd
VwuVtyWne+Ho8eHCSMcvthOIWt3RLtc2J+So5adPjzVRJbPunxb8nD5t8udVbTrzquK9zFttdUnN
kjCvk0b7hglKAX8nmRjQlH9vz6ovSdSTenqPxmAGVD2xKHbSuf7WBqMd+8LfZ4VoRh7LiODA4xtu
PjSnlF37aoHYnmIRqfKmR5yRbLULENvrdNE9GT9+cHy/bv6XCuf3WQwyh7YlC3Jl7GOIkyGYTUkb
dm9wmsP6wGoyFmtsB4eZNN0rO8WadD96+JjXDo3hD0iK8dmm2s9mALFsKSLd11GgdJSQTxhrERVB
11Wf3PBjzL7Hy/CvM36KcZRwsmFS7rjomC0d5qtzBwcr5yakk3ZPDHcCwVUbvsNQb0BIe+P1Pys0
VnmENYPUCRrqoWPNIJtpNHfp5WCRDdgJIiTpirDjmZDZZ7Y9sElat1wJwXwW2PL1Ycre+js3CGS7
09zlFpph6VvN9NUmZik7d1PcazUyUGy0ViTejUHCSr0PCpf+XXVI0nPHU/vnPzXbXWR05df8XY58
RIXI49cN8p/KMNasr4PNa/RvGJUZoDUJfeTXiatqBWnCVeNUMxtPWfx+vjD/IY6mvjEG9g0Ue1MV
MZJVeLvFdf4lFS9mUZ8xOF2L+nuqfQ+gMI5x6nQAANpncdF00Rn8cHa14oa3H7YdFoXZ7rXjxa9/
bmwRq4+iVpir1x2yrgaiO1mQeAvAXqs4eexvpCI9Y2rTHQvWNCPimOc/5+6x0KhcbUH2rW8G8m2H
QHGLvJ6H5etHC4zn6xSKLbDFAKcLt+s3YVNuZEk8wjE9x463YnCcA0UUUCOmD3yZLX7R/zH0jCdD
l9+TzMKtKS+3NrthZQlfJODiAfPRBXUXp/IltS3UPeP/yNPACqdomd53+sDmzPRyhVKUUVZutZc7
nqzpwcBRSDipC1fK43Bi7GPJDHT9DbBk81Q5lPCZ5S3kCFO1K2VdZiMULMrDUydtRCzrhfbB4QWi
uyuPPYG0xwPh7eReITpVoHEjRkvf53jPrMJhIGoBqqwkn0CfKhagSS1SD+evgwfZvBhgZhM+Gv5z
/dcUxzjauWE5tYAexlUTODGvPtPHz/qQeEsLVSzR/nWaLuZDU8YfZomlq5aYZBaAtvC4eamY+QKO
WzCXNSAAiw12Bs3P/5O7I1FpshnEOECT1Wyfpq0LbCSQ4djJjWRsZDacL9TMXs5THXjRLQTftq/9
VMbF0np3OSaun/1M3vfvXm7wO5C5jrKQbn+c3edYvisbt0VM/xlpSaHNrehpdjACbYXdcg3Tyw3M
14evwWaqGbMqtLn+o5Y7/62sTHI53sLEicYs2WTTAulKQ/ZDIIux19sQlbFj2JfG+ZCle7JvAJBC
5WQxXGDuElQ9/zZzPgZzyfS77RoRxTXTThojAkQoS4XNfrcc6N7HDnTj+eaepFn77f8Mzf09M8ib
sax0tolQZy9usgfhwzL+Y9jo6KwVQWbmJUFw8JRXnBO9BvYSrO9/tQlmgRyeMkh/w175Ul7MFLLB
+rcYJD9EKpEdtiDuBdWEzY2bv1ofRUnz4Vk0dOIJXD0YYrDChS/Z9x2S20DoQ7WcFFKbTZUgwwVH
dsXoP95m/xESaJps6NInUD35U8eh9IlXTIr4woXIATXe6Xtc7+Y4caAo3x0NSSUo3/Kxzk2+Qn3G
BNu9qVswaxHlilxp12uOl1wyVy9SGV8fX/sOZjA/FYCSF95fIqJCDk4HUUj4uUKAiIicaaoZ18b+
8+Q3OfiTM1qfzmLUbE3CkkyYSViu88Gng6A2+CUs1Wg6xrEUoQsW7FTuQ30YDTnXeqHyJbV3vV3R
FTWnVkBjAFpeMO9lo7i+2CDAnWqtxOGRNOeys/8r4BBjq+XK1wmbXzriK28+I0rkGVupqCgDX+lk
0PrznEydgIU591KvquIpAgF2RG3e5CjTME/haqGt/0OJI09KHGrVdJMSKRZWSjyDsMswan4sTUq2
1U5qxDfiYqMNvnCdykV/GDHwfpp3R3CElTFu9A0XSzf+JT1aPz+zAmr2P6TKB0sg5ElVLLt+2jFe
x4dePNNmRcnTfP4WpugzRebfof+WEWr2qybYG1h7ERiZPbi3GlwjDymBiRnfXfeaHRMxntNYW8t9
en1x6IySfxNXoRzROBXj1Ho7cshTSLZTQQAOvLJwe6jViU1mk0H8QxPxUhbcFeUIvMAyTyyXIPpB
dlcGtTJ/eI9DvrI7Jsyghtdso9vK8PcscwsyWcK78DFTpXP/JLKVm3iUkNwecw8B0gZe4r0C9A/v
tWWBQxiVAcKBJMHrDT4INiiJe2x/kNFtjl/RzWT5p2dFKsg7rzy0sS/Hd9Z3KzCYUlWZqWkkhFe6
No6Q2zQgSGmKKgttG4mcNb03ThxkCIgxQ2qeazw9m4qsKqAmybKX/txg1xVtF7KUlhaCZcQpjhbv
rzir4I13btg5iE0ehruH9zs9qUhtwxYgdSGItnq4BhEvaDJV6GWHR7wrD0a7JexIa5r2T5Oh3qr6
gn22rClt+FqbmBIWn5ZCfTLEocPJF6+Xa6tDZeSFwZ2Ak0evkkWgleSlMcu5AtYZoOGfp77B38Sy
f+rJMMQrlu6ATjrOLDjyidUsGpORujd79avaBWcfK82hTk7o0zdzR7IT/dRtn/oAitn5AYVhyeB2
r6QhjfXuNwPxXKNvaG5Rq5yoppYredYQaveQ8Q/4TbzJPy4wMo2ajFezNewlpEFcW8jxdMOBaxeX
azn1JykE2KQeoqI3DkP2N52KKCEE9VbDf1b1ZQK32PsVhvw0BzbEYnR+kmNlE96aK3+AgQVGyGXR
xRKz9Gp/h4mhJ+vSnh00xChOueIbyNzmzqFKb9VI9XnyQE08tycd1yz8Eq5doOqNbemRTJSE5AZ4
We0AMabUWQY9RbhYPXYpP3RaEYpVhvEXesvDc/aG7uGNAzCmrASYZucAZ1GCgQMGBdjRbMprBqtF
CuSfUUVVe/ZPUodqkfC4DsTrQZ190xhw24BOSRNOohegy2OyuP/v7hDWs0BKG6DaPR6psmvbA9Kk
UFlu+CYrbCi1EBANA9biNUoMd5a9glGxHg0oDSs7t8xHtXJbh4H3QbdyefvX7NO5oT6/7sE8nL47
Tt0P+6lvEvLIgVnK9hvt66DLdB9COLWXJuYLbxkAh0DN2fVzFJP852zP+PWGbmDmN1v5Xdb+8WZi
SNv7T+5zZ9jnpb18IxrFnW+pwYm+jvf2Y5PcZIV6TOTHBxem3ZWkOQM6nGhypA+qNNZhdeyH1Bnh
nVkg+eTaCsuR5UcWj4fs93GWSbCuItmI7oa8BJkLmAZ0KDVbbHYzm07eN+Rf0b8RZuoczx7j+3Os
qMbVZPXgZXwMokffDbVd4W1sQ9bpUqzfTbefyNL9riclNcNCZoTmfwjQO3R6AHWg/IzdycCvdzUA
gmww1l1rm+0O4NHNIjhb4BFzkrR273Lkr/ViT9k6rA/ME6mudUNX2tByh+QEkr7R25m+w7VbrHnq
Q36/bitFL7xxXdeUkv1YPYb/VCnJAz4zSDnj1nIOhG7hFHHX5pJ2CQkc5hb3Tpg3v9he54JzINsg
p/UjsdBSpCgZA/4YMMt59Kl0oFTb4eStEjqRLC9PYvcwjnXg6holiWokyxTbCUtVgQvTUZOdr158
k1rwfHGxwMtWwqKhlK85xeDOMzkmJ7qgJXVpaI6O1ZamqixWCP2UGGWoa92rgyTwb9YXS2vzUghU
ur3TDcTve5P9JUWWeQoXT3MEyVnwFndEPTE5PpPfE/FCL+VA9+P1/LdSeYc53u0PyqLbQ786Iu2T
I7mKP7a3EKyhPXmvDSSHcbcglU7EKnePOPcPxsgmLsIDtIWTdPCSPLytKAo/knUfP/k0CTX/L3da
h5orQYqppEfdP2IbgHfZ44xajO6FZxAz+V3snhij0fhJdb+wpdP+DHFL00GYKp9xC7NfN2zh/noi
pofB2oQL1VABHVE5ct+IDswiaEFM4cjBnetOY/3qsU6eppIf1YBSrZeUHh/H4gH+quroIO8tcTGa
ly9j55+rrHGIumK8ZLW4QNO+6pkmkuUOaUz0iA+IjcxACadGV0D+un8sys3dE7Z7HLfcYTo5GmXE
o5EH6TkjAIG6aOJWDIw6qZNGavC1fdhHc8oLksuJ/r8rdmOTKC/TqAUnFUyV5NCEjFom1pJtwDS4
sg6mxUymGLu4WkR4u20sSYPrE3xPvGb6JNaY8xAmjCzX43NCwyQSDyrDdjQ2FISHFf0Ar4VcbxwX
qrPqetzHHpnXRQzOQa/9GWR8a/v0kGyv5NOdZKgnDKu4JnDaZy35BFX1I+s1M6YSS+KVBiMWSQIN
8/tloXl1v/Tlu+0Fvqf2Lk5qy/fZlf4HUsysrphio04bfdlK11MJYsquMgK/U/fkKzZfY9ZdNHIj
zh2JpMIxwWbUvzf1LaRhycmQtxiEg7BGYvMXumRlNhJTb/aPs5soP/lt2HitbZBcMCSOLS9RwGce
iyXcNgfvIz5pUVSl474tZTyuL4nUODDmsnPWWFZzO0kZjjrwrbCBMr9rM+Z+LCx/eNb+IUM01JHV
O7rIYAgsi61Hwd6yeAbu9qSaZv532OvHpLJwIiSDFKWMD6l4AGw/+zMjCbYzwHuYLBzJgDsVsW3y
uAWAHHMx1VPKs2/p66ee/qbvhAdiXDwo6ANxPDF6l8AVnv5/BhNCq/Ubz3/ssZfOywjFUddZhuN4
wsnxysTTMlAos1AmZXQrw05nfID715lcE5DnpY8lgx+UOf72s+zRBYqX9QmrfHDERdpoyDjCYzOM
EkhuX4y7UiBdkB9QrsWegAJ4OhbOwnFaKJKyaZq9g3uTAXDK40LrkUuP6MFDs32LiOe+lZoqs+CN
KYHhIkM/1QiEiDfpIJ30MC7b7VWdw5TG4WfPks0QParAp5y1l7W6JTNiT1qQBb8W1Fvv34Vgsu9o
2tVbNZU28/lhBDQcb1aqEAnlajfi10sn1ZsnCgI5gQAAALsBnyZuSf/X/NSESN/a37tZ+JhN2CAv
BPj8QgiHuMQkyNnEgiHuiXkJYyBpZETEp3OQEBuXJiBPlyobQJ/wcMaiWdrpyFZc65ev158Gklru
NRXld+DelBi5S9F++0jVPrq4Bexm11xNaz0SBtEphzCUa0gQQXG9vCXlnDZtKiaPCaFgh5QgXHBR
cEJpzajnx4W+GnJi53t+C/vDWt5ZUlE3h1oBURgf0Z8ze/TcP66aTC8u+G//FY5xWnmpAAAedEGb
KDwhS0TKYBH/7j4dY/ns9U/yBmJ7ZgAAhrtBUmGTsB9QI9agq4rE0RJptakMzC1lEV/eFO+jM8HN
ewKUgXP6KOeTSEojUkbm7F9SxlIMWNQ7Cr0/9ddPrPWhjwj79jQ2CC/Pcnuf6yQ3FoNzadSIOnyU
9EIdPrg1/wVaTeBcojKsQFPhtOw7ZReKn2IC1u2p4rfUdNdEMVFIv6k1ZZnBxVJnDK83/TFhBAOK
mTGvH7yKVz6ZPLZNVjycV/yo6Bp/YGikGAgph18Z8+FC0IroVnDuC1PYg+TFugKkW1FhVkt51/zd
oPrOsteiAeeMpQFMAV/cqJjXxbF3BAo5Q+WTbFxVXSmX4T7lLPOt0qh/gNpSDLUVDZNeKxV/FpXw
77imLyvUbf0zJzEv+m1vfqellk7xFcg6/xSaF8adrMYojjDBhcCs6TIGOQzBe8Q2HRyy26xNIknQ
YBxO45Kyn4hzBpd/JPuexB35v1ouqBAnBMjVjHJQeLWTtM+HgASwRGToLHuc/ws7OiBAvlI8F0/w
OMTCg75tk6u85FS82ddATL7FwQyBAPsIB0KdIADuM9ZfMdy2KB9f4V52IowCHsbvvppjEeWS64oA
aBvYwK0t4LgUnGGF1BHt+naeSfINL6RU/hDEjgQV1pdgi5ixY9TUK13loQFumjW6rehgbxb1hsYm
2vJOaGoTH44qwd4xbyZj2gPS+OsaAYsPNmvW3+0gQMkOUk//UkKGeW2gz6c0yGdb/0kXFb1qvfuT
MBjtgZnsAKx64FRm6GwkmahHyWx/tVnO5dKGlOTIowF5jikRvqfbAbpV4ifWC9w0cN7HTSVH1uj8
AK2An+vHxvn7P6N6C7Gj0IM95Qp1xIUp2UxvznbDN9tZeXipUbOU4FGwkEzRsppdWUUmRDCq5so8
9fHXxiDCWfSsvOAtvjKpp4/7DjNDCcyU8pu2hsD3UrO9OiYmMvg8a+UiEorsiA8V97vlb4HnaP7C
Amm+4biPCDLEOBNi06US9wgLPQmnVOQ2fgGdq00EDbIxBj2fTYrgEFVwXX/ee39/ywrE3lTHC0iW
ThZIrtmys8eL7gN7CC7Et51RHJfv7ydsHUTSZKyXcn+Ygnuo+zrHo0R6Gt9AGBoZYAsM/ttadwse
OHH7nGIYFmZOLtv90KODUNPJRnfAEWXl7rlFSKICPKeH5ZI0zZM4AgDsgqJV3wOt0yMohpjl4Hse
LKUSQ1eKzRk5zkINHgXuxkaf5oRc7mSCyIH8tR52gspsdetTVEHwxseCirETS9DYXWrVaNCWHsMk
Wclvh8imh6xsZIU9MPwLLKFvCFw3oIh0+TK6djMU1EvBAB16IuES5mpffzAdE+1Dnr2r3od0x55C
x7hzEwVD+o8e9SsSyFuG0mGCqrYhLYHnbhAPuZicsxJPVNBbYP0B4miafBIOgrNUC2PrW8pXpcAv
DX+eMZXqvjnwM7eADyjWvyubpzvPRDfF8c/KJHWAR/Z+XHR3UfXMr2hifQsXtoAKIBlD+dj6bN5K
eEh/yBiJzb9EPKYtFfx6Xu8iuWSBL7FN0m4APEmE1SM/StmXp3Z4aKQMEi9WKlp5Htm9vQa0tuPi
ay4kOwqz+2KeZ8pVV3E0YKQ8kJOsaeA4AIKLkn8X1w5AVrLVZ4KH0FZYL1Ub0LLO5Qm34AAYGph0
OLZawQg0KjMWn+edcsX5LrsMfU4dWqsvknXkVEtjVaY68tfa/c37tNFOYyophvyQOvw1NTv9dey/
cF8JQhwxshsTHeI/h4k3r/02nIn0aiJXDs+pi40uRBMqJO/FPNRjuZ6IdJJFRWv/G5a9E84YD0sP
fNWDhcC03q/3j5C4Ndf9c42uXJYNZsvesJigFGn1FlDbPlNp8tBkm8I2v1glLQQHkQ+JdoLDcUWP
EVm1rDZkDeDIFK2vm7F4VrFtgPQDwagWP4gU6ucH6dz3bCWqcW7IPPhQ8iZUo4JnCaIZYoWRqVJK
i3BQBRrK2BeTL314jvQNc1VZmqG2+ZShsnNP9u7UjjuMdW7trG026Ps81jaN3AQclprJUDrhMDzO
x27nN/k4kBwf1ymVifWUVX34dvAEi7eNb+HsJKJAaFJfa9aFPJ1jGvZ2NfM/1arsMuOZOLyei1iR
p5Y+2isi6MNsC+PnNoT5+DD1hY0XPfgcTlmjRrlqiCTPNgSkZYlj5ikqVyBE5vgvmf3K8P1iW+az
i2iXqXRsif1zBbwNnMfz6xyKJ4y7vkigL2wBqTXykr2jOuB+A8i3zpQ/wke48CLbi0UD/ORZTuGv
zLcglq5CgmyJuH9su6uGa6HnSHbfysEZmckYqFLiK1QH9hQv010Dp3VoAfKUVtEpzA4yOVfw52rP
Pp6bU9+jBcwYrDDmGoI3UXiqy/DGXDStVjWMF+a/ifVPIBA/VpSx+Mk61kSpWL+N1lyFF+VEN7MD
sLbYM1cnn3mWC1vG5EkcHqtTVXNIi6teggGebQkkCQFm6OYIn3BsbLjU7vOMAwQ9Wxg142AJAZyN
wFU6g9VDliYX9e5ZC8sXykGgl87xgdSaqlZdV5sHNpXlbCi5DcrcXDFRbVSGitVQEkcxtTHLc9tR
vdRRoBc5bXsPekkzFJQKpaFJSZI09dHlVFCeDZjRIpYq/fjUIO79RkgGsOytTn0UAaP0JWCpm/3S
lvQwlK1MRwoVDea3wWKnuvMyFXiyqTvGMe/FJqRyOk3DF/qTcDa7ZoJF1IbfZrJ0lQK7njfcWvcf
D8J/CzOzxePMq3ys3RvCc9NlUd3iqGZ96vIZs3HOOz88FMNts1E0+qkpS+oyhRZAImMdfvMXLygv
WN83/04cQWpJGLIPAsWmy3GZVUgh2iJdnIR3iRiRWlEFenImgV76M7+h5q40mI4LIY4xD0poQwD3
1f4VwqUPHvAOhiC3GSSSZyyLRtzAF6iT67fV0/xbUMFeFJrnmcVVqBb9Ok9slNAIGMjm0pZVdZXS
HtiCeQ7bO7sLuKVHMpySr++ox1FMFc+zA58sIR6CFTbKN/K/S/AInMYExk5N6HYsoaxoDe+ybSSr
1KKO06TupqeWegLnv8OoAAGwONPjnivjXB0oMhP4LYqdYf5+oeyaCOElyMqlWYDntoM2zW+lXTW2
rNiCh4SBa+0SFHc3txMb2+fVFTicxFlJln/45mLjk4MtZw83ggGTqQ+sdP0C0Wx5jgDK5VMnII/j
r5mWbLlx285sVHEYtj2cdp9ElNbtGeDnSbMBu4GyRp/3BOzAfuzeeYaGiOoI4/tNp0QmK5AAwt2n
lmZz7EJSI9LPWg5gOI1P/SHSz/cz0t+dlrZaxdexBVXxVE8S8CzHKAXyUJQqJHCUJT71vkU4XTsa
s5eLMjEnnlI2fxglqLLFSn8MKCgZ9z00PkedS01NhvG4UfEsIDSmgWFV1PyR/ardG/lxY6rggeZh
ITj5Pmenh+2Lww6wbsIzrWAzJrN4JFmYlINdgdYBrWtiW1jZMUfDxyPv2ot5nmlBKlul86G3mRJZ
Qf9o7cQsS+tztesWp3vQwHx4aY0U0ssRvSDXueVQCAUwxeyoirZ7VfnEWEfTrK+1QVkzW0JnQaS/
Pt6/sxIEAtVHUKEo3h9dEHKENBlRrvobFKV4ZO75BHqL/T1/eotEFDtW4PUQuIHaNJFs0RW24qx3
7ijA3d0/R9IkUReKYnRsi04JzX0qEJhE8F41jQnt3kf1+jCKH2VSV9UwXpH2H1BBgolnSzvqAbLw
uB6E5w9NW+p8qyqiTKzO/yuNmc+Wtoc1u4XAFnE24fLpGxg2VO9gQ+4d84/vUE/u6UsHdG8E3BGX
5Fproq1NOxn3HbF+jP3p1YcHY/lrRKLBcy7TkJeCFz6syXbnEsJEA9V3b2InyrFoy4jTUyAdDTBi
gF13t3J5t9QZbPbjAtJv46I4nn8iw9K60gPxfs9PgKskC71+ZbRqiC6sebd4SP2hRNnkLAPfOZqS
ySsVy/IoESsuLnVyL+csvht0wI3A5/kFzwOUpk+ykrrB56ABfLJdHhIgbhzL/mA0VQ7HwLyBFBbe
RUqlWsPVgjj8zc7kIxXV+LZhSNeC4JDTpI17ETO1+vt/EJ57yff7XLM8vhyGLevwMO2gGF7mL8i9
kdp+OINl7wCYOruSGYIw/AAaFziWNobtkT9I8kfG7A/PZHtlDDKYZj1xEEGoLpnrWM2NRuJvsokM
ithykTC3b3dXvbZM06+fb6CX9k45fKMBHNQbFv0zYCrkZaL5coabGWHFv1CfoqCl7VRBWEY4NUvk
AJ1mvdMGesx7Uiz5u8KwZ+z/UQ2MrHOOlumTyskPV/Ojvhr1r8FjjxZxuFJTgxY/QRCyafuRtcI7
Ij1jG/gROZRyvFUaXm56EizJRC1kwnlCZLM31uOBfhdqu63mwwXIZYBr7AckFDJ1xCiI3TugB9wY
dKIlAqxKq9OH20uiWqTVvqLIoxV5U7m4MJ5g3BAXKRJio9Y/wiJrn/GF/i0NcJsKMtMOG8EU8A3m
R7Ri85iFf/NWNp6oFvW5+bHl3cM2jUp7yDPpQDt4dyMBdT6qOJVhrP6d8yJHct6HsH7D1DSlOAfp
RLjCMZH/Ompjp1W8GySfGIlTSnmibbDwWHvmYdlXxgBh+5pKyYcz7Ic1CSxGUpGSY9vmhUtCJbrM
nbyEM0iDR1PLCwHTg7QUVprhI1CKF32OD7FJ5wXWPfMusj/078TbSYwNQQHqBg2ERGveGxevji5h
jjBZHczQf658yIzOmjMQUYCvr5S+gHOX/Kvj1qaWFXHG76muRkZ5pkb+IgZ083kJ+LYjQff+iXvC
ho6uAzDUs/DIBMvkDkow1sqvUaEFoeFa4V2v+7A63itdpBYgeAvCtDNDwcKKqje/r00D0NZ62To3
QGmyximjxjBbAdJ7NEy1WpALs2ylp99pqWlF3CKg0FpH57lMLlsjiqhMxmq8fGlD7xCLsrFubXko
DCEv7nYXKTnMzjtEnqPgD4s1KIlkgZJanpfBlGktD3iH/3pNH6dcIBGZN28OuhW9lbEU7KnyYaP4
x3/89TzUy3rSiYDCtfmdRv6tWZnkSYNwFiCJHCC0V9DG3RlXnSzJ8nHK70nTTt6m7ibxBDv7Urem
VoL3AuwvzKfapFBbUJjUWhwPu1KR6SbG3DwXRgMO6+Vj1ccSqJGfo34KSNe9MV63LRKuH5eAfAsq
Vm+H+CmPMFxhE25jVI7tt2q7giZdFEV7A74KXUluHNt2QdzbTid6EgA0Z3EbCp7p+PD/HA3Ak8VN
utACR9m+BTFp3fsnqOGELOXXUBCKWL51q2tCKUZPUV6JM+lwnUq6USwQRwO8vkwRBk1aL6p7qnKo
hMGAkBeBXT6x+dUWhB4s4bhZr4r8gnj6FVuhWa93Mx5YkNEsA4WOUT36zXj241Moh+PWo37FC1Kc
aUnGeOrFhIUQDYyCFMWtpYDRfqj5qJwNeN8lps2khwRKDunM8SLe4LnUjf9jbmUxfvTWizm1Gtuq
HtKKOuTmdR8q+RbSexVAosZE6y9QYlMsVh3LkbN8EwDYjr6/ZJW4AIbce6vgGlfPb3qsSEGTrVx/
6vh9XGf+0MincFsxSe5BWZMuxwT31eSwC1vvzjt3ODIw/hPWzZS+vcpUMVpwyaRLUWN3ciMv6UAb
wyUW8zaXsqmNlI91h+kqTpeL0QE2h/nQYXMJWZTQzx83fUpF1KYbk2JgY6ysRq3B0e9yJlo3yTm6
Vjs1sLFNfdVq8/rLFRFkcj+v+Fwwg2wfTHoNJu89KAE1MhBobnr4H5YVK+x4bLeL2d/JpCe/SHCW
WcOm3AaF3HTLJUmjk8BeH84o7SX+Jd2dRruK0CQP3osimLJfmElQ91PkmEabBD5yIFzOP/ZG3t0X
qcbrr0UVec+S8pTyHkzw4SOcS96fayks9ZZVgVZKaAkl9KYXGJX/hKC3UKrbRueDXcSlTJw5AkER
e1/ZCFuCQlmhpt0y8GKuObNT++iboDyWKApERlTOPbz0LSBP0ApaA/3j7bfOowuNGVW2hJ2AE61U
3fOCtjV/vvqhmyMMPRl8RnPBakWp0SD4je1/UMJjzoqh7HDk73W2PZxfUuC7vkOreHqvjCOg+uB/
kAvAvvRWUomZiK623m19cpI9pHvYvaONplR9s6RdmWp2WU3tZuFM+TqKorWhaaRXRMLpMw7A1tW6
ZWBRjDVM3FgXUqcvqHpNbxkmS9LlkpnwvvZotYhLmXIMYmn/r8FKeR5PT8RxPB8A7oBqM+ek59Yc
9Fry8MorPpTBF5TqM5FmMQv79yeRmNNYjS44Yr0wMCuNk8shykloGZt1mTfbb5REdrcSchmiCPgX
SBKrRRSgSHGzja5SsIrFQHxWcGipcNUgauInjHz+gqJ1CUvW6nDuiOxjYaUyzAw+QE0eVm8/Yq1Y
MYJ07UFW78HlYCxmPs+L59HzyXVA653pyHhH5fREuaH9zs19Hv1TxkJLxDDwEvwsfLBQ+pkCVlDn
dy0RmmsuqezsquqX8cBXKxRvAGtCUSuoqZcx6S0O1FGNJGXOYBbwO2kUl7f7/WAu3tm+ikJVq06P
EWQGiOBS/rlVnIZy+Z0j5sZI13PRHXnXoeKb3PsTwK04fneBvPLWqo+YxCJVIvi7MLMNS5AVUnPK
mlKC+orb3RbxOqQtkLeldqMOA5tMgFIeI31ImTNruKzWUNeR6MoXu1h7i28BLztDS1oQZJxDY9KK
q4uXv6E9o3BeF4WLzN5wwjMZrfGy0n+kieyOnQmndcADHYeFagGGbD5QtNgavM3qSiBmn9N1//bt
VsSOuPwq9NMeQFdmRmH7HndPRRusqEvq4vcvRoEJo6TCf7wmi8J1bkJC2WT7Al9WQUGlQ/zXr1F0
4sIz0D549+X9bR6zEZU1cZvanFYpquHLhZp3LndD5nCixPEzlj6SCpWZ6fhW4ngVLiVNFBW5PXmj
2lA7Ie4FmhqADg+gp80U+W3y+Yvqobe3CIW0OtgzsvRtOiFwSHHWYDae65zY+rgW9/mLFK+YMWXG
mqpclZeFvEP77LwqVsEQD1yCUGasToXC1dxxbbGRbbJoFBK5wKaDDR4kJYrA3J8v1eOJvxrfCNXs
Rv4H2rYt5YS5s1+tyP9VG8r2RFX+BbgZ3C4WoLxE5ZxHptfcCnrDAOg46BypUtf93KgCm923Plbz
tOdDx6H9rho0V+Ga00c/CcuS3wjxNuLJ2t/04KG/5X1RNyujxkZOiG2otpuIHMS89SGvEeSCVS1n
NPVDf28rT3xILlS/xkdvtEgSYo2dD/eMdt/DW/WFLaxY/aCbouwb2eurY8Q8A2OZ2d0ztb33ajEe
0sBAAN0l6HbKAo6ynu0uCeoPlX7lfvwesWAyrOsjYuj42lCJBhASl7ItHfO6h8+7p6CtGfWF2VOk
GMwlE0LXqu07uUURflo/vWKYRDNKPTmkn6zQJKcRfyd8XPxzmkfTLqOvZATQWET+rxYrH1uFGbKe
dFYd9pyNIPnf0TG6jdajN9tmD63dDtaIfy9BPT2SLl3WiJKV1M8hMPusERIg6IHQg5bVa+EkRa0l
OsFanJ7cuT/YjVeZE8NA52XtoCz+uyMbXHaKku7xUnTTSIt6SiXbfuGBMI0Sr82B2qZ4vh89XNqM
+FwsrlIR53aRlABFumq0m46npAYfdE3g8eU3hzj+gIlj1Iur/6WHewYxeTD5xAtSNUKuO2Y5ADJF
r7l1fLzbHXxsJ1cnVJsmNCsVlt7byVWXQXEUxZJ0aevp9wkptcWtJBQcI6qyhsENpDeZQU7kEGHZ
SAfFIY8qDcih7ifFQll2rWiUdgf3mVwVr25+URcrzbyS9fMj+r7UKkDTIAdX9ZXYVu0evnvGmx7A
NjKWD1vxb2dn+fXs76OFkuYWBRlH9tJbCJZ4/XEqA/Y79peXioquVZEeztn80D4XylLCmkJtBvIU
8Y/1jq9e6DBNM+6qw258VFj0jv9+4S2fTMuZ2DyDy1/4P6Kp8iq+eX9ncWDuBd92A3yQM6XZKQrq
D5lK3rqazI/SkgSO3VUtA8oyCuldB3PzigI+7ufbfuhbTPYK8Tx7J/KdfoQi/cBFyMk+xCwl/8iN
hCleh/n5htIKSGCcG049lKWgDcPk3/h8SVkfZcVhjF3CrY9q9CedzieCDEwlXmtlDGcef3vPls/U
dZ3yAhLMVcElJcq8/Tp4JFDvLSnndY0ESVhzV/++gEr1df4OcQFqB/XnffJQFJdpKg3pPROMuorF
1bCcyfSAWfpKC7lUZ7VYS0sdqphgpN8eK34Z/Rc+X5130yX4CXjmuWl+1m4e+r5dlh/O7fatjOcQ
UsAU+wBWMjFhdlubVq4DdXAWaisR3nDuBQGdN9PQN+nI2WFN3hCjgFNPS40PJwLmQ55HE8wMPSC2
g49HdiYUakacT6LPW5qeP7sNPWvIiiMuFOqndg3mP6j8PQN3ft0AVdbkUXNfiNC1hHMuCGUYyDZc
MxwqcTnkP9QrKOjum2K5KGjnP1LKLqQPoZo+zACKLo4MpW6LncsBg6EEYIRkCJ/GXyORLsWZLFFf
a6HPSaLR+aNSqEAd1z9NkZr5L7o8skAKlp5rXNBBR1P28rjh2c5WQFrplro9ce4aZr2Q2B23sXC+
61l7bIdpxVN19yUAwmeayQJFeVhKAxme8FZ+Js3dR/ON534Z3mbymfDQpHK3ysKpYdD8QI0Qq4Ad
x7U9bFWuXdgNFbci+eu9Xl9K2uNtN19VzwomKLc9Yd+ySnSAydothGqIZ0659d59NZnAEWu3RPbZ
tlL8zsCRe/SGoQx+0xCx+b7Pirg6yJxtnZMHcFgFrEFMNcLw60ebN3dk9EKTNkJi0Ou8DyRD3doO
i5b1Wet7V6AGibF2t49tszpSlfUNbH62GPqp8PT+G+AnkYs73hfw4p9x5zMOf1ynFY3EvK7NiyXq
WDfGaGBEj167hKoQMn2TlJRafMBUA1AZ0u8rwdecpQCFt+urIEnwPm6nDr1bK/hHb7Daw2FVUDQE
SY6Snw97Q/wvUf+HP15DheYMYpiN+AsyFue9DGPJwgU5lY6U/YXOIn3gPmIttjhrhcy1rowfvHji
m8D5dsNDhYmRWz0orj0N1LmpSQazuiols4Yd0nxO1Fw6z8vIOy96sDAn+22igy95HhXvaViOAeKI
MxEiPRkGX/NSDGij1jwPu91qFYCwZCf83r2iVjmMkvH2wXz4uED3fntHP4LhEdiu/c+osmpkxWIl
IqfMzKPiNhdhQmJIRp/20yeFUW5KDB2n3SnMjeiBfDh9ls+DZRAB6Ldia3bBizPq7eCoVxBRih53
MHOfMFYQTQnIFzuLzYxnL47m11jvX5RkKNOm9pOfD2Xl4NAY4G0YphS8zeH1Tq5gM8WcrG2s4rS2
wjOnOpwHxvXZiqEJQS0YpHXAZKIkJWb/B8ry4Uxl5c8ukgMMKnuPc26MUyXB5Xf4ax46QUHEInF6
/KEBCIlo+mQjxYnN+89I25Si5oFZ/Mb6qSk7uXb1I7Ojb4hVoKJrRwIgg12Ezxsfqgy7/sifb+gd
JblNk4FkNzuSSKsP5YgByzMCrS0d8tz4UAQqmzKNgXvtz0lLb+3AJFS4NwUfwv5T2rSncGvLC8Nc
whoN0Si3AHY4mFDYxsUkVPKwH90mXLQTTuuTblWcbdB/onIlzOCEx7dK5KTwoazZZJvZUaaDx3wC
DS8/ogxe021CALoj4KtkBVzWp6Nf07p96B20jWWPqZfcEDV+HHx9Yqms/yMZ5vvanUb+S018imJm
WtLVbvXQpa7PxtGtzjXI45U5/G3E+8HS6SjfbWY7aoN5KSc4uJR75Y5Ms1uT6XMNIkLeKSkC9qTB
79/1bgFQLk7TbCCTAHWgPJA7h2JEs4zYkr74b8ffLd/nDDTCifrnrwFTv0O0VHipuewCHdzT1VfW
GuzAloasdFYvZOCd98qeEVnmm3TKX4Zyfvz2ay9Nn/U8AsQraBNYeplXXFDR0KVrSKyx6N4C2pmh
/w4Fgkiddkdu0SqaFhXX5iTX1Z3Kw4B9yBMM1hwLMX3khskZ2qvjEw84KOtYOnaPloS43z86ZXH5
N/vTXtrkMiDwiM2kZegGICbjxMbTiL87qinD87Xt2BsUEkpiBrgqxn2SWJ2FhboMceU0fWXMxYpi
wfbGrIp1aO7xbndjn/qcQlkljnkGFpZVd6pTtgxtOnEO56JKwRRkLquOO75NucpRzdikefwfKw5m
xHzHI5uJoRoC7DyIZGDw5de6dEmyhtYujiQN87Puot4yImiVlgXr3NOvm90vK1Dk6eym4atjEu8f
hhc7TZwWXADo6BH6uZs6o6s+d1Nr75crliKdQtVipAV6TZrg2cj8N0kWCNILiaax7z+x8efAUoFJ
R1OzZ7uaF6jTJUYuIoJoRowX7xCJyCLyIb3mYsd1BYmxCWjXVrZ25GlgAAAf4EGbSU3hDpaJlMAI
//pWoUwL1Nb1f8kWeKEDKq+rji1Y/g7KDzTPjBxLoou8mRpF9D6f13OZMmBP5AHvKDwwkhyBD7/I
oBdmzg5hNjH3XfbXaPJA05Rmk1zdtepRxmUkhaiBjHNxS2g+OOEtLq51zBSd1UT7jWBMc6jXUadL
On7DN4BFwEndWltC83kwvgB6zWAKqqHwR0OL1NwT77ifYeEo4inE9zzwNSP3ysK9w9bC0MO56O7A
GzyM8InG3vSzQ7Mi/I96WkF90Vg1+C+zzKCibzTOWx5Qe6KNLCg5TJBZb4iBWqjJRAXku8IhfEql
SvcE0zjj/WX5b+e/EX0mN50hskxl0bznTn7U4MYCePNPQTAtAAag58j6cGg2xAMgj/1rBROpigqv
uwWx2/ySMsVeFP1s3fRp43HXq83Xo8E8za9/jnSc0EnXDCmtX2opjfHcl1cCAjZSdddzrViTempK
JNkIG3Oi4NBwa5gj5wNqc2ykwwBx9LMDIZAevY4RiWGAmxfIhe5JKhW+jButnVDghrxig3BSqB1T
T2uzgg+f7s6oRIafndZj8j3uHQD44F+WaH5PC56uWuo0ALNTY/TBYEgNnXcFycJJVWv+UsrDAn9S
lgXl+xDasaBHV/gtYMAD6U9XOhn6+Hwa7Ldl9jQE4YYoeVuh/8Et6xW3rk5c9qRsml4GQMpTRZFN
bYeBbuMZvUfOApYj0KkkXGz+erAIw6a03g/F8tQH17bsfINlAaG8YRuyhky8tUDVSZd99gij5FOA
RqKRlD6zpsYSlldTjf9lWvKbFLRaY36ojRIS0E1quqFT58P1JZ8aY6xCMHqJj5V2oXt7ZVWXHAW0
jBgxAkgYN8GlEKHcCXLp4VZZxq8/706hAohOrooQZdsOQv0FjFBxftT1WxtV4AiC2AujUoPu3UGN
D+LT6TPiut6GP0YaBJvmYbX5nsXwT8avvRAzrW5kjpxKIy6Zi6ysW8+HCn+O6JyJKsfHEJDdB4VA
INc296JLZq60Z6tHTV+vWsMGtddSA59AS5Xox/ofcujoeXJmcTmXkns0hyTPr4375SPwkcHkWhmE
swvucUTFiXXFBQqM7qB3qx0YBvmOSOMrhxDHtUbQuccpUtmscX685Bjwlneo7c0Xcj0g9MK1/C/z
vDNSEtGrcSNG7BszAw+2LEhEEKO3R74LWx1SVC+dsmvOvQk+QOiHSwTSQDkGVFM66zaKcOkHHbYL
RH4V6rcEzwet7nfa41ny66INpyH/ef8PVWUmxgI9NuUdne8N9j5fmQtkDy4SZMVRZwcKo6cCiJq/
MfQLo5hEHtPYysUZAMimQZpRabPrfRbrnQicUTKPZN4ep70QflGltEPOy1rokCywSRyQryMYTNyH
PdQ9wnaz8KOm0oGQUs/Ccx/LhdruXgSFyXVMJT4wHDTClmk/jLQqMX9gk0/Uy90y4Jmjw12m+t1i
YYgCljm3v4Gfaz+CjVriJHRoDIaO5WjBquVv5rnseCdE2JsggACbPpnAtxt7qU9oEGXA/DYH6DPa
8JeASX/O91vK8FX7wjqhxA9Pmsm/k6jh9eTxiI2Kl5YBEbBtLE9E4/Gl4DHZld90z0V+dmLzJEqE
0ZwWrk3TbaGbqZYp3IEnNrE05MItE62dt1C/fOniMFlo98HUTEWb+2xYQvlJ7enP4EV2Hkhk6MD4
fzFCNHfiPBxvA7WR8SNnba1bbeoi8GZdDHrypyavktGJSGejS6ISlSnyRfhNTQ0os3rzjh/3NBJc
acGjKg2P7rRVzDoZP+qx6BI4adqMUNx1CbdzV1Y+xK7WkP6tIcPg6lYf+ylf8MzY+tZtAduizC9n
J26LbZq+IDqnS8+NprB8BPrTk6AscNnQT2N7pvxwDYv0m2ZUNdmE91P5/UOk3habATB+16Ky6tTz
d2h4TJKz9/ufPQDxIaHLeg4/cyyfxzfPdzXEjIXcYsq1wuo/PA7XcqAxlwd3VUFzogTMeA3DNftC
VZF9RALe2i9+JdKg2+KBlsjQDAw3PoUYFcetDTk5gHvZb5c0UCoZRw2eZq7lfRn446Ei903RUAHE
honlQ8je/ip5SY1qAIiNTy8r8mCAjZwxXPStF9XwN9gpcI6bunL5/yC2pm1YDDKpiA/OiFgekt/f
Z5/vNF74hIz3bCJko+UpKr+4a274N3GCL4Az/P8ywwnR/BwqRnRM4+dL7OW/+TjhSIXeMQpFujPD
nngHor0C9yZufj/CozQB258Ec818aV8Ew4mne4lPtu3aR8xH5rxEM6LTpWH9sMXg0QJdyXQSKxC3
GUNCWHIBemXKXeRC0HG5sUMwoTCByYpOW6PaK0p9/HZKz7Qqs1NY0q9Sx/z/3aaMmXr5SYDYoScf
Hnbj8GorEQnQ2Nnkxw7xKsVTrqLz2p87ze6NTiajsIXeivg9UCpnw+KM1veiElmvLI9ASBNxFdHK
5uae7TOWGK8K2VvMLnAiguMx68EjlKYzE1dm60tKvNJK1VAzgsKDSaJ2+bXT9TeaGtoftKeGWcJ0
55VE7lKqYZj1lxAHDTWQQH1UA0QXgbhIamNxUNscUbDnX1KGOv3uy8mxXhDE6hfD9J01BjwnhcjR
NHCcepkw3e8pK1iY90YcET6IfstTb8N20TrTc34Aar7/a/NzESj0x1K7nhYFpNzeAnv/NcBB//iU
nlXM0VNC6P2XBGNnMge/Ificw4qT7S5t5ehyRRsEeQL2wIbMq1vPgd3M5oPFxA1zTnj4CSHPQyp7
uO3g00tjdGEFGGycTRrC5M/9GddAm0Fe8OVYIerrxeHHmq1UsP67GhSgq7E2sIdlzLdYwyLgLsiy
vXexvtEb7z5fTp9ay1NHqIs+Lf39japYT6cTN0ZsPjp5xHRoGqmqszGq+ZwlvSk+7VDxKWrCzLby
krq0yEvVvhcFxb9mMZYZCwXidWdKh3dY45rs/5+wSJ+ZVABmRyX5pXZEqrIzmSvnQZOzSFh3JX9v
My8kjxR6+UJJBAEaGrTmwnbwyJQp8KIyt3xoJ2sS/BM7rwokZe+9QoOaCPIQUrPqz/NwGkxqifON
JFaDP2FeG+hVHkun/5RB9r7r/sXYWYadogKsiFAlpNEmPpFQ6f8F7u2P7RkOgesOqdJB0GJEvMRi
hbqKmTzs4qUOX1njWawM5UeLg15BuQql55pZ0iQWREKeg7zxfT5IPZwtc4KPdfjwO7dwguj3yvVZ
TVj0jfEejzY/yW7C4NdMKiL3BRezueoi3Ev+KTnItlZxEcPrr/tsTXR6yBGL5V7DbCub15hEcTvs
1Y3T/dNr7qI6/qcjVPcwckrLOSi9ul1lknCiY/lMIYVyDybHHvOG94GREK4f7u25m7v1XuQop3UK
HqNOfhwxSDnrROcEyMFfJcyKPzKhcABFJ3vuMRc3wi8rxlZlg1Y/0UpH5E+iMOym0twYdXSRmiBo
WXqEZjAH330rZ/j/RKZ3tTMz8vKvjX4QF6nyeR5PoSkvgfRFLl903SE3fiFc0Ort7xVHogTD2t40
taPF1f8SpwpO8ZF+oGb1H+7zMLYNVji08caUGHXnNBEfWGtIgdzV8YKaQ/6hgz1AH+680mAF49Ru
0J3ykTLONLWwrYICMeNOq2Wj+HG3Z0/zpgXWULHujQpwY9gZNb/LHdWMxgo2ACKabyykKhOHZOAN
BJs1oGeVB10AGS9NPyesJzPmecEHzvr7ejT4OnF2ECC5sOt6mNq3joao2BYNlqiUrM2Bt8UVfsBn
8/+602yFFSXW7gD2e1xVsJqSCRcoJiEWXHX5Xfj7TuPRsBQOQLbDS66AawMF2tEN1h1k9Of43OV7
VSG40Knq+WlDGYfFnHxirVR0evWrIjI29ZH1QixHi2uqPgFo/J5FdfTKmHPmfwTnafq7IatwRAN7
0exIVtGNk9zyLuizoclQiJJi1j/v0X85DN4HR/O5w0KwBwomXhNqpFy4Fe5mPR+VhraCb7BKdIqP
cpNry/PUpJZNGQyaIuhXlERaw1hCgWLUS/iVDIaXRMCPPXiCn/Q5SDsJs0jUaM4VDj2TCZTlw4wP
0zSrS8gfGceH/SPeMKoFTBiLqzfSxq2qxah2xht/9sjdFGGXWLIOUdjGDxPqMPDDzhkedP2mW9vP
ygWNuKH5zOTk/8Jg8n4ZXMAo3g8V9hDVSn8Q0mD4cDpMVXMcs9cFmOxoGgDwC/vtWhFYI+XzEmGj
lJ9hfLhA1+lwJW+JzYGnT2++sVdcNn0s3QQPWHSmpwHiqtu0S4FOoZ4Ljh+c0z3luJ26NZryt4vH
D9NmVLDaR8bEIQTqKVhF7RBmjwebiAWWnnyfRM/5mJc2JzGbyUU0Rml4HEkGjIbe4rcDPfp8oGDn
9ve1Mn+iryL00fGEyNoVctXq0aZmROg6zTdObPHh5qtdtisNKOsN0PdZ6hO0AuCPHmsY2wQCPJd6
7g4N2nghu1JobKtjuCDYPxe9w8gwS/PBNbYuGilTI8KtelttLB3ZwvuiYzSDxnXgM/9Nfo6TloOH
qbqS/g3EdTTJFNDma/7iYVv0PrTS/ronTQii0Ky5OOVftuelEU7J80/oO20lpqcBTvOXox1x6Bry
WlYTJ6aoVSq4xcxoGMU1+EYPp9znoNlHt8iPf9I3G7hXqaP4XOpwp7sKhACEoMQgrmhvKXt5qheB
/9jE4enLcPLioPmOpKnTJBgOTHcH6aJuYYBAfHqsfRPVM6MPKC/1W5CFQbXjNcQEgI0C8ut8BWCJ
08pssWSmcB20h61xzeC+DBGHL+dHF6TUDTog2GyPXxzBd4R6HdJE4WYu3Pz0WNECA52SdRrPrNTz
0ThiQYskrAUE5eDl1tPuUi1646Kn9XQrwOUBLTdWxKmX3YChWsGOCFHGBLESs/Lnt5viplg7NDm4
dqmGxTOpTDDOpYkNfQXT53ZReWl9SIRG/8TFv0xQW4ShiTWGs6AAZVW553Ef3IVxet+tjOC80cY/
MDUbOaEa7xuMGeWcjceOO/gvOyUIBVnUX5C2EBPNKjj/4AiPYekQWaWSLjLRXpautrNnlu408bOd
ZfiHmNYvdXvYk+P58CorOjhGtJM3u9dIv0I9IrbKYJZ59oeWAQctyZFpvU2uo6xV9jJh2s8CcMEi
DE5ZoCa+wUGCmB53goQjzAn70dnZCfRb1kNmoc3lNamaFA4KDN9mpo7AyJQIyO9zt291nZHkjovz
QQegJvSLagtay3JWdh+n+QMEsU7x65lUFU8loSA16NMmBBSygS94ElCRHL1GA4Yodwqm0JgIroMB
hhw4+VoGLB361f3i/7VnVfVGZ9tsd28nz0wnBjQHUc72yNRM7cldcqtytElZ378R7qCBqj5DNs+O
j7n9w0tc0alQIfCyrdpFIf0c5Rn6GuAyIdBeJglAaBjxAQMkHHZyy4hypYKP5D+ZPpLezMS3OLkZ
u7fak+XoPk2DGKRObp9E4NOz5cHGhIFIy/FnlVJ3RJvjJqg4saDkNlh9CtMkk7XXwij09ukZKF25
BWc21C+V9KTxqXL0/BktGx6TgED9rnJ+ITXJaUUUmAtV9M1VO0jt7PQItcLNO5i2D/3dA4YnQV/U
8K7Sz54tBd72btwJY5+Hau8zntbBSKLjQoQxgcH1oxhOX4ss4LhutS2oc30yXmbjRqiBtQq/fOyQ
URebVymrkYPWaQ+fGKaK2vBgT4Oed9Cu98SdarhK7EcW9xbw00e0bWC2vsG4cJgzDz3HYLQKLqBH
p5suAXsoeLu/iOU6eDbvvecxSJxjsdVyikntoGmAW1l7MwT5TNhHgw0ZCkvf4H04ON4r1AK1xRHO
ajWMqxEGGEP4vWCGgh4wXxk80FBce2Is3zTpiLi2WaQCU8OMlpEZhzhzsfDBcF5P/pUQ989m9AMN
qa3wzEEaSs+8dxPTuJeU86u5+J1fsgrgMk/IotZchooHWD5NylQFDZDbXJpUYQ+JSlLm7ZRSvQP+
Co7wzfuBcs7uoy/d7AmqVaQdAyZIIZqSzmIfJelWbImNUZm+TMjjtYsszKG662P/ZRgb5ogHfqXY
oQMXT2pM+uSUHaheedWrIxNhNtw8G1YWmVLyQMJGPRa/Qi8xOnPaa9F4qn0HRR3dPbgMy++y4GhS
PRztUfHEI9459lbNKVgOCQRLgnX/disOyQzYI9v3yoALWxMVUMZZgYbHpHNA2jXnfHOc/Yx0mhHO
zYEqqJFJaZcRmIQf+7vdHk+u5V5uy7rD9xlLrZzIrZaGXjg3YY+ad/92m4wMO0Yp+lJn8a5Dsh+O
yiEwEymEmv0QJQWcJT5ZraJpEjA+cGlYzsYmaGouX8tHe9wlzLvNR8uIiS0opTyLgeQwKpaO4+zq
0urCLy/h24d7tlBNIkml0AvqAzr/QDJ9We6GHOkqPZHbDCm/mEi8uf0UcZgugLcuCnGVn4nzqwJ5
qbPoL0CYRYFncGdSdbzDKA1qpJOyTCByN3FB7+xD0POUBT8/fpSuC6LM5hOU2WQnX4baM5n+KvXh
59U9kL0rmHy6aPW5rBkbZNvB8xOhYohHes3+GkclMYIjCDdb2ytzBOAUbP3w/AlAYAWv+Y2Ha2OS
KjXMdUuR707D19EIn2TvwiaXkU9cZdWZn8PxlnVhorEMhAVN1v1F9N5Xj81kCSS3JMqNEO/9qPz1
Il2Ygey89+8r6FfD0jCppXDODpW29mCMFshRnWtVY5U5OD/7RleNQOjlRRAN+z64WAt2oJDn65Jp
vAvtb6GGQzwSw7HKMNA4SubNFgoZubujKEJ4ObqxCo6J/ivmdESjAJdAUX1gZUTNq/G2GsBS/COJ
SMaZocShi3+J/a8aDP3blqGh7Bj6xtBl1nhRx0cDbDXlDD82V+3BFnjXH6LHxMwhr4nkJ1HTSslq
O0wsVyLpklHY1+/bPOE/1sESvmbCBz4cMnKWf8AziJZZgJGnwvqc86elieEfvfm3l4rlxT6xGDBu
Nxp5Xbigh9G9fBBy7m4x02d3PmhEDPzMOi8uoYl6CBH09nngtjAt9IA00J/LR4esFXlO6C5CJJ0p
iEb3T/pdVvL+EC5INLrE53qbQ7YBxUAq9gF9+jnU4q+xa6yYE36bXDoXGsDqPRt5SkRzR+bIWX4s
5zuw8cG9lPM/C1orwDArG5mbgRUCrdYjn9xDKdcxy9qZ3Mby1Gsv2Wogdc4TZvIIpFv4i1RIkZ16
4m1vuVGKLeqwnp0gjVfhSEYuOLNI0L7qfJ/JwgKQSJTgt5hqpaBBTkHGEDixvgPsHp9VRiaUn5wD
f4loD8M+QA2+83sxAbigx4UEsPSWT249QT9GvKQMF0YxYsEIu3DMk6npOekuzSvW2jKQc6opY9Vq
DuQw98Rkcp79TmK+s1CPIxVEhE3yz/5tFX8G5RL4IwEp3CZHolblmZhvG7qgUhANH3jgHndQnHtq
532DbPEvOCmi8UHTu1gOms9R/ljRC26iepTK/c5CsUq3Rk0NYaZmtD+7v1M998XWiW0rSe0YlDW8
FWiP3ZWBQK6aUo6BLo9bNQhTdheJ37SsV3M8ucBRLtAM3Cafx4jdYTlGdtHPfpcIzWoNTyKeql7C
3x+NMXDfHYQ0RIFSNC0v+pvVIgnVCWLAN5e5J9+NNtTF9tNTleSjgeDdu/AxEcJvEmULUoBa0oLX
xfCGx/hRvG6y58n6PXFCdlJk1A+rC6+B1Du+0UrBFd2grOp3UjbrZOcsk3qe12ODMCTMZhmgW/wb
7PteAhJWwzzz+u/JHGFXDxvivZKOY6ZIRwZ/Q2IOjG5dBZgw9Aljqr746USbbfXq8SBk4c/xexLc
s7sAOm6M2hzgyNaNKKQnb9jvKCJ/49izrWg+nqSeO5vLtijVrCpCRr3b9Yw83IP7DzJoI4UF8Sfy
DEQ8J+Fv/TBHzlBBbwjYEnElk7/VydmylKLb8GDlHZrUoZ3BOOpvJ7tOyPEBnrKNedYOPi63818L
0G1vxW6KsD4Cb0CJEegzZ8mUK1B2DUys2kEPrQFDuorCVgBdhKNFgGgR8IxkFHwZdScErfy2O2+f
6XOS5Yp3ekxUWgba+98hoxDyJYQi/YsEisjMaML54iZznHElgML9EJiWYHRiZ827HxYnktsnrJEN
UjZnXCYxnEIi1QmxVjF2AiQuR/Q91CcGRUiARBd1eUIA0I6L+goOy6p3SrchtN3ENOeO8BVKIAMv
yklO95/34gd7N86dfJONawOy/EY3Z7XzFW15P476AWyYYt4fCkNzguMHAjpHUve2o5q1qagqW51L
6uUYfcMpucVbGXTTYkAsu33JCr4O5WAvPS0hGt/ZD0Y2DPbqYdVeO7oY0Rd8U6e3cN/H57v1Nd0y
ru4cKJc7FLh6P06sfSMPWZTn90+3c52vX4Wc769BAytTBTGPpqb1RSMgYWkaE98QO/knKLpx+0yC
kUuTo3BomK9p+iZN48Y1ie80RKl7GBWeaBA3eW/XuCLkZ6exBRc2xpEh2jHq31F6gO7GQGWjFz9j
SNPiJne1ddUgjc5ea2HlcdiorDVQC0SiV7RLYsr6HffSa7JbtQ/t5MQK/IoCdfnNBa18xftpZayY
GkQKmqOAfVAGjRYSkpLGV/gJEpjxdqdpRlk5TxQdw73Y1oAoZNGGJse2MS2tCjzHQYE4Du45V1N/
854mvkbnLqmvad0zdn9vnplJaapj64DQz+wFs2UK3JgPufdAD8j4UfSQBMA5R4LtcOrOziclJmzN
xuepq8ARBq1b6NqEAN426NubiQFyid2B5F5v/soGzVktSSu+pIRLOQKqZUUr6AEplDlJOgwH7Scl
FIt31wiIeKBsYb7Lvgc4ad1kipLtAUB1x4TmpYQ0c39e41NYq5J3FZOjd6ASk9Ebgu1O1nqYtH+c
leXMqyIgxNC/MRwCxUvsB4Dh2vSeN7LOJIEHbNI7+MlGNYkdjFhQG1Gq4dT9VQiUQ18lqJsxaKrS
QSD2IK3aA4fuMJRCMR7EfxpDJo2QH9E5h5zPOdBDhd4bkUj1xt/icrPMVhDb1mPQ7VJkbFTYWnjz
FP1kJDoZYOijWrD78+hAUvdNw36GoBLoKE62K3isyHBG+kw1N5rOjvaWkMie93qCGh3NhN2A0cA0
QlLjFW5ypMY0dPJZyBiXVdPaOCAwU8CI2rK3ga4/48x3vmN9L/40h5FRG7+oxz9lCRPiIZx3nXol
z+HKupnbuMBL2uC1JSruxYJ103GXsqPpim5ldEgX2qN3AUbUs9h1VUxghXa2vATwmzLvsiCeyb+w
VvWfviMXkFuU6rDvjjylpo63i7belfNCyA9GxMa8MHR3MUgEYSWTrFgswgTn/+n16e2kff7ijLDT
xrhikfkNzre8Ab/cs/2dztBdxYN5g0WNgHDoeySSh7H179+Wfic9qXdqNH4lfn7eOPw7conr2e6N
tJe3Yj4zQPkpUxpPAPFygrgAoylyLN+91yCTMEGzbQfW94CvveNK+fjlw2xhCs9daYDb02j99B/r
5UMaJLaFCdAcXv9j/Msu84+0vc048wGF1r2Zp0m3fD77OxuRDEir4cjN3pqA3qSlT1vbk5rspNYZ
AL7aNOp4DcnkYBsIsnyTDxJGn+hseerQWhpIksScUV4RcuuzXgsRcWaajmNPRZo4jbhZgy4UruWk
rGMEt/iS98+2t9fR1r9ZK89j94FbhJNpEvxAKd0hhksMf1++HaGLRQ3GoJN0rLWbU4WYBvFLZKbl
zz6SCQoXOXbpo9viNsjKNLrC3nUxIVF/5nJOnMvyFzwicwgD+CpYhj77/xWC3dk89W7c8H8gpMG3
Ayn/kvXPnTl7X0lLKtyfBiC7DnvhelCav+JB1IUzseHm+kxugwosRK0LtB26NUmyE4yv37hyVZlf
dXZit3cfVKxdqW5nk0pdSFy2Kqb9f2aKEZRoEIkJvhuT2WSGWY9tx9uECHwSUlaT+0SBbAJ/VQkn
loLjI1WBgZZ/oUVOsTfl5jF+KWA1QgYu+9AC4/dqf25wX5sVFwtf80VBR0H64qs8kKKwSelaMipp
MxPBDJK8fzZvL9fuz53beqwG7O1WUJg5CM7M6vW+zguOxIK1JqJjRIpAzRYY9jwRWLXLrFcCU3tY
PSs0EPYM1ykFiyuVPdODBloAktg36qbTkA1GIPkaaCWa8L7vowL0AZWYzf82569kG6V4pnLhKr9u
bwsXhc6W2JhqvanoBeEOpPMpvLKEVK3fP5rqkKOoEDCmXUfxcrSHbMhgUYIdpfes40MayN0zlJOY
QsmFiXPgR0rVFCIxcVf0hbn+ZG2QDQsFLw77sq9g6JIGPTJNsenZ0PHJZRUtJsePXBNshTj0JLuZ
gXZ0aBAyD9sipw4P+pgf9E0cFSJUwMPgWc0p33pESFqPiuHEE2rKDvpe/beVClPKhBBqUI5GN4hW
hksr06RrEuEnd+jg5Pva9r6dCZlR7cYeCFHioB1ZrIcwmEG01Th0Ep71GM7j/GPJRmfGjKXTm87E
v09+y4uwFzoHfCAe/Tc3T+V4UUiJccc+n4othzPwDpBNINuGV2BRnc5w/ZrqnXrCQgxyZQyzMXBt
1UNU2kY0pMIlAxrAqvf3icxx5zNRigw19uPxkAv/KHnFtV/kzMeWRoE5VhgY9lQFa8kkDzhNVHDg
eUwX3iZdALJkfia6iS03nr7BoIdqBYgT0sLdfo6gpCeDbQpfpVhlvgA9FAt9nNbY4ueV2PIckrZA
WtEARPVmT1gH+oTc2vngNMfkr/rTDziotcc9iHqpYpUvOsv103+Z22GoJHI2r+QpOQJ0U73+KnPl
CBEWsDsiWKpHoZJeo0xnnMPfgmUpd79gQujWqOvRLHbN9BrMuxTSp8gCR2sMwIuA46kJ6Kpa28qF
Ykqqb6ikxzN4uO7FMfNPlxbIUy0RqByuGFJoGQw0Tss8CRxQOGUYmI9VWkTfISk/T2j/ipIO4AAA
Ey9Bm2tN4Q+lJlMAURFxv8pLlnGbALlKNkt4P9LFrjNrmL40F1al1zXUQK/TzjqYMHkYHWLNcMc/
2Ovz7WtmSFCwoC9yJWdpVAf0HOUHBIcUL99Q51MUoQgq6sjmWOclM1AN+GkcSo8WRH13ww3zm+bK
v1OMHLdeMupyjIIOz/FKH9wv4dUUvSNTFvANavlODHUI+oIAcoJrSx47Ah7uT3QUfUrEwKPctSXQ
PkH6TJasjffdoUiRFgArke7Rb3vZAsxyj+H0v62as/+cBqGqlGlgM1FLpRKk4CiOa5cDfLgBpiMp
XvWrIAFxYzwUWdLMBD51kHbtpW665HxF0cb7J5vq91BgKc8KbGVR25QFJfisjtU0qk++PzCdB22N
4FQH5xwhxESpoPaS6ihpMQdJbfxeniQQHGxo7TbyjbXogguHBeLlx89Ic720zrMM8+/MrSRhZM4p
2R32ccS6O9RxaQcmaxVxjFCQbtutpXqioncgUPeFLg2ilv0vLvNTHggLMb30y5+yrXJseh7KFvqh
+zdYlnBMzx9mIryqhIJE/SZgrToRruj8ICSUZkbPMyYG72DmieVNsPunrmq0yOFoYwyYPNgdOcYk
CnR9JPMRNilhFK7RZwX8NjRwPb3TiSyB5Yg8at8hag9LPIEJSfvUf9umf5q+7Nlvb8cUcUf1Gffb
5xUXz3D7jtd5376hLgUVgb+jvV51EFN6ty8/iUqDGo9OunJr3sv5SJJBq4AJVktW75b+nkovi/4h
bmRMN8vkf2RbGGBN4p1PSeusE6Zpqy/zhMlvHJJ6+GKy9SdFIF/HZYMYb66d1wYARlST0Ls5J3kY
XcIW2wRJR1c8wV4F6dvTVfq9sdHswKPTJdFWhuaTsSMT3ToS2u48QoFWJGP4mV/JHi3/zD+tPegt
3bOGI8Zb0mgXU48O7h4kKl7CYHCqsOh9wI4L88rhjUA5DTFEUhGkPPXDdQls65FO2/1ULdtz18o5
/U9dPIoAiPPV+eBUfYu2gx+rDa6l1LjtpqnYs3TGZMVLVVsZ9Bhzu+l8UkgFbaENSWqhSZA9zhmq
CnM6nFJTgeps3YRtcX7jhNJDMWZu0jex8dw6uTNM/9a0rlzayUX7z7XgqXgY83NnQ8CWcP5xQXHw
yeSr3z4EdHwWZWHLRD7fDCnLk06OPg0zlQdbmCH8N3uH5nLd5Pm/p/jF4ZcIxQqv/AZ+b1+Fel05
6t+kzP/6xk4j1JT3BhgHdJummz5+AxLcpVGQZdBliTsnl5jRNq8JSXseuhm+3c0fZmoDS7NzMqsW
mDkt3b3T6cl/qJyz7AZ6bIdVKPVwKgFc5BCY+r2dU8Pe1Uv80aKeUO6thMj4ZK8W6sGgcZ4oSKEK
XVRGjEkdHXZIeEnMtXbBqXvxOAn/2frc9PrDanEJUrznyP1L8eSlPH0Ofr3ZcuVzqLkryERva6tz
VCVjKVlG/2HCT5bpzMoUrb8ROEpevbrQt6jx/c2vaeALiILpZUv6++PfEmm8Sfr/HpL31qOL5EzK
PUwjhAv8KxMNqP7qD/uzFF3uUeKgANEzkujrT/rnBtvzR0WW8vHePMnaa7m7vjiu4sht9m8xT1Qv
yY/4zMRPrHO+981EWxJFtlFKo7Bb/f+46w4CEwxcM9TJE2YenDrzwSZF10WFiCOPCHeDDZ6PZVYs
ELzD2sV67ejLftQIXD+5w98MKGqJ0TACutZbKtWOKdx0kDs5ksQpQwp8458WnWIsJWIuX3C/T7+O
9Q+WA1ajsapMleRmrt7w66uEP7QsuTKX0xoqQivTQTudlppKMzfE9MYgzG+JRJPRGN2PfhUCO9Xi
DwJezlFRXsshh8CDvW8bvy58iGrbTjjUjIflst7fgayDNUuOrk7HldmZjT9IeAMoGg0qKaVmI5XB
ONKXyb/JNt9Vp2NBmMmrwVTJihK7VCDaPSUEhYZl04blwDXLWNAHwMx30cBS6xc9hXJ1aCoXZSFb
wjPadmyISXhRKlpUCVU+mH6CBoXXdgMfWs1b/qO37OGp+8Odno+U0AJlXJ5KrjwO9Np+UrSNFny/
aLS3XiQ5QsiLCijuRFCKCuergPQSVoqcnM3aTdRP0PYade0YJffbsjdBKUUTN0cgmpWjkm65bBft
+jOQdkiUCZYwj+XMpE1Ak9leAVL8O9bM2WrCC0RJaPvk+HaINBgirje8dfvtyEpXQXKMKAd2ZBXl
CxPIn/phHKYOg1+KsHNNPC1KzbZo7otfW9kOstIsP+7mfBrEjGyzP/i5gi2uz80dQRmtCF29JWK6
sJJ+Vi6rZgsr85Z2AOK44hspGQRUuRr+CkoZ+028GtyNxkbvljEjcnmvR0Lia8xVg1z/h1aGQCvF
ktjQCSO3bHhiW1nesrzH9eEnFlyTU2WXMbYA+k5mzosTqYiSFqfdVjyAJ2L1uNKmlIBq9/nVQunP
Iaa8pHJ1oiw1hgixG4Cqaa7vfXtzQyHcgOpeMRU4gEPypHotwkabH/Kk2RY0KSuaUXpjiyn/HiL8
K5a5SqyvsYsCiYVpj4yAFL7X1IIE2A+Qm9M3ixmDQJ7osig8YdbRtWaswqYks8nm5qIm7zzqNUGC
t7hVAIb4OtI6HQy1NK47xoeQRFEdEpIKe8HInPZp3/qE3MFxWSw4QFpbIlQndM/6f7wHefJHjOhc
jAZyYYUm6MLnfJfzBgg/hPNCHuSrmxaV71jZzxN/J1ph3KIdIGboRrP1enz/9t9oNhVhN507SzoC
lOFfb5xTpH8grvBELmb+oNQ+Ua+7u8VRohe9bMmYU16QyDfcHiAbxvLNQTXLCiZ39unCqdOHTD4c
sJKarSNEX1HFJHy1PpEMaogUWMtWWv+jGApljHcNpRNyzyXYn9KabWrRrgjmoUMH9DwkR6IeFKV1
Bvo4BEPQdJSUj5Q18txe/Vi8syzTScROJAvSaA36/FdsrfwXT43dW6+xNTGCxXfGxlb2e52kTwR/
zXGF1PBis3Rs3ru2xx0hgdMx8/zQCsDiNjMU1Wic9BQgl8RjmA4NQMtuMgo1/0sEb5U190I6YFTh
gBDItN3qK/n2K4J3sEcUjuaqN+f7gwWmlza5Gz75ML8vYHovQPZ9lMwXfw+EUvit7/167l1czPAI
g86l21INlSa23azTYmkTyLZXaIZFntWXba0BSa9+J0j7n9Vgsdmyam972SEybwTR8Kf3eg9jwXlz
qIjHPMpfuU0BS8mVCKEneyxafwxPDTta5G3hu8yDhJ31ZHaaLfBUEkXd383f9gkXxFUvwa5z/j6w
vPNnMrAobMwRLBUvv+3ErPC8vbFqI4Y7PwbS/9SwHrimuRHEhslrx3z0THwyOE9wFdlOEvemb4Cp
ASx6v+RZYBPtnvTFGfwOTtGeFiAiJ4AKIGp/njmaVGElSCpHKy7y3pZGUjkdg0dNsrI0/aR4pHfk
eGRQDE1pXubK2kLBmK+QumSSG+zPbYfu3g3IbLJxScptSisz1TuME+dfLTxbYOWvaAmCSjxyft8X
fxm6PA1tYUC2tDwy8mU/qgHY2MQYbybjuamtFUUCoNiSKNDXvA5zhoJ3WxfTEL5CdjWjjqK9APPH
sZVBs8bvllhy0M6dWxthHsyozNbigBZ02BQX2oh/i3lSQ3FGORIVowVrC15eFd+mDneMkoebR4rm
I7dLf7CkMlUKEkryicnxxEKGp3BfXdSzs9rJRkR6AR29LzVr/MPkNgIElVSn5Z7+2PKvC+wCVjJe
F2CB3PWP9EHn8HDLrMpG0pb7DXKQaVvQyP9LN5fC2xv7sImFHnSftlwK8lizxmlv3rBzYJNlRlVs
P7y1tcubRUn9kvlr/wChfToO8KwrqG1ghVhExKys0bfZkOUGbTX1PlHIW2gTEadVAH/Ny8+OWpE8
y+9/CN6impX128z1B+xrtJBykSv8UEO4i01w9Httjpv8ttmnpBEy2/wGttaTth3Y9+3aIzBT0PBy
SP0KC4qWa4yZiFLOwMhoyA745H7hEp8GjNg4OkMxHJhXqRGtAanNhUv8ZUAyp+bdusu0zsPIb1EJ
8ff7lGyUCiyHoBZloIakU4ajaH6HIdHsjRc/86+ZSECXdfGKyXkwx1cVl8XMuePhGjgAw+C6qNI+
7y65dnykaI+jqNYl5DL0AQN5d2Gitym75nXkQpevfcwd1dXoLD1RweTGOfzfScW2K9SXR4kPVcAT
WLc2kXH9zun9k2k7bSJCWoMkVtexsjZy8hvoXj+rhtK7nu55wBmvckWvzZwpyrhV0t6tP5M94IRh
mIG2uEbTTooghVl8VSYAjxvcYDsMVACpAVuPwT/A6a4+Ka8/Qx1x/LUU5Sv/zvI7a5rQ4P3FdbDD
pW/MFa+86H7EnAf6AT0b6w72VdgumW/6CDMGBKTdeQbRfFtAZksPJTrYA5LCQ90MkUcD+TYKAffz
D5XW+SeqRg8UqmjlnwzU3UoyCrCIXB4OuylBwCMC0uOP5SBUPfGnV3PUWionyFlJRBcuq8kS1kXd
gTExsujsc1yhJlXGiEElHlGaMVhtW06hyg7vBnygUBfaKYSMtkzS+5mDGa9vymB9bh3xGTMrpimq
uul7qWvInmYTizGstAKY4UmLchDfRUV6VxolhFP11XGv+C64Ov7Klagn0LOuj5pWqbqoX+cqCgz2
gnNFbKGcwoqGc95GqqXC+GoRWwg5M1bak7h8NM6MDqMrudWlXfTvOpDjdhA2HjZxdrxAs51Z4vB5
XmGTK7pLOGWFxm4vwSKMhKOIL4xjDl2lYRea/C2xmgFQQ8ssL2904WkCpXQJToLLqZuFfR4mD44H
4ExRUqgCklWGAQ2+I0w0MDPaKuUFZ6n2VCLbYSYMnwMaubxvtOjjl1W9NItduZ8XAkhU6n6zmJXr
WkHZN6qJtMgMjAHoi4krc0urZF2ecUOF6tR1PjlZxe0QlTqjnHOwFG4sIy/idnDI53bkq3gXeMNT
fDs+JcqoPyVvobeVns9hKqKZy2rMh8DR20mW5O5TcQcRky/H+XAaqxEptveqd92n7KbVZU8Tl7CM
Myr5NX0o8ChHCRmD2pu3N0naicKIOtnnbiqgTor1hOfXv5+qbSu8Mso3FNi3I+b6Ur+6UtBD5IMo
+5GF/4DQvZjp+z3RDBxeYa2i+VJAN6WAPA9qUPzkxHzyNMpFsO28TJNcU8BYNzz+JMFPMFcV7wny
lrsaBcDP+ixf+MpNBpNg7adF4F7lZlA+b0fUjp/Mw6I6pgum7wxPkmQn7nSRWAVpzmDOFWQT2Nd3
f+AaVV++R0/ng0Qq9eDYwNyaZEbuciLBb9WGQoquuP4QgXRw07yD/wZLzII8jzPxTO6R+eHzRzQw
HVcaFHYx7J5LM0ZbgfVLO+BQRv2pLGXSzL6mRdvfSY/qrgFd+ackXh1jH4mj20T01HnXrutMc+qT
fSZGaIFCSe8wBkGZF1qvR3ftmXimD4Chbdh9AfiP3P/VNJv7Ktd9qnJGNfv9XY4AwLohmG7rDVWX
62FlzCD9OSWzOzUXflyS46oJgekbyMNGTOfRFZ8s9ejVVV6do5f33/Y61cJx8KsgdsE88RPdPMCS
NBHiO8VNlev+HfApssHqgg4MjhNGcFs3pBBbiCEnyYxfR+Vdf1AAnZLTccFEwXzinva0fWdUChWM
z4g72b06CQrUG2nEe50HOzCORR7tqGapTfzYmJ31Hg4mAqwVYi54ayUcTKdmvV+Q/eGSTvQaOLsl
raGQIAibPG5It6MPbzTwOuMSDROr82hyy0D5VIdXAxkmj4vXvX1p2bjXvJy0GgZnUTDs4S1dKxAt
wmqEWnKwPXAgjEXTOvpmPaZE6OtxoDdgaLhpkySFWzgxe2s6rMqbT5o2Pl66Ao+ZtvO3p2G4/v56
M8rztlYkkjt7iak8Y1liJxaMU2du9IQfaZBm60PkSfanmj0SH+Pwb4LJ7XL6hXO9zAkRVHlrkvIx
EJqHGnwqG2Yz6AbqBrmMDEyRdR2zn1dIQWkC+zWiXn2+7O/MD/E13MFUHy8gYcSyIip/bNKJjNUo
1HDe3DYhMBHLOXRwWe7cDKGkiWy09JGl3eOjvDmZsxvJ3Pl1cWjdaZ7ghyQ3Um1DAEKajgknD0NQ
ShKGE10RcJtFyyLRJgSHgt6qnWnzkAseHb5J/r0mLpXQ+JyO/LCQSIUOAZ3/plAtovbBnFKbZky5
zQ1mKbyFUaxVvf0EyRnisIvoi9ChjOv0c7InOZmhBtH8JmUms3Rctut+JuAmu1bkuAgJpT6aWx2L
6hE4lUourOTrBoAfKiB6hPQKLV5IV+V4kaphq9YKT19JB6wNLQ1kqciwaOd15rXNGT8txmkUvxMl
fovFWSHjNCSYSZPNrJ7SrmluTLPmSWnCDkT0kTwmGVVoipumFJPd2Chl2mbiSksYvzy4Wsahj/wr
GLgJRMq+LDgAztk40k22xTnvklvjaQ/oUE+eiCJRc0pLCgKKc0diF5zgL9kp5RMJxGK5sgu88+gI
F04VuDBCWLxSzUEaWniN+Sq1ay+1g4FsxSiLnJLlzmoEI7Tyfo6azGiHyofxhcGcW9YHADCvC39m
CRRtjmxaSZppp4EAAACrAZ+Kbkn/z9ugrSJO+0Zmw4rbgajfy4D9FnytuIucTpZcdHLH+x0TzmVS
GgJHsm6c5Z7b6H6DwgXdAugf8ybS0IJXgOJtSUCfLuXNOiml5Rv+XEPpbdYOMYous34NC/SCK4bA
4jUWfnTpcOD57qwJrCXTs2LdofcsmYJqP+qe64CfRz6Qv206cvtXJF6wOqsd5liSECvdcJ1MydIh
4Ymbc2keBna+zdPfqkXsAAAcZEGbjDwh+TKYBG9vOTDtmsflqAeZ2792SfKsBs+ZZPN5u+6TUyeI
q5oi9LsoBs+D0EiCNE8LpULoKixavY/Sq8sPUpcA7Mi0iIrtGlyudzdG3fHM9Ty9jkZDQX7YYj8F
4Ick/mhKYkmT/upgT9ZS0tCH6zMYdpwNOrvaWe+jP3neBBILBYir9YaKmOIiJhqJz2s8d+VWQA11
MT7im+2qmGzBrfZA7Z0RcMKEvC4UeU9cex7xBS7XuzgDBaInbq7to9blxzuokxUhqv1w5xs4//Qt
u77HSbGMJ4guGNGysTpF9pXKykc945m70vGT3ZISddIpv27JJHKT4Th4jVB4h/0aCZZn52eabszj
X7QncF27mVZH1EU4a/v3MgzaKoLT0YMmrYYvICBWIz7f7d4VQGqRcOZMjF6+T843Ar+aME0nWbzT
KMwviXbO/gHLpx6UXmY2fbeF3ZvCCoGyDj6WsK8d0CKHcQJXAeBenWmh50YdQpGg1QuaO1qCw+wK
PF4AJCqBioAyAp77XVY3pB+UAEfVyP3/4ZCXW95YVAwGp67uPqkOZs+wm2x1yyV/uD5g3vOtMEep
X4nAcFVVNfGEq7jMRF/aWGjDsgoJu9mldsZzpLuNJQamQGjrMmdCGZbPnyFY4ldUU0daPU03Qbyk
FEulPCA7ZSFKvYkpzLNGzKAYlrD+8m7nunrblnBC1Q5/VsYsSB60PN54Phxodf1NZnT0lNNljJYT
Df87ag3arM+qxEk61UjbSnuDyz918iPYv/V8KD0hre4Qwsjjw+GyOBEURH/vNlOsUeR8RQ5vHNE0
s5VLMvQoyi/JuZbiR4KihLoRgBn6dd3/SVQ37RNVTV2xcKx7pLE6D+S3sNcPHIPpyoaAYni0jYun
SMI20+2Aefku+m4ZI4xc/zUQg3X6NkWRqwcqNn4UQLW591J/eIpjY99RanP57NfMvxGbDBDiAjUb
7pV8BN6WPu1VhsD6zQeIkuD0hLIoaEa28SN6HshKmkargxXErE4rZ+EszwCWOsPo5gqV32h8nrqR
LDlZ5i+rsRgcUn38Gjzxqzt0lQm5njYPFAjv5NcnoXbTzSzsHKaAQQjIE+eoEn+9D75oyOWfpjhI
tJ5OsFz37xmo7I8RLZ9bevIrWcgNADs9vpGvmrQgQ3N4GHFF6MAQr+Aijq/NoOMaUvypgsVWjjpA
N9PyaL2aRxkfqqIrZSvKwR1wntSIBAxvDbxfikTf1J9z/WiUejJjqmR8WwnahF4dP9K7PKN19tMt
BZgeyno050NecRfXyzHtYs0LI35nARoDL1qKSGFbSlgMxsLXU6mdESghcWkIflmzLC1zvbVQmyrl
zVJXDXHrE9EG4oq5Bo6GF/j4i5dljgkOcg+MPNhBgKeIFe6GuwbybrRL9NLmg+11D4zDX+MOb4Wj
tuXviCzJOW9HIlo+BdbOaI5jr4FM73taouegu5K6Rjp5VEIm9AsOVzkm11Ejc2VZB6tpnYchdKmf
uVtAMWG7U/Y91FnM8WfBoG8hnRjWPNjSf6MpQ6cWSNe+tiusIZk9RKI/HnxLFW/yfAxVGnTlgPHX
duJN/Pz/GMLWOAB5K9EiT385MjE4SjQM7Aw7ZULc9UxSd2tuiPlFEBXrvPUrN9C38s5cmTy4dHdV
rRE3XOjxAk+nXn1rJAzFJ9YI2T3ihD6jsRCGwgGKno5CQjWd5Sr0IAEUosxV2zLyCBZnjWu79I8o
Wau4i4/ygNBUjPS58XVRintdYHoD5k+GP9M+fVd2yR49AZRxJUBJocIyw23Bowb9ii1BufH2FAi0
D83LY0ML+ElVgl1bj+cEevABpF8YrBUkkXezNzUVCZjc6iH9N4eZG1ZDyGD0yjhN+5Xu9WJC6xnM
4Th7Qva3ZeLbOtl4CKbFausZmw4SLkZmnerSRL3hr6UbYvFSwg4lZs0MBr8vVZWXimJQyOUMX7Yf
/UTekw37Wu04XRnWHyJ/Nf9Joz+aQsEVT63wNBOlpzV/eqtlW379eoxBgaPpOJ49mO/DsoY4PGtS
7GI+jtvNWlAiHeknrfIvvgNMOuESzo90L1qbZwuZchMj/cPoLjyuCZK9qs+E+2sorMHmU50Wnus0
v0A9rXvcCsM3eWnB+EEuyvgcpTDPv2n/t1QVAJ74r1uaJhKvGpWn2gAk5fwCYkAbRYGgfNHPdK8S
4mIMERiouoGKeVWqzZzhcyx1ToGVmBiY/trScF1GSVJRIiOEhl4+cs6GagW0eblT2vwsubAsAIUK
/XpP/JSQ56Aozn1GpOPmHq1bWoK2xwN6r8kLvTq8sxuPmiqWBjMfd5pmOqYfxKuraqwwCrcRNzMi
2nd16L3Vif6dDRqDNHY21ogQIFgzLUVEaPjY91gj34qTfMR8DvF6IlrmIASMdpWNFrIP+k4xPGqB
cSg+aeApS8Kc/KXPQOx4VH3bgPd8/pA0sUpbpZBRkV1Ujj0Gf5jUZL+82T0BJW+wt8VAxWva/fBv
fL3E0CipsjdRp09UkTw2m0Y7k3K2hkTSwUKRjojrudnpkqLJj/RknlP9BdzBzptPgrk+4QwDRpm6
qd+mwxwCuEfMURFmlvVvSt0Kb4cN+HETyhSFdUoSUu7SYseZfcKhZ7RndgEogIt/HNJte6f6Ue3V
5RMwCzi9STE63j0hEoEbj1uE16on1VsIrN1WpBQ++WFKqejQ67FO9/vtU7D2YhpzT5wxup+78zRy
GosLGk8HBrU8W/fS0Y9DnIimIoLUQIL4DOG3XjuIbnK/wd4AT4QsZoseQOsiRZNOzqJQBClEfqyu
up7xyyCmMfdaleLAg8cdzleHkRCsYVruYbJR9Naxhq9KlRyTKtLZ2+AoK0KtsNVTpoqdDSKJThoN
X1j4lnZPNXrYZsPiEn7cutme8EcRWURecXLwPRUuX5sMNgte3xEEt4yUkWpmbctAwgk89UNx9kbY
B6jZ7AieH95/TXpFZRjp3fGhZnHC4omb9leV1XjYpG74WpeoJwF2QRqWSibcNhIgvQyuzzJbm4Uz
AN9cFGLZh/VGItWcT5DNAtcwhOb+ovDhb77TUa2HKK5y8lOgYsA+1HxYVO1ZsCWwRhN/nZU5vMVf
LYyXip3Hmc4mfB0svZfG7WR2Ac5VWCXfD8UOawxxHXxfWAN6kAlmruYrQfEo2ty7cBD9Le+ie257
raAsEIpWmsOpJ5t7783pjurQ3Kh0uXEhF+8CmfF+0/6L0AJ02/ObTc14wxEY39XEqszYDMtiG/WQ
QEsjt0ikpPLQmHe3G8jSCl65SjgfEHUEUnJc9gID+3yhU6MNYBOgvD/Re0jYmSAw7wDW8SjcVQYI
FODfIPopV6zCCT9O6Qnjj+qDv++gzfla5D1H8xkXUPPl7CGcns06CGPJ0lBGa2ZZxOeDXjPLtcW2
N5pmeddx6JAtNT6ZHShTcOBc+LNnfcu5KmkEA8OoJ9aVXW8EFZhnIjzpgnJo4TydJ7xowswqx3/i
U9YnNgGXKxNteshwY4GL6RGSwUWoeaRlKUtR7qCfuWeKQFh0TETa+wLXpSBrA64OI0Rvc8giFYi0
senqBKus4DItTWFM02KIP1Kc23SY6ASkWwec3IGy6FmD6w/EGoWgX9TI2zPkgyJg3vI/eB3807Pk
QjlLZq4kXdIrh4/k3BEtYjb4pjm4MgVTUwEOql/toUq7xApTb0SnUTMubH6Sf78wf1dYKHRvkGja
mgbvkqE1Mgrbxk0oydNog1hNydDdvQaUXZq31aRpRiwRryOID+p0334hhaHHlVw0tOY/MBxuF9Vq
ldIjJ/pzCR3ZdOkXA3Dg+N0dAGkKu71B2hor7WOEHgbg9CLLUnKCLk+I7UR1VaQKXy85PF7jG3i7
E8bSJLLwuTNuDq2ngRidUh1pgufnn1nAdZNwFCPeymCHqFpgsRBHl1qTWL7c30GwftT6YLChMnLf
bw/DQtJg8PvyD8e2RHTJ/Yv6S+BGJGNBZjDnL7MsfJ7i+/UY79Pv8rUPyhIsag4KvhVE78j8RVwj
b5n32jiKpl5w4xdnCGvHZQumR9vhprqhc1RQGBZLOFnKEhBgLy8RqdNTVtLxGjc2WIghLwOR1ZuT
wQX3gsIMLkoVwsm64L01+8pgVrVkyqZS38DnSXeRirRQq1Q4Wb8/hMTEagHQJp8toZ9vWj/o5060
fcuUnmEP3ot/mdHiEUla+kc5GX6LnLtEbqNiJFQt1huebdu8RmKKiYv/xP1ORON+e8dNWLTJj8Gx
WoVgwHysMjsvBOxoiYcBep/c/8dOVfrJP2yAVJO5GTfvO2fR0QfOUClB594XHL0wxbDp2xr9R8P7
sZnqbq/phFgzwuRe0uN++7wax+zjZF4IrP/fTZUWZLpK2lyJXiZHURC6Vh+RTQurgmkpyR3PFO49
SA/tJrEWdL2VUCYgtoYAenyXDQlbfbbT3IX03dpoAwxA93hZMUT05jpfWALBQ3U5ubYgCSUQl+Lc
fUPZ868R52mPr2NDBlrpFqQSQai9ANvENouoY+aZNiYUL3LiRP6T7WKR298MlWHQ6c5T+dLkxrYQ
1YBrffZvR/FY6mCHZATNPdmsHfYmiQOVR2zxcupnsaGe1Zt0FRzXuDaFjxDnwOGR9Td08VTDQqJt
8vD8JXNSTEF0AUxOYcrggu2r/UAIm6b4gRT98OkiWEGULw+KiTOQyfJwjOvHXxoVj9lVXXfJvjgv
5sMLkQg//Rafc05x9VyZBTlqhe7A4Qelvwx1MlBmeuxWDIksXP+6BSighSbZ7U5FPSoxvDcmjfK8
V4PHPxzYRGFw/o3vC1fjR3OGYnbENkyFe30KeTUENx9AjAqSZ3XZAWSbsVO5pQgeM/7sQoZzddh3
zBGWf4b9Hslh4zqGkLa+B+BT7TjJUriLMy1Y1S4b6PvPDn9OUtUbX9/2WYRC0H7cIijN34J4rkMi
OW14uKirBnu7iTHojorXceSrh3maFRE66lWv14AullsJN3ILkh/9vpkPOBfQnpRZ9v3cQT0zRuGk
mju3McMN6tPfYFvAGkOLba7wG4bK2yffWd4p82NSip5nHsCn+OmPak9wYNUD2Bv3s1OxJIVm8/Jg
EsnYjnkrdwlviEzgrbLGUfBQYyOgjLvDzXr/vKTCib0CpALDs1ArdSEtAH6NKRckTUls+/VqI2DK
AwbcIClDxCdGODu5ssNcWCcWt8tIk+K56O6r12mWkkHlonqyUX5u27erd2a9eZCvF+oQrKhCqX3P
bvDYcXcgqjc00K6E22Z8X3U5oTSoiyT7OgSnh6FLSKiR8gEW9TODo2dyJdjxBUOQfT35hqcbRAGG
Wvp0Ax9S/p3mhviPcvr4t/mAzZvo4YQ/Zg91KeBwDn2YblcUC39ZK8QhSV/WVox/a3+BScvoQc61
q6z2Vy7F7+pew/KWWLqiTAFnBFbjVvfwxc4OFKkSbyL4483d+O8wfy7ZTPZUsCHoQkdw9sWe5UsW
n6FZzTujJiL9z20E9CuVqQnCcTk8W9rlfOdrA/17ngXrekF8uaV1fGw7lm9N1SjYdFX3ya1e0UfM
p70FaB2slOodaYj+TmlkIinAVPgLrglcrZjGIOFEIDH8Gfwz8kejj8/IfGAA03bYk2yet/Cr5Luj
+o0KIBsm+FL97LrzLEazsXXwX3XO7qVbH7ADNu4T60W8umVF5c7wtUJyMcszwVEfOvqMR3o9zPIJ
fNw2LUAzMV1NIz736n78ys+3KIHV1J0edbkKsgufZcFr2jYwMzNtjy75ohSHHtjQiHHSxQCqweoa
8ehEH5FbYAxvqUvT76nB9ljFtIEQLfV+dYJ7woBXd7uwAnSSSdfbveKXXoSgrbQTziIAiUlwoCYJ
5Nvd691SajAFYuy/gFjf/3GuMnfuW8j6Cag60Zw2ETtppxNYu/UaM4sU83OwEwfJGRwaUS/1Hdvc
xXf89OPrJ/oUr2mB30U1ENW5CKjsv931v+mvhcMBjOWUYF3kLVI1r0HLqfVCvYBAQJAJx8qwA8YG
c9yoAiMO3RmkpIoHM1zPd9PbWw6MDRHz2U0OSKFwwYAIr47QVWvn5qxV9rmguh57UuXWaakCiJ5l
64yi/duCRGojrLCKKyAO40KgupurNjGpQSwNce6PieGHqu6fjE/dJ4MEml3THispEZJ7QRWvA3EI
paQiSGbRBRYTf53/csiOfNbl5Y85QCOUNfRejAi2+n23PspkbNYrqYU/FKVFd0+LlKavvLnESd18
k56v4wFzu7ZUI+k86n52Der9hnXAA4Y3fAeXGxPve7/IFXk6a8SSSkEF5o64Xa1ZnGuXHwOoNO6K
P8gRa0EcsAPrMnF0eONCDN7BAh5p8iuQ139aEf7ojkMuiOwommLI3I5XxnJVlwZnVW/S53WpcCcu
ft4C4+SCrL+2d6cvVQcgxx8HxwZLJjO4KxpDYVi+SCWf9F1/b1pCKabZCRd6wk9fVuhGFaQhTNLQ
trKe5HtqLMdgKmcZXXwjkIg7o4+QNoXUWUBN19g0uh3YHAjzF78L4fQFnZ3tu93ZS/qbXMEe61HF
k0KJrc0HPo0EJgJS/BD6XGnV0/MyXQVRIgJ3iRkumShFtWvFwpx9gXDeZUT0k0j6pr753OufGUna
7JrzI+nYy4/eOdIXIbApJpoGCt6kLGpCwQNqqRHRxMBPA0h6lSeF1CxT/g0U898xrmaka3Sm68sW
HEpZqITLmU5nGuD4a1adjcHHnAFmpxFu35G1ueLcAy/2g5xG2Li+7dnZidqNKA0Jt3TeEKsrzk3F
9g7z9BzsdZoOojWa94bJP9yGHADvpCQRqEVcZiNZioaP+hbOk4Y236sMYaUWbQwYGUMYlBDI0CfD
KCtNENAiDo0amoEo4PwXXJRhWMDGjwzvYB3XKSI2+RnQoXf8NtoKtGEO1618V/HukbYpBgCU2A53
60eJGne3nFPrzbhfsS2IPh+LE8eYsTvp5Z5ohH6KBRPG3m8SVeC81UeIkAOa3xtxxotVukdROENU
B+pkzgSlDhWdM+D0bNi6XemDl1jOUhVNRotfeo+662k4J1MQfnk1un1aS/LeDNdN/1NKSEh6f8UX
ub1FTL8N/Hj1vJmV+8PP4gY0nt+DCgtQM6rF3af4iyqZIDVSGwL6b27snXWheInBcV9xtmXVi9Un
pQTlr6ElDEF5vPSbLaeeKpzMNByRdAQ7kqcDNpfY4TVA5zaUdpQwcmTVJf0sUmXR5zzp6tr+mI/k
bUsfHpYzkB+WEtWhrG8vxS3xifz+ZLHs3iZ/9Z2QzD83NQKBNtRXyTbw+y5cN29UNM8RVDD4gQI6
imcvh+ensTEbci66wCgBhyT+n4LrbOyoFwfQox1jOITLs1vuSMSRg6uLtjAQFSpPrz2o1uZWEcFy
q9Aghy1mNGD4KIdrbUPtXufDLDSfnCPwTn40k64CZ4MpiGFx0nnUA2T0mraD05Yrstz2kEeVOkij
go8L39j+fqwRjJzuIFKbEa5dkZI8IYqocUxxxBR2a055cjgJj79K7xTu7C6f+iB5WeGK1gmQkhIW
wRckvKDaS2dlQTk3tA4yD9ec9XSDPga/LY6gGBdiOdlVstpSOXW41kZqPFKmbABjWLYmdLZx4lnB
gPPDjb673mG3n+wlIz6BIrdXbFryZmr1LjPZKSM0qUaG9QMDsd5LJGPGglcEPvtMCVs5s3pYBflo
x7hr52gpdWYQAtHfDolUvl/JojRl7k7KGfFo4l7wCx/laAnjnRnnLf6at/b6QGZfNMEJuNzzlf3G
P13umJyMNPSddkrtQKZtARrVYbKBbuaQ8askIBCehHdK61U598BS2WhsQWlsJY0elXU4M6XCBfTT
CMvGo291/Ju834/wUjuLa6xBUfYRYJrrbwqDoS++5B8QWR8tP9Dxn0Q/gfRVKHo7y1JlyhsZ+s60
ZYqwHK9nt/LTrkcCkMOeOeD6sp6xPw+N4vpiEqwB/8L2/UKw17or+8NXg7V1EAJ2HA5sMJ7y8JHY
eJVwmF5rk34Qkt89j065QMuX7UX8TIyY+bemuKvodvZpN3ECIeaYoo/QsBP0MAVYWrwBjr/RhN6p
LkoILKjYaXl4tNporo2dmlGe5VD0ake0tKPI3/z2XvvJlGMAjy0d/K6st/ECFbCPgCvWbrTCRsNU
4YRwRWq8RPujdIeT6cYOYuIdn/fAHWxYcxK84JeTLBkv/+VEPT/T9PKE8WjA+19R3H7YluJ759sU
56lsCtyb/PxuRYgPhv7dx34fDe25ayLd1ueAPzBb5D7z8m8YPYC5cNygO+1j0XtPeL/SXsXzc1Mb
DLKlXaGJVeO5uMfOdnGBE1kxA6lycv/1xdjLry/skAd3K+QBo+lJJ7QD16ZXKUU48Y+N2ZVYeUgk
rv8HNYcMAwESP5wgN7BSlCdq1yn8eaPgng2xAWa46oHH3lhvRgfzTTUSrIcVEazYc6pqjPZj8kYU
bxQeEeQTmqUkFZGSCMFA6QXewODM5XnwRtkW94yDsaGVVf/t4CZ7tOLvHczwwRjmjKjypLFqc5b7
zawCsIFkWx7OQ7BdOE7uO3YrGA1E6WIYtZR9NT3V3uZGgRFq4zMa+0ecP8cdfVb1dIDICuTiDi3C
tlb247dGp8a7TRadguAIfc5J4JLWO866NQGkexCnW/ORIlhAJFLG+x1KSXiFaboNTz6h1z+OT5Pg
CX+RYffUM24Lu+FnUINz8LTMxL2gQmCL1MEZ8NI2hhEOHsoiNXuwYpfZjjvoQ+IHGvfZdrpDv4/3
ooGjAdV5Itf75U1JeZl2xeYmr5m39ErJ8khtQsT5VjBExl/nX/4csaLVmXkhZKpWXk7KHpJGLiF0
UfNRQbe9f/kmpt+H5RfD8GysVdTXMIY5TgkDClbVkgqBqmk7WwQF43R5f+l6h8WPtTjGJpGWHywz
JRogtH13KadGLQ/7p7A4Bs9DMtE1stEFXhrpwl1Z3FXef7bmkIVVGDymKZTqbFlsg75r/D/CJkzj
yMnpDsEktIu7xZGXOqjOyAH6APNwc9ayFo44/HSo8lek6r4Jf6r2QlnmyF/o3RCVIYha8nHS+vh1
n1VaYAht8yQRaUbIk/GFCZljK6Wjy6F+JltN7i2ibr2OTX15AvTeuTs3VSzKHuThEIzvJyXj+9el
6V62wmO2+bE0H4nZzBvzV/xqckvlTUM6W+3PXXFgcWCeO7oL5QVCrpht4VMmRS5HJG/JdYUU70VU
OioiLkz+YAY0TfCXXP/2/Nodvi0XF6U4IV08ehCE+dlr/02szZvOTHOsFECLQxCH5cHB+6I0j792
eiaLjwDpYgPuOIj3E7TBlz1EihnG+Yuty2jSfML5EWAPklVSSkuT97LGhk1GGYbYZtKhGp518yKJ
/MWctUZUib/g8kF44sb+Z12qIzpejTNrZiddF5EqOJ54jMxk+R1fQJgkmcndR5sjwanLXLRog53Q
sBsSLv7F21OrV7rIUtArV2+bSAhZcaedM5XzaOHTtv7K9YsdL8qmkVzkeb+wcluVm/CzKqkp4XgN
b9OvKIjG/CyIsQG6cP0Qk00tj0E6w8xktgzTG3HARk+2/8Zq7DiY2rOv9G+NPZRcs2/SWLN4h+dC
kCt/i82tK4Kh3DWrzm3qI/PbwCYzw/6XMGsMTWw3YCL4FQRNsNUfDAnykQwQ+fWY7zDeZB9sNYfC
QOVm+swgSvmWCqaIgmI8gmtmhm3NNAbJFDHGuSrQuqZunRvgdUaFi/m9EUEoUargAAAPoUGbrk3h
D/JlMAUVExv/yk6CTNgDr3aJeT2bMjhZCgCqfKr6kW+59XXnhVkTTxXW98F0XJDX/QM16d4tSOqq
N9JeCOaIpQ7lt7Joemz3SylaMRx1WeRJO54oY56HlZb9X69JIjfJsXs7kZl0/AkbTKi32Emc9Xrm
ZoRU0H2mh1nBbllzgeKgYM6m355O7OGbN1ea77uCu/jn/Rruhe1hws3T2mUU2BVJBg3U6SqfUNrX
mfEnlytH3VoomO/Mi2Gb6nQqIM/s7mcYWu6HOlQil++0QRRg91+KKweWNV6eJS5epQTMlWn8ynIx
6PiU9Bxvl6aLPwr6WDXiltLMS50Q4cs3O+HVYe1F1auX7xwviYTaaih/BbcApHAf71Hx+IBJpEXn
HqhPX9JEp71W4mLIiWn1JUbOHbAqzC3fWdVm+AOsL2L3hTLQVEHUtiaM024k/dDnua+TFEuc/hyx
4dSHNdLtuU/+n2SB8rXM8WvcenpQnhAAyMvOitIvY0BfjkijfgysVx8EbhvWMuam3yZ6Ljwvabot
VfcfYssQiUOnQLQguePDgfUN9015na12sBtfdspiiFK07NYTXDavs3HUdKOhkTVHeja1NPZbiez2
XhYHwg0lnrIitLy6P9jm9MggtEUo5OujUZ9vnlHiMGVzGZMpA1gnPC/Y/rpVxJZDCf7OuaY/e7J8
9vJDSJQZRyactM8zTBSzFuja+Mg/+512lTdGariWCUcKOsWjPC5oyP8S3jwkSOQT/sv6DFt3iG7B
Nv+WeXmgqqSGkhBIvlkGXhcw8Rtg73xSQ03E5XykLSQuXzgmd2/GAiGcGAlWZAFZ1JdrBJOEjs0d
TgofyAcwxWzuuxvo13dttMUqttRJZdX00vtN8JEqqMEgBdnZBRUWUbrkltty3gWBvdjWIK1VozY5
BLwaPTvfD9CP41EmQOIDztDicMDcVZPB0wWatXadrlfGoNrgHWd4wS0j9q3HRAWEHWNC0ZKOQaGt
C6rsVl9cEZW+qQeV9wyp6/N+dojJOvXAzwZgAWaA9hSLo68VryPZFnmXbFBcQgtHKbzYKMyd4qlC
RrNbXn5WyATX6q4ICnuJaTD5WgrYtG1wjkJFd4Tdzb8voEb3zx9s1eGOZFyQkc5m1CqzICeztDWj
s3k3Oa2BMIZ4cZ4D2JnvED482ejUknSzgZwlBD+kPIRE9fjcX+cxSB+xD34mq6IOga0pMk3KeXpG
qvD2FlZ0fiDJH7ObzWwbGPjq+QpwscF31WY/G/+afeYBJmQPldLq+a371duVJtlpZndEyBTiTk3U
Zs+rW/WAJ3qVwmS4/2gpZ2nYtDkstVSaMuotbqwM62eIFfAK/OMU44cXbMeFtj0xA7rj3YlMgK4W
+8r+1dOjbJU+ZBHnNLXz6QS6J4l1oepng1QW/x3hNJUQ0RG5TB0HJUa4GoSh1N3j8fN8EvRld7/k
GsuDJmTfVpg4lmMSMpcOaI+2I+77/bnwebEplJ4qPZ4wYpb0hhgkU4y5xM8+ZkTQs5N1D1xHmu4v
zu6M7OxXjY89MHozL5iy4JaXvN0rWBm7rxhuYNFHFkxgsOvAEENKNI7rgR/OjB5NwZBu1QQ0pJO9
2reHAC71BgL5KFkC0rwr6Gkk6+yEC/n8a2dLEOo9JEM2SN+Y34s3KHrSG4FhMG5xOazZpMVkSngt
6pZk2ovh/e8YfZRQqsVu6dhK6IJL5mUDvqr52YUVbg2xxbnQEKvC7sf/Kgwr7BFFHttyqYQkiejh
IBkS1g4IFkpizjpmYhpTiyn0kmANMOspJ/6VId7LB81Ani7TYAKBjFsw8Dzx3SwLrdkRfq1aGaoC
CC4/nFAn0dqT/qXnnLG3ItuUNknyOakCoZXP4RdOYCoPij0Cn3heCFPBmRLt32tHNKQMxs+475/N
sPmQspf/RyHTyPQkxVUYDALSZzKIAfG0ByC9bucgACZg/sQY1ceDfpbMq7LmVu5Ba6NZeEJnKMb7
mg4J0X90YMnOxiS84K43hBMqsb3pccwZjkv11pTwGHhytjQntxo8Hc1dflI+rZ5LSB0L40E5BgNL
sitycBgMvopjuUZvA+6dVFejaFWhCGUZ134HOmMZPc53jfMwgUj1ZPcLd60UNYoJWAFHsSNBd0PC
b3LsqJUKxaVqNqArEw3rMRDp19HDYjcBIG7yvqu7Gp5Cm5vVowBQ4KNYFa00/DW3PcaJ1+dzMTZD
cM0OwraF4sONKQ8OZpGXqMe9RePkinc7tyRiFuM5uDseyfDm7MAZnO3UwP/9TftvKD9KHcVemHof
cGz4knUKZhTycL7DV16Eu3BDSsAkClAPeRE2behF3rIItYxET1g18ZgtVZyfiw9fDDrMUQwAeFaj
xefkKJSBiSmtb5hz+FwiTcPlr5tESZ2/PJa6IbUun1QH0JD+xauujxs3U0A5rSOWWXi4hb9rCJhQ
GocEAqYDug510KcFOephFyoI/yly1f46TfGRAvrAlPP0LSDGNR46FpZ9sC99uq4KSEMPfBYrpvXJ
OsCZQsv1iaFDZAx+pbsrms+wq3BZXTucCrUaifWLupLBKKmGdS/Pz6CELY5ozqV1t1umL9GOJIQw
X158pYwiSgLsJjYhr4zSApbfS+E4yGSzrUgpg79OoakZdk2PbXJHyVfHUDrMp7b1i528eYwY9k+4
wkd00QI+M6bbQoXcY7GW6EuTUHoXcyCu2pmVcwxctb8bNaPnYZfXVm/EHCijruBKAleJz2qOGQ31
D5bPQhGDUD1iR0oICqAqS2bGOMKSTUsRhgqg+yRyUh55OdxgXd2bgFTVT9oemM451/pf0YddFkFU
dax76s0UnwggrUwGT4XyOm6Yf9xnlAQfXzHtsuHnE4yb2AknHsbUd4a4xtMI3DvdGgsiDofOVUNm
WtbqiQEcEN1Dh6oMD6vJohI/xh1NJpqiltFYB/OMRxKa6ZkslCaHiHavkVZnUEav9LQQBW/SbiKL
7LIemnt2/PIkhS4BZUDaSOUn+q7WIfDEqTcOBVH4nA2+9BC8zoiBHenXZqyditqFfWaZJnPKADi1
4c3tDeqdeuH/s/hEqGOxtmJ6oxJBwjaJjd45Bd84YmNNQMnDW+ymZLje6DDpGl18+I4r608GkNl3
UNiiZ/Eqc+bPrETJK0q6ofhs4vGQmabkXupJa7PWQbFqxLT2AlaXLk3ADym68zIF2T7Y2uG1cbZl
tuy0HCWVpov2KLPkXQ+u3985aXLqY+HSKW+y0Dk1ARRhrMf9xmz1vCFx4ra8qxb93oZYxkE8N73g
Vwsu4MoWJCUkJNlSaC9lGzH+0Xs6x4Cpuh8RPsQod5RM+cYdytJUFPFaY0KlHll8cyTc2v4ArL9W
F/piHDP1A3zHYwcCN9XfBml5ZgD16hUcjGh17bE1l/HvceO6oYxWHh2rEG/P4eCpYf3U8sbJrgPj
KAJ4by66QPra8DzTV/OqNLziKMKIfh7bMiTQvWh/V2QR3rd4JD2v9XjXeT+3ELwG/EZaO/56/DL0
rXbuoO/pSjNDoSJnvJX17Gaaj7pHrnrB6uqKqCC94ZTL0JvlO0E2H+/V0QTKXUZCuMmjN6rz6br+
mOOwiiBB4PHL2s2dZcIE1oU2UXE/GhmiRSMxi5qoVmZoL/x/zw+rak6JU4dy15zz9u+4yuvevgLY
Bfo5Ogukh029enZJHfVqK1RMGx+k2s/ZqVaRVk0SiOe5T6mhpt75T1ugL47bvFJefFmObRAWZZCF
zCAwKkeJ4WBa2AJcANOlUiIHs+2Kq7XCbMbctNkPWdbwr3LhWQn/pCiT9hlzWWdN5prdMxrAccs+
iRyejoIFpBGwOxvXT8I5yT7AlZXXlQPk96jD2Wr5jOzlNsXqvsAa1KaZazOJiBb1pi86sYZZY6ky
3/s2baJuu/jgUw9kMOH3JoMpqhk7W+Y6vpMWscsYeizF1Bxoke9q/qzKyq48k6k5p3LDPGO5PvsW
fw+Gvn625ybWT9rzDG7VAlj/Lxb7WU6Rn1bSY8CMoh4FFJTTTo7xLs2UWEtNI/cP2yB3kUIr5AGU
mM3pvER3rBxJ8ZHKcXsOoHqGIEnX5uSSNovPrWYgBj58cerZpzZdbI6titF0lNY/PKU+KfiqQeEh
cWsjHNCcfjTfn0mT4V0cz4ymRmpkP2QgU05D0dDX32KZ3Y2BKI3QAd5kbByPjZ+beNXkoYs7Gv6O
pom3nvk4coFZfXCAaeBljNS0jifJu3Il6tUJqTPwRUn/ud86TfJ5wXEnhQJmcv7aGJgHUJCfV67/
wNX8m1yyVkV9IdGJoP0KWPYtz070fSK3dfb+1tMprGlKhzXN5DW/Hhlcg7sdO6T35kM9WBZyk0cm
qLhSGwViMVdPqb/djYVbF7tJKFeFyRi3aq8f5tE5/9HO2fKxEZVg44kSdMYpUYbvEX0io3r8l2Id
UBiSYrqXjrnxFiun7+ORQi7L+wvF+ds0D8Vr2BjueGFE94qkjANL868a0H/B1sm8MnCnhGA1Nic8
P5teWMy3WuVdb3/hdOAMsmhfWCYu/NpctdDCJfSvc5eHdMmZCn//rfYz8JoQnpSrbuGmX+mKzHrr
FSapG/KNku5J893pocN4ZZHZRWDwktvj+e59phhqTBiailaErom0qDganD4MFg1kVVpNe4CwYUVC
uwXAJMPQjlQTSiUjPwFO+vNptO3CNm6Y/qRdattMfGYYgozyzZWRZMxgVdo3PHeRPCtFCu+vpm3z
W1bZoVsbpAYHJBQcB1dRamHiPpibSkMDMZERBaBwVPN8fQX0i74k4R0XVjpOMr4sxLYYD9J5ujDy
hYcodubMv3dv5pQ81W4i8pREs/je8cDqiIoNgjdQEZDnblI42J5GYuE7erJxCw/VHTepD8J0GkBd
WD746U2BG95MIeYdQTgJf5qEfGS9qLAEbtO+cnHoZhdmhbMkh+aVDD1ftglhk4gLgWrtMKDrpnhP
jrCRAqwQ+Iczt0v9PVV3KN9qT8swwMq8fbbUDyD7mFRFKh60N1I8TXqUrj1WChpZYu8jHkd5yQBG
73zxwCBVxmtpzRbmFrYR2m0c4FGopO53r2RUweicXgRoqYLTV+ucptFsqj1va/dcM4KPoOfYGtr0
7eDvmucwLPnuzDMp1yBTol3mAdZkdkbdvXDkChtn1bz5c6tFyZHajVvH0zACnMyrpKd0dKH9Ay08
mCpaD1oMkGwZloK8LSX0pda+RWF9duiAl9tTC0lW3P3cytjosE7dEx+BEl5Jo0h3kT1w2UB9S4G9
ze5XVd4gPWZmlyNV3okyybY8VpruLhgJNv3mVsKW+wEtyV51wLhQMaYLizxVYMpWPJx4D/kLU2sY
LKi6MVpRIUzTQVt1adCgNuVacgXQG3LtDLYK06FAQDW2CDz8/l9HwFP9X+g0AlAoEgAIZiRx1BFE
Dr3+HIPQfQ9s23kG25gAMxf3f2g/vf2G27ZmIMxZi5AGYuQ8h20A0+29PDTu/g07QQ/9/uj7p/7f
d+25QAOQBKK3EiBpCWNZ7r7pwhQDMW2cgDkO2A/sJ1137bHXWnW139/25Dtgcg23bfdttf2H9z+8
ObwukBIUCWA2YDQGN4e+aD+C/3yGgP+//f/YACyIGyq3Jp1ldeOmJOOgDr4AGn6dp+n6f1x35bH5
zT9P08O/v/cfd+790/vAAC81iNhzBgG9JBCQVsDaHWngQSBa+MVS7AG3sHY5B8Debg5kPE8+5552
33tvtNrtO+erDve/eqjve/776XvHfHferB3vfnqwAmXJisluwF7oFs23bPXWgad/2ANB0DQNPDTt
ODMIbb/iGYNtAOQZi+b+aAZYiThEDRSEFVAmrMXvQ9/7wOy6yEG3MGkDQSWEf36RELQO/rNF1x5P
O8/leUB5fOPPUx3cIXqUfbKOAnPIQIZAKABlnDksHwdDrxAEAjQBaYOOIIABx0FEgJIRsTYxEEC0
AUSCsRe9tMHhMwhbXf+g6dp9taBoEV/dXV/Oz93dTs7dTl9dzvj+PF4/ofQRdU6v6G7upy6iiefz
ffnm8nn8vk++8h9+D+/+/+7+3/9/u/t/vH9394/uP/7+7/8/uf2P//+z+7+4B/YA/sf3/3/3H9j5
v5oAAJQAHHuqTza/H2X//3/h/4+/7gkAJY6SAbM4bC4gE4QGI1CAxEDFhxQJh9HXATxor6VouVBz
xidFotFfT11PX93dxX05O389dT0UV3dXc7PTk/PXXIOQhmPkAWxben6cAW3beg2xoGg2xoOnAAAA
afbenWwAAGgW1bdsaC+4D7X/v9vMe25hzBmPMWYMw8gAPtPtB9v78PvvL955/vfIfeA8nl8h5fvP
OFVIK4xL8ILenwWgp8ufy4fNw4/HmBqtNauqwBwhGpRtylNhkYiASjAgBYADAFvPANJWkglgIFFU
KIkbE8KRkA4RBAACIAUSjhEbF2J4X3XkGxKLBmOtGehcgzFmD3fMeY+QZjzEGYA23beQZg92zEGY
OQ7aG27btuYcxgG2vp390f3b5F8h8i+m/u4AAP7EAPpQfNfSvpPpfm/pP7C/sQfNf2J9J9I/sP0v
0oH9gfNbFAOEAGxfCB4QOvB4Xwj+xAPmgfNgAAHNAAAUopA5Pn8OfHhz+XFz48Dg58fg5HI4uQPj
y5c+HAEeBLUAbMAqCAZEBTMBCLEAKdOixB5oEGxxh0Ggn++n6f1zbFs/7aftuYNs20NjdfDMWYuQ
BmLMXIMw5jDbMxZh5AAbbmDMIAHIcx7YAch2zMWYNt5CG2h6N4fhRej+H4Xh+v9GD6X6V9K+lfNP
m3zQfN/NAJQAHr/yAe73vc/xv96/3//tAP/f6/+Pvfl97/cOIRqUbZ6JZpEApPYXCAhCAmGBFADo
DkIHw6Ce+JSpG/yWY+2CQx1iPsy3R1gPu33nZu+T1/dXc9f3W8TnhCYABsXMeYMwcgzFmPMABmPb
cw7ZyDMAZj5DtuYgD+wv7H80A/IfTP7q+m+n+R/uv92+m+m+mH0z5D4j4g9keyPp/7p/dP7s+m+Q
+QPpn0304HyHyPyB9P9O+mfT/InyP04G28h5D7ptochzBtoAAP7394ACaTnBUGAVUBhjVVUABVuv
xls6j78bUHFppKJ841U11FtQr7gylnPZ5aBREomEBAH6oGUAD4aQG/yUZc+ucnVkJ7nHhOHY2e7/
/Pw0MbxHhlsf97Z0/T9P65B8i+mH0vzYB9KHzY+bH0p82AAPpQ+kfSfNfNPmw+kfNv7C+a/sB839
L/YXzf9hPmnzb6T6R9KfN/N/N3wOMsUAAfA58A5cnNwOLgHJy48U/ArJQuJ6Mc1ppiS82UTvOiPD
SOIcIRqUhbnJYgDYZLYZGZwIWpqQACgFrOgbbmLkOAlJlLmG2rZ/RsH/1vPiFjA+o37QOug7+0/v
+2NPzD/jtvoHuvIA5DmEMwcg/vf/g/tP///9/sD+5yDMHIeQ5jzFmHkH+OYcxhmDMAbbtm2Zh5A+
kPmj6V82fSgfSnzR9IHzYfNA+kD6U/sH9gAFoADwgde2KAAHhAfSn0j+xPpPmw+kPmwAHdeaAAAE
EEoQBmhFUotX1u77n5Xfd3/CAet//ruvWP5Uq5bkAZGBTGAlCBAfeEABijjoB2MakNbfoB9Tx1Bs
Mms58J9RnvT7YtrQdA08LY/7adoAAGnBoGn6dp+g6fp1sAHX/CdeAA2J4XwuxwDwuxA8KHX9jeE8
J4XY+xtjbEti29ODTwC2dAtnQdOAAD6V82B839KfSPpH9gH9hH0j5t9L80fSglAD1u5/7f/R3f/V
3XuPyXN8efB8xyDgIRqUdb5HYgDY6JYXEZEEJQF6BmLBebeQ4cTw+LArhAWhAJgR17jqPd8w+6cK
XbfduQf4BmLMW2+gZh2P17Y1FI5D/jmL3bMeYMw5j23kHIQxmMv/1I9UO+73vgfS2335oIaBbds9
+9/WzbdtaDoOgWxbeg21bdt/n9O0DQLb07TtAALa0HQNAANBtOc7Xl+KXvmeP656pb6m0zxWuNa9
XjGDvr6+inLufnr6KK6iiu7q+9fOX8V9f3frovdgzFyDMe25gzDmLbNt5DtnIP7P7H9/9/93/+/t
H94f3/2gAB64AlAev3ne7nuawuZ+K7I19/B2v5WiN1bfugASF1hEXAJJAIKXACWU9DdNlobhAgjY
RlAfeKqwAtXLzp5HQD2d3OXXrwa7b8b3W+nPD9c8z7x5Hmf3//h9t90+0fbPtH232gADT9P0G2LZ
ANA0/TratnQA0DQQ0/TwtvQdA0ENADYvXuvAAeE694UI6Mb4Wjt+ELVsJOy51skdt8nBYfL2WfXc
9fTsV1fX0/dxbx9594B9+855AUgLSUhcgEp5yXPjObURDEl1JwBSTyKtai7Oe56zvgBv46G3cqa1
MTs9u8kA4CEalGXFyWJx0OTiICADJBhAHBucaQ5GkiAEE5EAlAkURAIogEkAtMFoAIogcP/Q/mv3
XOn6AAdl7aGYNs/w5DyHbA/6gHIMwbaHIQ5AATiCzmaziczQB/af3H9395/+AchAMxZj5BmHbdt5
BmLbA20Nsf3gf3/3f3H9x/b/cf3gH9gVtLzw1ozjWMAxpPAcbzpmsw1TzXgtkK2XjvoQLedZsig/
UFbklu6ZNpZzf0oAAc7mAABtNjYbG8bABu2GwDZtN3G2BuAG037du7dsbWzZvAACwRigHZXPQ5JY
ZHQwGY1GBAUwb0QBLPIDwnX6IBsXYwWkDYts2w8p4Lp5j7v2vtfcPt/dOYX11PTt/dXcUV3fz87P
fS/2AHzYPpX0g+lf2If2IOOADwnhOv9f8I+bD5r5r6V/YgHzb6X6T6QPm30vzaxPNOUpmappOq1x
YpX8llGhv9rUJs5y+qsbFD8OzKslcm1/RccqmihafNASqev3v/c/9X/+QA+Ljx4cOLmOXHjwcAOf
y+XAOPxPl8uHBx+J8nAhGpTVppDkoTiobiAYlAgfuYgDAlcI2/HyAaeo6mI8vGD02TMviMqrn4HE
OH47gk5DfN4vt48K7nZ6cuorqcnLufu4r++vr6+n7qcnJ6fiPL9/53rev/GPN5vL988nn8h5E5dT
t/dT054d3Fdbzf3V3dPKebyn3/lf2/2h/eF1mtUjZY2hUsnOhc9vvQGJtWnUN6fDr39O/ydHYaC3
v1VrZlqX5vK87zeXzPN5vvTyAAecBSFAFX0Wk6v1rFIkKE4xwDobmoLkAUmoahAglAgFVzwBDQ7+
tgT/9+/2DXbv+9/b5jzeV975BuX93OTwPMecDy+qvVneDve8APyweg9B6D0H0d3/eHzR33evZHsz
2fxL2VxsmZCTlFZWGNdXl9Jd1xtWZOf0dCov61JaPTrlKanXwNdqLxYobn8OT5PkPlzCEVISAblo
XJ2vhkvSin3RbzghGpUVukthccBlACMgEVX7mjgAAIL2nRbJWfgtM546Qy5q/UZCNGIQUcM+p/U+
J5j9DDYmYAzBmDMe25i9A07QLY0/QdO04LbtgA9m9mezf7H+V/L/iR+Wg/LPZ+zdd6cGQEdc6D/6
faH3H9r+4/u//n9v9r//DoECPgIYB8JenhCKf3b+7+6+vaGED4X6cB6dpv7B6dn6j6i+al83H9g9
PxepILGXlfK55pl1wd6ADfs4wOPtNoBUAFQNTTYxSfuj1//18O9/wHdO//6P5EjaHMA4CAbE4oIA
YCIwG4wIAAIBGOldDTsgCIJSQe8glNmCAO/NP/hy+KyIJBJwAPK+98g8/lOPi43bTj0C27b7/0HQ
A0+2Q04AA+2+59wd6CBACGAGLLAb/plO874yOqABjO/55vxrA5znfp1uv9tfX6/V/V3cmd4u77nc
DHqtV33f1p9wAGitMqUzPFGBUJCFlrAX4fhubpc5zvAeH4bgIRqVFaGPRlHRLE4QGJAI9Gvi0L45
JBi7qajfMRrJXH8oEaR0j/e7uZAvXqq7v5jhDYyhsSlJwoKu/819525f7V5z5zhZmpWgoneeHX6l
8pTODw0VMMEjFTKVYM3oPlbw140w0JSxOQiPYD6MeWCI5/0/CFS/rJw51Xg9PfQNPZoYKySyuoPS
iHCgXzG3JKOvg9NQU9W5FMvOyv/8bPZ3SS6THa4DezGY1LYgtH4hkM/vsiv9B4x3LpogEexaexCm
I4VAMntEUPjHxJfP8SKhXAAAZ4gbQJVl5KfaPr5+WKhtJChTjgdBYQhAZkAgaWM863ACQiVvjnpb
KmgAA8kDf+1oJFVU7WoPycTAdAppPM5iO8hEOW5BgBLTJMyGTZVCXacOdTONaatEvxNQoBUx/yNq
pDchMgynG4FYsZ8nZT2mHY1sg39nfCe33+CMFv3XHo+pc3tJbViL4F9UYF/iIIv0W+VliAfomeO5
hJwARMR6ouYgv7dkdKfGvRp7+qe3qni6c0Gxf+5gAZIDvfyn5EAyypd3Meo/xNX2XCEaj8of9/H3
QWWlsWBIKB0FxiQDAS6vRUA0bCKdZa2TqPB/fLEQQSKWZAeLyIQhxCOz09Tyo/2D2HDT2wNmrxht
Gx1fbalWjheq0s8qXQNZENDPSuwEQVPuuz0pfNWqP6S+X4cf1sNBB+LAaPudP7Yur3xaDV6EKjqO
HQ0X8rVuqd3RQzxSLLCSFIMTm2Ucq85wlqs4k9WQ9S7QFTHOFThDjTzmp8mxDgEN/zY2N/r7bb1/
qdPQ2wuO0tmO37eYwAAC4AAAwIgygHk3VnrMqIMwwC4YCoaCwhCAxIBAKa3ayQgpkq2lWDGLqTqq
Ocie9/05lFsCEefneH6fhDwEXGza8wkUibkM19G5my5xSIDhFMJcEy2d7e2/HCLAaOzM3MWRic0/
QPAHkjLGtxWGZv3QUgig8cZg9RGbmnvOxchKGq54KF+1DNBZCYlMp5Kcrd2Nk8qCAAZBCV/3AMUV
gfbqFKJ06zpGDDDgIRqVHa5VYpFZJEBDGBAP8LABVkA64gisR8+zH2bgwiQXEjBu47iaHvkOYfQg
2zMPIMxByHMPIPpz6c+R+RD5F8g+m+n+nfI/3X6YD+7fIfI/IB8h9P9N9N8j9IAOQe6hyH/DA2f4
e7ZhAMwZjAPpvkPkA+nAH9jPCdfAPCbH2J14A8JwoNjWiAAAAAAAmAHCgJgB17wtpgAAAAJgB4Xr
wf9cw8gzH/kDkP+GYeQh7tyH+w/Svmz+xg+l+kB9wD1YAGFutsO+/wh/+q//6idmVhkVlANhA4jA
gAH80AFHkB/0dEDlea5sNIAJflh7N/dR9O/uv0391/uz6V839IBaQOFB18AA+k+k+a+a+kfNgA8L
scOOg6+GxvCdfAOOAAAAA2zbA5DyDbADTgtgLb07T9OAAzHtnoQbYAbZ6EHuvIdszCAAAAAAUS8X
EF1+v+Ub+SJwIRqVBa3HRlDQZJQ5CBhEBAPxAgHKSK1R++CJsPWNio1rS1TEwFkzinLeecPg85g2
GziazWahhk0Hm87yeU8nmvru+nr+dvp6dnZ2KKfuru/nN7np6/iupczk5XJxeAIp2cinfXXc7839
fAAd+B3veu+7zv+/He/Nd4Dft5u766iu7++nJ2du7WVlbxg7Boq0lTCN3iCyhqxaydkrNx1dpOOq
h/df3J3p3nq3fd6eqgLIqAJ+WUaSuSBAYRgQAD7gBbF1/NA0vj2ge4fxnxM1qadgAqsIpUxvLly2
jWbLmRTWsUxq3axN28ua27p9a5oPVe/+49/3zvwfN9+737k737n34A8g84H3/n83kHlH3o+8+/eY
HleT7/zWd1cy8hSfxReZtPD9rn2i8WysNvPlQ3txd5kMgplCUS8sD0hwIRqU/a5Y46HIgIIwID/Q
AqDAZwU+6BqVrTDLKE0R3BKS6mHIRKQiikWkC0gcKjwmxaLBsfYmY8x8h2x8i+QP7qfI/T/Ij5r6
f6Y+mB9OP7p/dPkD+7ezf5b4j2b2Q+JHs/Z/Eflvs/iP7B/YgAe37Z7QH8Ptes9seu/gPXfwxclF
z3+u0cnz/+m1xc9VqKo30PCapnFZ0+Hh3oWuUU3j2MzDDca1rEmF/od5d8D7n33e9+Bv7h6vxNu/
iAGaApAAXCkVE47DMbE4rFQgMIwILB/kAARK+gMfkhi/FBMA+b/sY+I/LXxPsw9m9n7L2T2QPiAH
035H8iD5t9J80/sY+lAAUWDr3Xuv9e8JaQOvgAAAP/Z9oA+0+19sA8LRAAAADwgeFnniIAABjZ44
fjf0LZteUXPk/jOX1vVm9j3rvnZaz0z0SXh5C5SNcqa3nFqzVEUgUcp8H7hlHAAAAHMBn81uSf/Q
S5c94zSb1l0z/iF5M92etV2avei4vGCVQxAeZtfUFrmsryahVjwVtBPSk+jqpRWo7VDEpPibLkhI
yjgGRiU/EK6/7PEfFaWY4puxT+w+5bGJ5zZi59Z1M1vhVDZY3IcYcD2O3nqCM0cRUSCBAAALP0Gb
zzwh+TKYBG/7QmIXsgPdfGw2MYn4jPJXzPUPReBrldO9RP+qXAEDPbLJmsfxGh8+g51yhw+WhMlU
4YEfuiX/8wtliqHV+wRsJ8JeHbd2o9ACRIFBEMj3QJBCkw+A6ELxlWrzUfyhsmDqtwDs11lTQGnP
Xz5C1FNEboF1bHAsNUj0ttWJzWZYBHeuC69V4ZVegdQb6/pccGWvX+FUhvem430QeGtuAfjp9XRX
kXDzVVFN9XGTuyEKSCw+sORvBfjhEBD1YTJ/JSMc8qxETKI3kuPoeK1GFznwVf51Of1qOpxbIJQa
rPEO4EPlRn8NImF9+WWg2+XQmQaWyBbGE5dbgXezrU5uFpZUBC82X0FkgY2N1GBZ84qrdx15i6un
BU/QkQ/C5RlWT9iHLJTO8Kdk02RpTStpo26irXgI9o61CTgTCZVzufVSb7vxtKfSFqI7vZOspt89
fkm4pF4V0txXmy66kTJl9L1MLNGq1MOt+9VU3PGwpiPyKb7mWnz5CQmxOmEL+oYHS/PZfirI0cdQ
c6fvpEzArKj1XusOWAJpBFIGK3mBzCzUEEDAhEaQUzd+wRJD0QolrNd3GnuTCNAuENPa158IVgtx
zhsvziBjAPiIdeoIADc/t+s2xxLiiSqJup/m6V2n/pyCXn9+IKgyf+vqVIIKuNETuzXyslZfP8rr
gGE1aL9aE3Piz150WYdmsS9EEnunmRiIAVI9OyVdSkWm8j5LJoWIv7oSc65NQ7XJOGcHFIJ0gE2K
pswcO1/Qak6fpq+XhP8UzseDEhJLJnGNqM17mJWLeDa+nVfAactNpXusAf1ORzyi8q75on9pVlxC
FGHPBFCU3jj4awFbGR80/AkUF68lxQ4mfAglGBpWnGX2Owzb1F4uzJiGHecUG+qOb19tCBbfNe7c
/N5XNUv8admV6qSE5Qo9KGcQms218BDHbm6IYR+jkZriuCyGcvfWCcB2Sby+j/rFoXNrVRXq1Hlq
SwQHAP72ohNjr7ABRJVlCEoJFOvNdVN9ByD0nQy+s2Glc0Vq5luv7jp4cIhVhwco+0QA9Asbks6p
NosAZ01B8sOybpxfWpqfMXBDu2787ESGtTNpxMEcEOB1f2UPW72srOnPO9angaNYC9jdVCwz8ehQ
rGjbNICmMTIS0jV4zDOJT0Svt5Viq97vpkvJOs2WYXNPIyTqFzuwEU6q07M4f2P7VuggLom1WhZv
LHbWgQg4qaZmKsdh0coKYRt6MWoFbmTPbzsRzbYfzWikoEHvsRKpYDy8bnREk7pBoF/D7ziU9jNq
DC9sNDh0mhPToqQjWYnuhgY84HN0EPdkRaNHmPXBL+7qjotGZYHmluo0KDhYW1zphOtQtAx+B+on
hrNTYu/bS+iyNicG/xcMlTheE4gX7I9B11nQX65ZEt3yYJOLZqrRXJy0Lqm3uILi627YcKvtCI+t
rryGc+vU6PQc3cO6CMvGf3l1KkIEGJo00cFC2RqrkvuYZbaGwcmZOy/lzucHi6S3kk1uSdJmVIAL
hIstoYuIOoGz3IEwiCITOxOG7EXbzUhsyXRgkb3yRJFoepUjHmAc1fAt0G2lO2kTIR+MltpzRfJT
hZ1bEH0NbuI5L1VZKIl1rhOpvNsFKBE5IUszinEZA0bak/GGcHuyzBBAU6mrqT23aWFu1da5QeH0
s4U/oOn01QxAVcX8KXVSSEQph7tON8oLM7nJTjFiXpnbqjoyPR+cgueJ4AEdsQtufZSTOjNM+iEJ
rGQuGyxdh0RKcFGisqD95KfObwXBDgXUWyhV4+rOHCLSQ0P5axHrIp/VldWhTH7kNvHsYk/ffPed
a6qBDjee+ya86BpdY7tIXEDkUi0oCnVVidrrAP+InnQBct79imZ8k79IvB4KlJrfpqDW5noo8ZMf
okdHJtkaHY7cURJxBHwvyEEGSZ8UjjVawM04kM7KPFZ9tWT4oivrN6EmuMHfpTRSUTY/xmYcHgUX
oR90dsCNsccrJru6+IG04Uc+NFN8MuX+3ZjW2bfcqs52Tkh/qzvmFF72Frn9yKj6tkqGKGuqt8Oz
byooVq8eEnyVRKGsuau3YpcXEN/HvS7lBV3Lu6MkFvz2OVNgWzGpnUYa9C5HQ2I/gEPnOp8y3OWG
8tUwcl7BvkiA9HdHq9ttl4CWp782eHoFKCHZ5Vz19uwCe6vRLpPLJxVC/+kyPois5VhW9gEFx5o+
lRZfiJsQXa7IinM34mZFZMo3SpSrXf7NU4x76pZtRvPEilcuaUARE88+mY2WdBUxmj4yzVqmUnvi
l+F/6A7dDkBc6R9+o4GXH28jyDi9J0mE7J9HM4v7LytIV/Eb8AboTWjTiIGF5GLMJ8kPIC23j4UX
hMWrjtd12a3uE01xKt30PQIuGCqc9Lvz/adcBtPHMhmC/Q7nB1EvQwBI6Bpf8kO7yIHDATleOx5X
towWllAPaRsXEUUoSYF7pdledstOPwqpN5Tn5yJ/sH8N5DMpsxp+cZdXURB7AZ8gcbajBCZQnLqp
0ydKfh1SeP6FZ3YgikBFA7zrAeHuAXutfIDZLDhbXGkE1zDa3PF89inFwlBdvwz6/ot8rZgCveFa
fWHC0g98Kb2VbowGHM9j8Vu3DPlT5CrDRIhEq3tyv7qsAs+BgpLsEAHLk8LahbJzLu4+eHVoeI6C
yehbcxIu6ECSM4D+bb4zrCFWxjZX8z7wpTrjcf5WKjAEm120iwz4F93VNorBX60x5Bll8u0XlsUW
pH+lGdlmlGvCHgAmEetG78+C/J6UI0zfyFv46ntW7Y2Wl/GE9Gu9nWNw5iiGTDac8T/wRpTh9hzj
io1wdHXSaCamXw5a3ei9qWTDTOUe2qgcnJdC9u6v8v8p3v/G1tWGM6sCxPyLRF88VZduUUSTT4bl
xTgJGCiMA5FbANav+LDWFydrOLQUQjhLyOw3KEFh2g4nkrki999Vt+Od80WGeUrP2/QQxL3mpAw3
9i9sAzG0Vnpzw7xDAE9gna7KZpdi6V1sb/6Tl4r5Xxa8SPB2kgmx5utqMvW2w/nKgtE22N+6GSGD
xv+ro+ZX0BT98TvlTjqNt3vrDrR3gmWuIxfWjKBtPArS0pXgv5QtwVp0DTLI5HrXScNLA4ti0WNw
RjRYpjntBVUrbJcZa8WUppHR19pRotkJVqK2ccG6XHQmHjCmQiex0zSl6hjiPHx7PiSSwAjasK+h
1MJ9Md3Yt2i86PsWxbmtbv1OEbz/IdzT9WNQfpr36c0bGWapGbrzZdMDkmmvEKGHgopoTn02A47Z
cg06VsJzEtVUbNoAfSfFRXArGZsB+9EVrm6fa9D6CY4cBwGp9cQ7ZmLG6IuunfjwTCNlAz96NOQJ
UNoR48m4NJXq4VwC2mI12svdm2eVxVT4gDSllXL3Aecdp838KYwz9SKEwQE1/O2JjwHGq7gkkj83
CJK94kQ/+bNiNtTQagaYd0anttTG1m+v3/nSuQMeuAgYlMfMMAmp18kcB5ddCJiwkzgiyo9v2mL5
N3/uRs70+wndTOWmVSPaQmn6l5ri736h9j8LTcWEooZ1tYguzYJXIz6FZc3odWXuHUVor2RQ76sU
6VZ8Z8f6GqHGWb6M2CIp0aB9pE8+/656b1pPHyrsOOXwa+iESpPDP0t+ZT/zdZMYfB7UVdo2lJ4q
X0fO43hjFgfsx/KGDAyQvMUntVjOEY/bjpRwGRyUwD38v7dirXv9aCoMgtL41QNNIMVUh2dGY8Y3
GZPFfmXzwgn+ahGtXtbnxIwmUWYgLcjQWQ4Yu0Z8msNPZnL01PSUd+mg1aYNCBCxumNeYo7PBtkO
5ZUa+k4psoqFqfgBnHY4AzOWcBLpGVZq70qBAAAM6UGb8E3hD/JlMAIn/8Om+y4ULHMnHU1bAQPy
E6nGgvoEonOCdF9+pVdzoh7EELHjg9nhFQ0bUJfee1mTD5iFqpOZ0lafEviz8d46wG0p6cNvrXkE
h3giamFjnFnij3slLpLcFbZ5+8un8U9VLs/rw3PoDWDeXQgjSVFQVCvHbvPLEw2qU7tND3MDGAKt
7PFUiWX6rt7ylGI7hiPQma+s1aO/K2QRBc3WJhnPLgdVQzUVA8plEwD9/V35petBnTtidjbec2H7
Jk29bGZXUmVl5xmzmt3XTHSh3aHMEVSg5eXm89h9LvbXR029eQI0dt3OemraY6HY746P/xgFAswP
CGcr38YlvjDEOoDMzQ9z3SgwiMnzfz18LCUJWz8A/Dco86N/dFeWDfKCRfY89l940i7nO1RsZLnd
H/ZxiyAJ0IxhIXcVE6NBQq0IzZIVQVonxxSeMOpzYYPYJHfbd2gFYnbQnbYz0/qgJ74qPaKWQpqH
gS8ETUL/ZrGapgSfmxGS1EFFKYGYck39mizv1dr0Ni2b6g5MRGJzewqevEpSm/ObwHgKD+ZpsV6H
PcmOrORC5kFUWddpo577IxpLkWl8jnFUq0AoAYVUpmIUVa+gh6xzUHNHF7LbDTYLA1jDFSTN2i9n
m7GyoGGOF0RfYWTOLzVZrhzx/2hudRVvPhwfYyp8wTYEiyQNoBilgjuM1A8fw+8a4zKMx3FPjTec
IrIzjwD2FUn1K4/21o0D5E7Bvw8ulW0GRakF9+PidFlYiQ0NJxwBzASOIq6MwrDGslrQNEJSjO3o
FjXtEm06RCefI9V5mcoyEsr1I2k8RQBIRhKADuEWltBW44p8YqC4E+c9Vyb8zOR1JbdShEOxiVq6
cCVf9y/nhkSN5inMJa/qOPkcaXf22Si/UGmtRYnvzi0UmKq51btnGng4SyV5Q33+npzu1UKp5BSr
MISo4Ykd2zC9thRjZMYQs35OLob/ojjYqibhK5SVRu6VsIWfQXmOWGqNvCJ5Y3FnMBfKHcEZ1R9o
SvLvSl3ul06vDUrOaEyAqcu4fEmu9F6aboLcJ2Idtc+keEfY37Xh32a3DokLNUuTz4Do6bTIwUdZ
Xj5TJxpGLnuJAtPRKm2/UJdQ3s2F4lDDlgvk2rGWTxEKqwopeaJsvgHrdKV3VbV15zB3FR6fxMOE
uXRtDgy0PvZTqG5VQObNfUBHRG+XTDujSWVRvlI4W3B57mIU6lo6mhDS9XZGG6kf4kbXncwJkpm4
krYbs0urDD+1x3StsajGQiCeV4bhvi3eAu64CCbeIqXwwYAxN9ignlFit0Q1GWWGc08wyQi1EaZ6
+S7tsD0IYkyFaiWrfIuIAUXQybELeCgz0CLZ8I+w2aQZHH8zhN2KHq5T/J4j1npvfcNjdS76Ka7N
JsS0qxR05kI+iBHwCLUJOTg37FnJlAfVjiLrbeGHnQ4Kk1UnUnFK2U2p62E8pqRRM7TvgibOjcoG
+3gqQHA1eU/3NwUb5m5KH5/Stda0bgszMtovXXGjTfwxCl/ARUJel3U8GTHwO1oYb9q+s4Ha+3gQ
6qs1IZ9GmVv8Jghd5rrxt9DQ11xQoBqBSfHbR0LHonlSwmgXh//FWVOZm+I7hEMrXVAlsOdjRUqE
JCSLgwq/8Llp0CDVPGhUNeNYHo5ATiB2SFihN+V1YnsKlCZSVd7zAATz1ubbiquuJ2PWKqZcX7el
MRUxOEjxwj6sZE3ICbO4nx84nxr3mAf1ZoXNUrqJTs/dt940zm4X5vaxtPOPVrv3C8arR+5JlTbr
+4w2SJPgBbx/mVTt4vjMA6oLCtZ9wCRzhx/tWrHNAvEdXPyreZHmRBosg0dD9gLLS3aXlMU/Rnh6
H0D5fI7npRPoysHAVYkHBv9kgra70ajhE2J/g+vFtFb3/OM5DJBc3fRkz5HYyhtefb0sQ3byinib
4N4kmNcaawKjPof0Pek/+YL1fkMxszx041hQQVBNHg0xqfPMcoSvI55vpYK4tcZ/w0Rl9XPqWpxJ
pqKMQKcUZMJL/OyaeCLJ05fjjdZCawWW+C2x6brQ92chT3JoX2LqzSWX1HNEKrvjtwWTssj27Do/
cLrwsAjhHJfYZ8y/VY2u6SboSLF3tzLsQ+DM6cFSX2uxIUvCOrmcURtmTkxEv+Lv9KNyDtxiyVXA
I+c0lLnvRdSQEjwnVwfH+p7/u0YJbbAVcd1PEVhSkOOueBt30zVYQT3zBWWuWk7jBAb4lfvQZlS5
RSlozVxQ7DHwS7esbXO9bo6OgNM3p8/9sxOz+9zosj82PKB3vFZrnBdq02MdE4a96dYmG7jilxr/
rRsyZ5dI8P98eWoYbQNbxiMLVHI+xvQk9jjY3Z/jiqlmJuF7X8Vhox+R8l9ask8zP6UMoQ2LvT7I
lCXAETQolkr3pfukd9cyksFHhWIHwLH9z5a+dcRI2FSaQS3eQ4F/HpVBwYfXiGKArxRoxFZQ0pqm
vFCY3UqPxym+/qrWRpcv6w2BqsSRGoV2J42RwnZuLAa+/4NtLwe1G18GeaEE/O3YyyTvdXLdKIBf
BteJuAjWe1KUE4IvuE6z9F3hy7N+uxiEdrpQCL8vF/z9N6naQOlPNbPC4l0Bx4Epihj/k/5dTKa0
4ngacrjFKRAfiFqZah5lDBhpAQz/CBORUOEHXtu0iyqQTb95K2DLz2cBIfytO9fKGra1LMLrbCOa
m7GIoIliW/OuY+JPIf87TB/m+SfMFKf02RNjiaYfvfYssFAMNMiB+WC+jURu/jyBjrGZf0QY1g4y
aqepGXHkzOkpdUQCOIKvTPy/KqPf0L76WNb7Pr6RoMFqb/cP+2TfFdVTR47bkpQKaBCcLujAi+uI
+r5C8vtIkSgkO28jYdc/sfWfDnE+IpbBjspQVznMjv3l4Ft8aL1S3WEKBzvkO1SmAsRskoqDqVJ3
uSXGhJKxTZitaW8v3jVvOkBKgJfP2mDvzJBOP0ZPFb0Ab/A2FCoYQGGLJR+4r9yv8cdMImq5xa13
1aa56LfZM3AsWuCWCEaObwrry3NlTAYI6av2cPh8RS8QB4VZ40ZbkLP9Yg2nSdROWUojafe0J4GG
hg/EzSvXtgeL2vyuThT+DWgCMGBzbRDFPyRKeMoFJ8DrFZE1qBdi4X+qyvJrABKMh6BJkY7OK2On
32YXzUZ4ndvxYxwce5KIxjHevZyttRLjBDyA/9Jce1IynM71zxrlMOCCxrjh3r/GfmOvHB67t+mb
BvNZcEH1G33pxMRAWqkm+tyPYaHFeekwSvTG0hj4+h031wlG3O5sCmDVO9fYx0WyQLUzIA3EnI28
bhaoJgppwZFm8KRxZgCZSvc/aslOd/NfGuMszX+aayoW24TCuamVQYS47MFqzObEC2qE0Yw4TtkU
YLNX3NEaoAmxHKILFiWxSSA88yI8jEEPPmA2AwHPquwQiy3NkN6DxRcFxQmDuRHoggo4oW1bQa9U
OaYFphVjQ3/I9njgVdcNWTdhTvPtz7j8k5MK/U2pugrz580pvNGeiyGC/g+sinDLirZ0j2aos1bn
nljnjf88c6DUdkpTiFrUc/HPU/MSCO4I6oOeIrYB8jZoq9+I7aGzbMH8HrXDYEueWCIh5E08xnEt
btCkrWFIuKnpbHExU0emVX5+ARqsCCsTNGzYZb86jpPbYzsQgGw4harwy9AHDCsFAnMv2nj63oPG
eTqsfJRlo/9CtLVNkw8WnYVPCWo4lUSLkx4OxOO6JhD+jnn6CMe5Hji44xzYfl8NkxZd6DINCpKf
QfPsC6jzbp7CxPHoqCH9NOegd0iY4jA7cqWTCNDm+aQm5X/N+5g3UhX67iBuNuTAXv3DIgocfr8t
Xi06FkDXm39vvXmeANFTeCSHVueK9v6Xs9F1daC0Zb6HfkOrIwhofwl4QD4aH3jDCAxlK4HA600D
Ci+ajH+xBT48MpIddIh8zl4TBv1DDhDbE3kPRWrs32GPwmULXEwDohZ5oY2ysVPgiPMqZEBeLGdV
zxOpDvYVe7i2iQ3myWLOPeOPSZlEaem8m9LEXt7ZMi5Dn8sWNCxaBEXDRlKyN+vYrqI0psv4Prv0
neIldGLfQhTLbT1BCSWmEibzWmoSPIzxvM4dHHurlrSt4WatEfxIwToERkCKBr38eeVbNL+Tnorh
0JIB/xsz1/SMRZBva142gxVL3CUwTkLdOg0SCooj1W5O52pm//EM6Tj8FsLcZQh3O0ph0GsI3PVQ
OckHeP8/NDi0UwS+1yIqxEm97Qqjf7hQoHHw+llHPWbMgJrdGHhlw362aJVXbBWLPTftHD2ula9i
iYQa+iHnItqCpjQLWg8IHAJDEsfVQ2Bgj3qcfKG/lumyPeKfnwDFHmDkUUch1pOWAUOG9YNnBNAP
YmpC2tWhYl7INWf4TSAxwb9aWmYzE6IY7GZV6dn0AAAGB0GaEU3hD/JlMAIn/+RBIp/e5t5B40iu
PGKraJtw33diCIzDGi5dJiF9zQogQlRowcbNcv2MeKT29PHiSiuaLF+y+/T5XXdHKDWV78wbADaC
uMzMEB1K2M2CARIoWMHZts0O59GQfatJJLzXeILeZ2hz7ppmmSjCO/L0TVQxAhDHPBrAN56m/W3S
f0LwqfqLfWO341ZoLYsCKy+6yPUp099gMx5jtSI9xxXDGIOZW4imEo/Obx1OqhPgslLBIsR0weCy
2/AbXyQs+PuJte3dT3Fv+TrE3kMBkqVIxJloKmgaP8G5xlO22LX3nmN1BxYxn5sTFy4pySus3qi0
Hk4A8mZlCjJFr4byPKqZArwhGGOjd5paZFMvgp4DAfAA24naT88bpwGU2VSkFpqN9Bwx3x1KktvI
t2HJY/M/R/96I0CB36V1pLxhGLzHrzHANmsnJFL8qogVgU+KVhRDBsPvc0Lk88AfY2UhTKRoeCai
N2DQk3mdEQZU/lgvvJAPJbm9SGviOtRNLjOxMVzUd8IcBdCSWKRCCQJ0Alkk1S70aGJTHysq9BAZ
nmxen23RMzjeGyMTavCI9I1kTzZLM8i8AFUGmi0JAJ/Iw1cQOpHnbjyHfbh7k2U7W0f3vvdmHU/p
bj4lpep7YzUdSLE6C0RyF29QBSX0WYkreaHw2LPIc04B4efpgSbrpTPWPh1v710HEHYQUjPlpzSg
ju9r50lKh9uIKFUqfFzOUT81unk+onUVexKhVDv0QBBJOD0nbsapQWxWK8WkI6EGr3OJE8kUOIfB
GEdMBWFCYyz2SQ7tKOuGdmIQ+BYoG0nFmt6cLPpdQtKblJF9zhU1dMMYSavr+qhab8WUw2s9cVXH
ziO7IqhRL9jJGi+EDGA/BhB0w/43EQhn7miNtAKI5UdiC3oX2v6SEGtYWJJUr7XjfnfZgkifEesV
thtWqTyi1BnMnEp8CVqd7IX7lGkU4IodxDliIXFN964RJipP09WfeTpPyiHq8FiM731aZc/HEgeT
bGL1wXyc9Mnq2MD6/GNJCOjTZrMFzm+ntO5ZKXeI+SjEWcn1kKcClRuwggvbiiiQkpvllHVg4x/9
LASYJmVbfhVaYwPCyWF3/d2GBNR3V/KJ12OHg+grd07sCcA9Rrvc8qPXUmbYWjVTXdYVOtYeUfK4
EBSZqHn/KfCH1w45bOrWqwKq1DrAGwBfkrU0NKstyDvBuKU8jq1ciL6SlhWvvQeKtvS0+a92z7ij
abhs9FWGRNHIsc4EP49LG4PQDozGKtFxOYwwfWFkhTkClwgW64Ax/1oAMtFs4yMvY75o3dNQoo5s
uhFt8Ffkovun81WJ7yap2TfWKmvSmSN6K8QI5QPI5wJFHmYlqo+ZjoVw3xIJkoEI7ZzkV05CUxJZ
yjVxzayvvr5MEetSerPZK6WOo2XJiTDsO76PXAu4NGuWMvHDrL7WL0yQAztrvS5miOxPUW5zjrXS
qWB8InF04GnBXyJLGIEv9Q8kG65kvOjQkYSOi3CYQcKyvDREyCZ+bwBhDXvZNZDSBxZciB1sWnZz
WQNdWGysgWJLZu12Hr2VhANAXwmn/FSkIrgdS+WQMmaFHpuQ3nQ3PPYRzT3h0ZtXo45QnSlZ5+N8
7zYioP6jTcafN4gd/PRUTNf0XKgEbKWCojCzCm/0Lt1rA3Z13dE7Q7gEOPle23mPuJxR0KFRcePi
iHxjiDyiUhrfjspX3u3OgPXyZi1BqpNJP1ah92SQk+nYB2NZwX8KV9f6dHGLTSnyBKnert5zrBR+
zrY9vLAckpP2My0NqHicNWhl3NOL1IvgAEj/7pIoE+xhyY5LXO+D+DdKreEB2LShibo93EBotzx3
zrIHlGnDqe6KSyhzyG92hnFG9ygdUVbw48bYEr7nWDQPbptJ9dTKf7SdxNy4Ro160xUFT2aAh8HP
9ZgIaE8wqsn1BRKVQRdVfbc9J+r0qMarTY89pteSeRs5pLh2ygT8+eyAe4uKCltqd2jY5uAF0Ump
bCXJBaB6qStVCV/dC6LUcu6IKElqYraRxwvczY4YnvGVtFWdBsQAAAvSQZoyTeEP8mUwAif/8LfW
anQQ2/YQ1e6eGkDrnaQZtd30dHKvZ3Vyp3/07ijbfAXeJLJJHMtL90yC3U9uLk9ZtKn6c4d/ByYI
TEETIwuUG8fF9Z/4JDGPuThceyIJtSN/XVSMz8VthXf3iwoCtkUOVS57Of7s5cy0/cl2kOGBvfuv
bRXAJCWMmVbjYgoez/6PqdAHHsGDIHKH9oCK9P1xMw5FnGYYJBpCKNcVJiOqzve577dKfVTtbEiI
zpa4t19pTnb1nneosvP15dlQMvx5cyJCmkFDO7VpUL1dO4TCD2jrFNF7TSjb81ze/rYpyHpcHD/5
xyVjWm+QxsGv+OCTd9C9VEw3H3LvXbO978hr1x+MkZEH5Cg/BqrNlMrcvHYX2v+ZO033qpYSspW2
MRn+GuCazss2Mt7w7rcBL7rZR2p633HeNQFOjkXicTWjdqsdLjGJBWKYCW9fsskrN3fxpykvMFJv
g5UQTK1gS/awJvrI1Wc64nF++nKDi3BqJ2LUz/RC2mR4yfwYLPRR0zDVYjLcTixMPBAxs+OZAI4t
nDTd1ktbbcisFexUHSR40S5kSCXZ6xXTBfKNoznuUY5eKRdLDCPA826XEysd3WjYGbhyK7Eg0oEI
OT8nMQVReHYac3VhaHrjpAbFTDuHUa3iHuCDuQJxGNHyWMjYr5/GU2dIRmPYFxd1IeiRmZpOpJq6
PK+ZQi3DasJcy7pNUHlrxq2cKGEG1CAZGEsB68ZdNy2nCIG579Sq9LOjXW4IywkgYaWv24Eo/KVA
NSq4UmVyrAOoBgBf9ckND9kSCteaTsG+SVpt56J+DFNC3fen0oEYG6BEE04tjh8AmLYlCEg+p3eL
nsnv88PdvL8uc21KIuPkjuKTlZdlCJrb/nNSZc12ByFL35tyeQtDiwREp6cjvnguQqa/puLr0Deh
79ONQeuP+vJSnOXe7D0/+rrQAYmUGiDO4PBwChsZOWUcaJfexNrbRIEYcwe007e/6QdY9HEzhIbb
V/Jn8XkS87xBoNpuCF3+fTJgi78QpFO5y4PXGyPI9WTS2UpEPapMpbn67yWGXJG+ggbiq7aSUkrF
3oiXFozfPeSuoBK7DYM7BIQsTZJs4BzmcK2oDpTBD3xAkvASKX8Na6Xhey/JF6Py8ODbFEictVnn
dg6Vt0admUKdcs8JGpqOVkjIHWwKaDUz6z+qjxwnhD51+N4z+grDcFGPpQ8LVoHBIVZFcnnrYpq3
XNw0hNGqZJ7cTVexaz5WxVu8VBWa4R+5EaBTvTwrC4sC05gkKwjxlTLTuutjPjEOLppeNgymwgg7
Fz/b82Ip9ShLDbxwrk4L8yLn+jh5ueZrl3yCOkySZ2hSt1W3H4zaUat59sbiI8iNcwJ9nJlBnWHQ
h5K65vEV9inLpqxnouSmnlum0416yAepTpW8h5TWI8ywC1q6tbBhXG6lg+oPskZuUs+kcc739RPG
XfMyCwQCkWB93IVASsMhR8CMNg2jQY+LU7KpM6bSAvMjCRthp15j2iYAzm9izGaAi4cwWTOSbIDn
q3osi2E5xg6wm5hnPRs6GLxz2xFhwbMqaF1/WB8WWZsvbjg2X/3KdjX6ISkiYhc+Sh3tleWQ2Jqs
gxBWu7wAzzJuCtDBmEpv28cNwZwc8PW7hhX4nksOnhcCAaMV5EMiBQWLcNMDfrbqu4ZHoftH9TuM
mmDSujoBfYF236A97NP/TqoAkuZyfb+CASjHc3cn9stgfgvYPxD8Y+pfqkxTGGNL45BP5RkZ7lMV
WH+FPIKzptiw1DZYMshsHdZU1CS7ZIVbTrM1wBpO5bHiSlXFj48CifvfbJHwTlpMH6jxFKVjf9EC
8x65nalpFJbUbRJ3YW7qkBSPO0ylXTgn+0S+rTBdKBGekFnLujFuIM6T2sUf7FKPFWLYHMQo2MK0
n2Mlj7xgZ6Yqsn6ep2di9Y9jsTi8Pe9BK7FVtPhzOUz61CIENIib6/tmm/B9CzbKQs/6xbErslWi
RF27/ONq3Os5YdtjGgYXU3NTLdIgSNIc0g1OXQYWTrd/n9mkj9oZl4hqa3AFwB5887PF15S4jMIj
VDVc8X01kpJp/JPWZonw0t/OgQge6Sv4M+MuRP6lACYHdrA0rq68L6C4FlkGtntcT4okTd4WcghJ
UgIF1dyMmF4TMQMurNAoXvvrnwYXJZyIBiWqphZar7POnpI/JtB57os6itScirzFiigT4YWL56CK
fhlx85rgwiTMHWA7Ni2i4YXLkZgRe+qOhqiAcgVx7iCAt1tKDyv61R7YQ3nNljvSky+0GaoqU4Gw
pe5AfBm2z4EChwvRwkUKkySzdmQUlJAweTwYryDL4ZrwHKFrGcOeplJc3arw5zj5Wzv7a/jx2sBv
GnPZQH4+TsVitrwmgBkQDf+uGf92YxwpIvpBNwQvuXgZ7fT85aQF16mOVFHsVeHc9Y55zAXgLxKF
CNzUlwthPyCtpw66yG0pMKCBLqoUczo37sxW0Q5uwHvL7TYNBkg0PynQl6bspKTX2/nVb2VzEfPb
6wS1myom3y/HxZnIYvurrD++O0QEUvtDs6KL7R/v+a2JuG+E1krfAONQMjIyGXl2XoHMzoUjIU/k
2NEj3C27bpkgpuezveZcGs0EvNZ1qazj+wCzi/z2zRP9hkIlesL4Vr3IygF3T6zcjJUSPr75KELO
p30dkueIdI20+uI2r3pHrLq8pn+F0I7rKa5q32fcyytJ4+t/dCeucVBvXEi8K8sbAhNsTEOnvilF
Icq1sI+Fr07OLSrfLR+G2dqJ0Oydx3uH6EA0wywctyk06+3hHMew4Z1AIG/EBXz72OgVLuM1RG6x
72LTLhrPG8u1kqp4SYHyi+BczjjgM17cD6k39w65h9QZbTWNY53IrHSCXFwx9i6zyWi4Mu6vUBoV
N+KcV907+DQEpJcAZkg1oSoPN6OwNyQBzgIyE5W08OO2SIUp9RAhuHEf4peTRdnWz4cmz4hUNHw8
lOj61sj+IDSmdxvVeUojukynrlmwCJqJQDaOjqb25wQqT5KjVYfiJGB44XlTzVp5V1Ji6BcmnTgz
S0BfWLxuCqzkhCdPvNos8ay2W+vmy0zG3aAZerjImLaBhHKwhP9GBu4Uk9mXh4mIV7AqePLFlzAn
98ZX+Y5NDD4P/35gpVrTJpdlX2ER+YTAHF5Dkr1SC/rIAKNiu+AmhwEy/IbM8aQYkzJBraz8jq3l
mU93Mj0EstppxKR448Wrv0MSZE1Xj6c18g7ns1R8/oYBRqRHSQCxL5JZ8VyRnuPnatKdCd4M/bnC
e5cMb6rOK1enllHbFEIo4H+J7S5j1fG39UNi/ehkZqLpCeplbUJv1iinuCXrDBzWYePBFpq/b/YF
44+brfkIY+G1zZ694Zp0skWXt+p4D91S1s8yVvo0qb0livV1Ml7K8NGa43yRZ3Nz15Doxr1jZ/mK
rCRVusLpPWhLBtL+9Cs2cnLtS/bOm6Xd3B6PwexdBBbaJBsloUmwg7NZjqvTRvs+4ZqT0bvRHvgA
VDp5d83Lx66/1xoMmkyfw7QvwPqS1Ff735269lZ+aqNXcL0z6TSNZwhtWydIBEQVCSENRO8Rr6r0
wxPpHpXPVvkeMNJ32g86aQj18vh6ffxyw1FIvRok1TGTZ0bL5blJSF58Lln92/DwO6OO3KB19MW4
J14IlKipF3vJKd2omUi0b68kr83nOiUGyIvBoaPyt3OC1dpUzNTIoqflXeh0iKWG5Ya3tn2M/vLJ
WPjRugW81P3vwfMK9ap9WH2PUm2oEyOZWyWFwvuEl8KK5CtLF2iyhTpx7Bm+tNc8ylwAALa2xrWf
4XhcTFJrbLbphQqUwDcgkVVLetGhaVMN6dXkBzPFGuw64NNVUaWnRYRqUVfAC/vQAwb2HbAcnLOE
YcvlPIgiu7wJjLqiFjU9RXSsH+ERN1BgEGlF1xXCqDP5CbaywBo+kVuaPx1FCuBndk2Cw4xNnB2R
GKkYhWW8GCKSJ5gB3TRYHLsVZWfJhwXa2kzfZCCwbTjpLFMy9fAclct5VjenrMEAABD3QZpTTeEP
8mUwAif/w6cV1l+EBP1Wuob/eUAlLGnec8ovjYtwLueI8ameJslYQP5Q9igS39jxyLVHCvaeW/ym
PtX+P6SpThWV92q5GqtLIItVD4u+PAHdvjukdtTK6+Vcq9P33I+jVtdxAEsJ9APioIaMVv1wR+9l
Tt96idww/hXyTVjFZn6h88o95Xwp95DnZBQOBeUgVTnlvkKnmqAMMrIRruvFSyR9Lc9BQuBQYDwR
AWKlyAQR9c3Q0z6mxPb/Rg2Sw17j8jIp4Y5ysuNldQGe4hnYVgMxqJTuloUcf5X3WrlKTHeTPyMQ
OPu/AelO3mCuTMUpdw+5URA22bC6cTKb869JTObtytFaiw4Q7u1e4gmvPJiVyO8KfrNnSxU4vKaO
dFurlXBajq/QR5XalS20Zc4XREUTQWjyNJ+hWMCmkYLKK6coOGKKPZq4HOQbp9Q4pu3kfCJWhAjk
RcOPurvlf0IhL2+usGdRXkjWNn9WA/cER1DwJi+IOHlq8p48993ydYEv0UgpZ0ldMM15itpIT+2G
Knw59B7bqcaIJU2yNAjqNh8rAYAEzrVF5/QVEDjJDYt4UA/siI6gx+4ptcvTFIWgvc9ucnH5JG34
i7spIlUzfw4ludktCTddF7bDGIjQZGQ+CFPvoQ5LlHKMq1Ib/GBEnnpAWnaSJkOdLO+iWkRgkgJJ
9lfC+cz1Luc6O9ySl1s9Un4sX2/miaRHiK2/v4rTB0xarhn1fvk0pb6FUW/S7+e6pzUtMakZArvr
gaLnhgkWr5SrVD87h0M5GbCGOmEfAXSTwo7vOpbT8ZuftsLoezgjK5muguRXglhZ4n2l+u9OawEl
xV8KjbvApzAX+basAquF6ttYLz/uBoC6vKtWGFDB8DVY8H5B5qxwoVRmHCf0lvqz1vD3i8OlsuTd
sSTezYS78IDxcgjNiMSpmozybXRUNOVXQJyNiXoZJk88G8JWYlucEsOL7UPW2YPjZt7yc4P4gLGB
cETE2pGkb3G8qwb3Cf+4VF8nlG1WhawpkoJ4rYMZsAjI8+YVzpXKmcrdgcKe26v2wDY7e+RDIowU
DkO3cw7V8lCntPH2Wvfc2d49aX2UwTUDPHDqIBID1MtjhX6mp8rgQXke/5pVT53moOmMdpeOzqIQ
m0BCPh8aCFNkh5JlyA4/s+ivdJuNo4m2k12NbqPSrgMtoeBEdxblLXsqyJe/gqE34W8d2XRDekd5
CWr6HEH/vKlgc7X6iVPNGKkzTbQbxALCuXSjJfH2iNEHMAq7HLVKmaqWT8LeSYlSZ++DvVR+lJAd
jbgVKAZgbCOr26Zhk6tCZcIUcEAslhijOXc17gorZTLZbphtqLtxtNHcOeKVSMrtzf+n7aBt+RK5
8u2f1S6OCqeXtAJ/4cH900jFUfPpl3W/w5eDJNTEKEiSxkugu6MDjtdXOwGECKLPFkf2rikcRs87
erHmg5B42yP2uGFaETGbbhsKgBum4i1zU47iCyenzk2rpLUPuu3LLCHHozr0C/4LtODFKGb7pc1E
n+jx3oUdYbTNpAB3Ysy58HgB8/VpKyeKa1XKgSdN2Z1UoqsVjnEInfuENx1IPbMr0pmurLcsQ1mg
SEI7vm0ascIZyTEfrYrfbXIpX+4NFvvqqML8f6Bh9DbAq56SCwvxjQIU3ml2GdTIvLiwKkdJduAh
kM0qlw/b3jppJwf4aktWOmJ31u39WNTBy9dzAuSAPRkC9AdM7ePVzxV3Flk66mJ4bstzLjUyJzes
VoRo2y4Gh69tPMMa0LIwiYVF9uO6MfGUKGUAHLXkJnSGUBTaZVN/tSkNMuIVSbyi+3FCKwycAfwV
mt1xF3o8uF+AgefjSr6kp097geF+Iqp0nwYE9Ae7fOVPsCMxZJvr+iLO4r6AQYwtdZCeMIFaqZ8F
VY4TIWrn6QRqrPyN6jn0wRj2Dh3vwW6lEKTxVoNKzxoVT1PZQ69McL22OUtnPxGw8mILX+y1dAe7
bvfJLE6iXtDT3M5YzARUQPaqh0ZYA7WSKkmn+IvkaJaeKCMU9ArsBK0y399H3aSafOZNCGckzER8
Lq+HTEBrAidwyDjJyQmttXFsJNoJ9PaSZipG9Tc4ugm1x30QMlX15bquVFJckTX47MFbByK7F5PT
MfVAWIQlZ4S83j9dX8f//BHBm9uEBLoCgaGc4iNmnbXLMGT7KvsV26sI3ZZsdF42LL/gOKOkV8QS
eCekBYaYz1kSaCsYef00cVIUHHxq2YrIWM8YGZz9amuK1DHTGqmxOH8Nh5rTaE0/+n4mPsri4EtD
VlKCnuvQutvd0K4uraUMZHmwX6Kx5ApwWy1URb3IzFnJ6G2rUaCqNTqPVEf0CQlc9NVgOVTxazHy
8p0FSo++TAeQMPuivkg8CC/uTFdWriPf3nMAeepx/pkLsE5Vl2TLDnmDFd+EVDVZqV+MDWQyizBR
NTWrfozhf2VLktkUUfkXv2L7rD1R09lO7uN7EU/1G9SVXvNHg91jD8XB0g9kmrwg1jJtCSq4g8jN
N1wBteMulzJB5/hFz/tGtY6yGrffItiW7wPp+wxmrxTUjNtYTxXludRXWCCOgC90tRow6Dow5GBe
0kLMHwJJE0C9GBDLDyL5qm0F2y9Kf9Lx3kT/tZtu8G3UfssPTPAlyNN6dAnRq5tVm8mr2Yh0Ix0m
9+K5wKZVZDf17VWUeNcsd915/u8LM+XvDjai7UpAw0Iu9gf8NJRfwqAyZXHH0OGxgHfxDy7zRYil
DJnH454IoR78dSNo0hJdLZR5rkNWUDPQ6houx4NV/kqh3F53/xv0VhEhtsaiT/oyroSScAmrzPII
IkPsXT8sGXmMVvYWK6M1nSx+vB5TqYpRFEHRy1wcTxCuXQ9ZVXRf+l0159XYRYeOwPcby3OuPqYZ
E5vR8Pkgik3rRjC31FIUyhUIyKnmLeG847KYURdRyhfa8ZiIjeusLlSP7FHrOG2fDXUu4095me+D
azI6pEUV8Yq1LA1FuG8gly8tnWDb1JzNxtF9gAPUs1vbJ+eM0QEmZNqDSxuenEhAcCakCLmK+dGg
XK3hkHK7vTOR3at0/e6btR+77xEQnk4N6tHKJdfDjNa7WsbJGdgoa+c7V2jH1VPVy7EroKCfXTSr
RHYQi/8zy77kw88/Rw1sDNFlkS98+FZ5Ep2Vg448izrYmXW0hkiqonRc1YprBpdycDr9Ri7oJaUW
YEbFsQCREXr3mVsNwFespVaRAoF5hI6vfi4cUWQ3bzisiG1AujMAzplMpctpZFM4BydKNTwpIuPN
k9A+ZN9x9FiG00sgFe7CoOLGa6cL1wPajUoRdcr+qBssZxUA4V7ATwM5UoTrXFPKBxHmfffzCgAd
7sW+oeeq6/gMS8QFLxokozmVoHp1jNHJYkkxaRwa1KwyNYPKN8vXtfM6qXepdOezEH1QBN25m8e7
DvT/bNw2bWvj74QkwtAU1CZKb9nSgc6v2Z1qfzLs4dtwJ4Sb8TUWRxxVJcBd2E0Ub7AXXqlH0Ze5
qI9S/X3izRv/Ev6ZpyrCJ3jIRTG/d2dXp2rs83uRq+eo+vbTPfXEPLw3YLyE/u/VQ0dxx5rad6Sw
E4cTQO3NnSMkKaY+Lh0eyb04zD93qwHjcOt+Jsz8wZlme1Z2wGTnhVM11JnzbbKAgOs0e6v720yb
kXky4qs16RuXnbxwRxg7PFKOyTxF2gSCzWXv+HArPcDSb47GMEO9mi6KIWaRQ7Cha9+V6ah9Vij7
MkKMf5yoXf5tuPerGYshc3WLv1kg37EYIRValE3OegvJahg1Q81dqVTFCqvVK21bB5LJjN+DIhW3
Hv9LI4W4Is3tG4TrlSuzEYrzE0zpRFHIFIgzbdSVv63w6P/vJXG91xeonYk5gUlVZ1AOLUPu3Ptn
gii8ySJ2EGBJGgL/CeZIWm6mEV/y+8Y5JP/ehbcbpvg3Zlxckb4J1wi0FrQMedxg+yvlL4GuEfuN
BvWNRDtYdsu7ljLeMpZJat9MhWPB5D0bumFqUQvZ7CCe9EXmMcQ9PTz5L+H5DbCCzCXSolbMOG5z
5TQw7fpxPRdyWpyyNVLVBDaEAiTideRTWYFpl8+LkKG1WLMw2+3lNJlG8Iae3PEoJR2y25bSbnRs
lbGVkUzNKsVw+CmTbTiiAcTM0DKYQW7JdF4BE490odG5Z4O5eoo3xYtKBHUkROQbm/8my8bYkFST
5IIeVV6JDPcJUPyEwhRhXiNeuYgV6RCtscHzLLz3yRh0nx7uK/WSnNXFuEMfhG3NXjuZqJFzL99r
c0D/Uk03y2n7zvV38W5FVIQA+1+SzjcLDDfQDN/2/HOJYxaFsMOy/6DGsTnRgTBxuwPREC+H0wFz
/vbMo06j0ACeUwZ5g/13CwV9SJCTA86NxPkBDMDDw+DU14gPW8l9va9d9R+WmOXH9czcRopCOAfH
7la4Mdi9/wpH9Xr6gr9tDiDWmEYiH7HLQ0OPkjdarJOznhVHN3UryhbKX/j3nyVoE1ilXfhqkF2r
FIeWADcCcpqsBf6RDCkcCnx5ARpjjlEWYQ4nMW4LAp/Jn5ueZzv9NIRjzCXrbtPFPJ/bcq4AdV/r
YYYqBh0uVwP0vCk72xtRl0mPJ/fWGXmRYJElcnjyjZ85ickNeCkjUU4f8MDewRT/rvXJNvFhafn7
BC6L1ACVgIogZ+pU/dmTGr2vNXlVsv6zv2k7grfkEdKz8k3DB9vu8g5qRcRRyT0aZzLiLoDqvQru
pTqejx3nuxxO9rAS1yL3VV+m37C+FIFr+kZlT8XQoPU4ZbF1hT+mQDYThIiX3HokZDh/qL8dO7vz
LG4CE7kK+XMpfZeX0g5OvDGvDYz2Bo4RXMskRAPolOfuY7oEdCxol9eiQy9FkXKDJ+rKe7uT2zD7
lYEWiRQOdMkMMEOTSXTu7J1qpu41cW4ZHe31B92bhHWGe+fPlskUJ9k92hvhUa1iqTMSHJhQGE94
/Q+7fNm/df6KVM7wCDTOrBvgfLp0YzrmXpXQpDF5SsZLKW9afKdra4VHmKcMDy7OnQ2yveBPqaSc
jbmn2GV4mnq+xGQQgPtr7hysAHcASXKPS4Yfh38QGFQAYrfzbxoQq/lSLvBA/QvqYoxd9kLyu3F+
99eWHT4/zss67fl3Cdo+7CQ1dSrp2ecd8HZ7ZDlabnezsV/OqGo+cXjA3jb4OvjLzlEBCVVGiPuk
LTgnPBiR4FHEkYBTFQVBgQNL/U5RZ0xjzh8Hu/FXXkzaf1qUUlxHec0jJZvGuBfuI05mv3+IDWni
H/zkJmfzeloHzqSHVUJ4F+HvxPv58onrMRkvFNr7ISqQJnf+9JoSJxdFckJkhpJYc3TeGAWDNoCs
87umqilCQoaqXdWIG78i/w78dDeR/18n7ZX6bBsmUVyx6VHMIMpcZ4xqZ8B2YJ07GN2AQxPcT5qi
1ut7ceatW+hZVFm9E0FvX0/9QwAnmJD2fRMqsg8fazNjWigg3ARXPSqUa/WpXOECbsbzqeamy3gG
w6AO4BN2BF0R/lOmVeGF4iT2AduDG5iOnM6bR+0jPFzP8XiCvL70o5vL8xIvomhVrCJagtFwpSIs
QJcJKJWpzUEjtVewA2nuXMytLkgf5QnlesG5zjXEeItGtJzQgeQ3jA3S0jutf0j0FnG6YaiS+WKy
tb0K3J3Tlw6L6uuW76gcF3TqhFVavmHiClu97gg0i22E0vTh46R7ePTIx4jcpU+XhvKbGYvsPLym
7Y8kIUUBMMh8QGH9hkhCyiRdVd35mgmCL3C4a9/zHeBQsB9MQPepWaslNyq+RMFCmCQYG2JEMRi6
PsrWRq4AAA+KQZp0TeEP8mUwAif/uMA0IYVxlsaMsh0gMsJ1QGbsQ7Mlly+vyHW0W8O954acyUH/
/c+L9MmxH1aaZKn9oon5M1pifP4zlCl15nkV7gN0R031+6LEGlJ89q27hP53ZCchBYYMPMPSVbZV
hciVvlEJDZxO0FR3s4IPJkfR/Cq7dZdyeTR3P7xmxiZLtxHxXCYqTQ/KOPkBlXLW0nm+Uf8LOE3c
dyAQbLt3jXcA02QZMDP3b5ayyZexqwT7bRoCuMLNHRoBcZIi0DfGierL1P6k5vG3GYNKA2QV6vGm
sNXWqNLQr8ka3YOh1JxUGZYtxMPH4QzlyHsIDYFaVskFUhQ/8Z8VA++VPg8JPNK1Vd1mqJBku4de
04G4Qjtv5zTL+OPpfCmIdYKM/hFN/P52uOFm+bwRmvGOeZT4keDbvY2+nkrUwG0R4setil+xeD+Y
xUCtwsMLJslVr3d8loCi2YHJXXIiMKX3csG22coDSPGzcIJtcEwuSjwjTGzJpxhfMwRGvtaMZGKS
Q2E5UADEfTv6n0CKRfLJoRJLi0iHdjgUKhcDfztnpXzrqwkl0ngrvQY/pOmhzKHSyNwrUh3NokAI
sbBxpoYJ3IaXI4Yemep0HgcNoeutUAGGmXTmk/GyG/T31dpkce6suv/c7+YM/Po+k74EEkCnSlaQ
VUN55qCRMv768D8cIZVvZspaYYzgc1XGQByzc29W5Fjw6SlRNw5td5fA3qkr8PDtK9ESCcnjP1Lg
/U8r8FvHrFbXQy2Wn3kHsKRDFqvVzaSTmfgC1qRuEp/yCN3kMB9s+3DCOAqAwLatlruRlbPLNVJN
qpgxz6+sMZDM0ndinXLj4gt6L96G7jWQ+UXt5T06KEv0MNcZdUXeYcVdiKUi3eZuu8YN/5PQ4S0W
paCWGRCtFTAVlVrZVHJAkr3ov2S4Ew8ygLUoDWhuxAB2ZWQ0owtny2LYLffH/F1wnWHJFCuL91In
gKIk/Llla5Sh5WLdsqouBBkTMi/itoMp/Ni9Caz8r8v88ktswZHO9roqpQ4mfoncZO7/x3TsaWak
RQvzDKDKDmQrkseYktrzhf63jImPE3cCGZCABptkLroNNexPvanLkNAZ9H2yDmeRvUGAo9epF/6d
Zum8qe9PGMOmbt2lcSK1p5wAeOtLGDUK/iGVdS55oP8n4wOKBwVf50w7teO/pEvHB3/Vbn1ib0J6
L/7tW+QZK1kR5jiz0GPuYIsdZVKSY44GOUiHaOyqmFXZnKSprfRTEpwYAVcvBLFmUmjUY90Mlrt8
3JKRBs3ydeV4W9Z21P6FlLfJcF3bQyDZZFykbeqY5mFGqWWMhG2wZaen3eL3Ukw84pAb+7fMFy4r
yP2FQKVtPDwt10rJ5h4XZ6a5Qt1vkCoJh134bDlVTQ2l75hemilsWqDKvBQulXvlCbrJZ4iPAJd4
i8enU9RUMDH6hK7yrEzQvy+u/281MC+sx85UUMCCEt5JPUyYuP7m7lDDfEiNd4DkH3+yEVcih3Uw
nQMmeqzb+511i5bU+T3/4Vjm2K1EU3PI/n9t4UZhNzZMJByaX7t9WZJ4xA4UmGnKbMmUi7yhQr87
da1+JlWFUjQ79ZIUyyCvRWpj/jH/dzKF1BhF666SlqZ18e1YPVWliiozkr7kkSummngnAhG9yb8/
BrYgD32kyAYQGyRGEjmzQkTKg9+kny817wynyhK4rJM4U8WoYKIk/7jIyn2Gb63egnxg6yTSdfPa
nmVE/Udwo/8LFEA3bo8l3LI8lMnhwpFpT3rX63ccJxV+KOL72PjilnUz8Gcv6xCcr5A8gquwSeFG
yh9YY0GgKRCxrFAbbivNQrPLKKOd5ud73gkVvDNkLA9aSGWv8DBTir/ZDRcGlB7msfycCWGaZJos
zs8+ueECTbldcAAnxT7GvZli/WJTS2r6HUuIAeTa12bUYYUmi1i3CoT00ORJ49pg0QAj4HkvxSpo
paSMQWwrsrN6Euj3BqqeF2aPBwyuf++Kfv2uXN/Yzd1no+29/cYVryY0o1Haaasnv343CU1rZ/Jb
x0giFtWTNeGsMjNFi9LxM1aNS/NiIZBFF8AxptlCsZ16EHXmXsZM5jc02RpJ97fuVublOdNYhQY1
psieatWEZRHN3tGF23GPT8kGIyR2zSgyF8vbTDyknz7+THIaM+Pd33KAeTGUWb7CQSU3G4SgVOTH
EiUfBbKjcYmxM1sMuzAxElVzbQDQSAoAHa4+muJaqyhW1eiKYdb0kz74kA0BeIUuH+M1b0pgE143
tOl9CAqwHzEIi3aLG4FPrt+vmWICvTI+xvKScu9N3M3+vE1rRunizlU5PyRMxVLRhUGVxZ5KkunH
7cpaN8VyJO/mC1LJ05XTRTWw7ef3Ns3HLBIC603rwfKEQCUgomOoZdCqdGHrY3mRLKPdVN//QmsL
IsutKc/DqOT+pbjHRnaMuYF5oYRwsj1WnCtdFkshLtpcDV7ZPLE1pQ7tpJqFBuLvjB4nPZIYgte3
QwQ0AacQvXa0vcDblVwDLo0Nht8gYJWXvrueqUSugOCikaFwvl6XXpWMgcr3kKMuaIKa0DqsGVjF
DfDfAOeQhaphcqIVZnVrUyeSJZZCnOC0p56NW0GQqnEsaOf6DJ0xGLFiu5Cd51aVemSv2DL8alzd
6nCHpmxoJpfZFDJZ0l/AeNc9+fj4VAB4/FKnWdG+wyfu1/PI1GFv3542do2KZdv7B/pDgu8ytyIR
HpwzHErzsfRZC5lOlKI6GP3xqctLU568+yz6eh6dKEqnX+NMaNyXWwaAFijwtlO1P+PSUuJBno5F
sCNuNSS8ii6Jt3h5GMgq3WQhX/HvjTeuOKsD7DZ3UPZWY47LI25tYkBdqjtWKpMYEgd27qeUcLNC
G4l+AZ/j4k6u8cNnJCsMYpRhvfvhaDIvxEkSCkEhyaqPe1pBre7v+J3MFWpPdnDk5EiaKIAB6mHW
qZHJ4uLdXNKGuE0z+kyMLe8IG+YCBVwbcIsTE88Q3luqSLNJHPEEx0Mnq0QWiMaRiktQYtkiTlKx
w+891bJ1JWr6RBSBERUvMFoi6GOHu3UsnRC0RDRhrKGoQqjZNZqzZTNFM90zjupKhuy6+EoxjTwZ
o/Z42P57FARsZ4JHo0TbSipFsS0S7EHbhAn7ZMcwXCtNXR/d9JgkjnghqKG1xR3pWWmP1OBFrRA6
htltu8J2Vbiv03r+pizInv6B0dga12H9Pq68gIOniGmCqhU4qllaDkaeNrSOEFq8eIXNJTHm4vXR
AYvLANSR1coauPyEqA+0Ng91RcAm9QS6DXo5bsXl7WPNzBnbqKHozgze/xANU9DV79gLROhfPrn0
KX3F8fcrgRwi0rWw2Y0oK6aD4t1HkstYAtRWrNfplZvLm7NTqncODH+NONTnU0ecQz7I4T6OjXDa
7g47fe/ZFdSALgAQe8UMKa6E6AHPF/1UT2yjS+fKb8RwlRfaTOKaPez5bNJC3yVioyxOWlujoewz
3pYhNiW+byQvRo1icBhwrgUWVTJqVr7WRq4mB/STa2GgOLctO1AZWs3CzgpyoPcbw5te9yM7A9a4
JZe/3RAK3TwQsKRaUL2uvkwEkRTjgrQ9fVbziLrl1dhP/AYAvp9xr2xwb9dLqHI5j71/jF47FSxF
35sU+VeKdtjmH/IsZ3k1IJpanmma5bWYoFMmUGFBUJreTGWluRcKpF0L1N5OVdIGhBAbg0F9sQ5K
fRaBoMM3U+eONzEVdQpTHgQcOFYOjIqpMnSNctxCadocgPcdkVAw9bg66vCRfUTpwPJFRw+XiaOv
2u8xUtpDyOeHYqi/qhndPce3xeIR96/6YMSs49u62d17nwjZ1f5mIwhC3XueA0d+RF2Iq/9YFT3R
zNtXizj7dRM5sR9RhmUSdiEeg0N9aal2awncP/d60zHgJq76l45L6FNP6fTG6AdCmp4huX0XEiHc
Pr4vs7EcyOOkelguI2WAkNhJj83eMJY7ySJK8+F6J+ujL+QgxF7kKYZNK4N4xE4gSdbsWsrHGWf1
z5E0EEeWAG6SB5EC5PKBkg8FntGPkBVWZLS0oD15qxBAa7fV2gnpnjwXHs6sVCfogXyWLKReDXG+
oZby0Aidh3DPo4BTr6ZAJs9RWkHWfWAZBnodjTBfLnql0JNx+h7rbjHpzrWLBW5iOQ6QiDwjQPOq
e+wLwpt3r5CjLhnyLK5awYLRRhZ+3wAnzt9TsylXX+P/pO2svWIt3RrERTetXHHFVqMgtrP7kU84
0sIa7/W09j3WoNI+EOSqSE9khkCuHe1rmNPv0F3xEvVm/ROAesl5SKM2RlP4JhLXRAuZBgKZL8FT
eCBGJWgOCtxGjRtQ07npotDIaYdw12h1/gRoYPF5Na1A0qWS6RSWkXdZvfpW6UlSHloOlIE0MWmm
pCywVuDln3qmcKcVa2GJ3LrNqPIrnm/szZ33KXu8OvqgC8kz0PmjfTl9zr0NCifU7Lu5rn7Jf0+N
LHezaqNRzRhqN1PFxVx3NV2qHNdhBfdHQSJh8ojK1CohEumcG7cj8eRH/A9vMsAQeds6K02UVip/
WQt5qeZzg/VIFgW7yvdZ7wFH4P0xG0DQzP2e/UypVf97408AVCxZ6lS/l7whrrjNKiw960kmDDNF
Wp1eEPKrGjf9wz3+ieVGue4/xWPVEQUofZ0ddbv1/pns/g35eWqJtQmbG53GRcfUAP5TI53yTUj4
frr1F/iU5FnXzwyFvAvzJIGpRBvcleyNLB6e0lqfyD7qYHw13sb9O6fKq834B1oNnmuA+suPiDfF
vmHWnutumBhSNp2rNhvGx2VBpKq+xO+GVUbQ3a3G8Ab27qpPNtzNHurU/l4tOqQ7ZooNd3pIbg/s
M/CbzTOqYMxgLxRTryoQwL4pEp40xnMmea40vut1J138euAAEnR+nL0AjMU8sgVYokNHNnlA27uj
WVe4rIIL+auR7XufOybcV6xgxzBK7PxLHTgalcwthcFMqYcUVR0J3ji6qXJVDhKGK8GRYUekTTKr
TjEfnIaworPCN8bBvPmPmRDWau9ZitgjxzhLPkejiSN5mvk+CsWFT5brHunxCPxi0pa8ttmNPgeB
+JzCNpxIXaLOVjy5QE5jzsnL4rx+BNuPsHqV9IOMvS+skHe1z3BwhGNTXIVfWvhsbCSVCoGqgpJs
S1jHaXbj/q3oIoDcxE/X9/xgVhHxRGOH5FUN4EiyJhPcTDBmyUTmGWhZ2zjqAo1CRnKfSsWmjV9f
hlWhVe8rvdFltQxij2PKNN1a1q2gPZreRA7Muinq0AKBptFIoMfteiYXy/sWExGuzIbLkwqYAAAO
REGalU3hD/JlMAJ/tC9IdeowduC4dfu/oaB+39yeBBP6admu5iZioBEdHUW65oXuZ3Fp5V/0WIRb
BCJX49jNQ4B5zuyCn9PH8X4kvjIfTdb/05FwBsPvCoKnqVqZBLi/7Y/+PyBP45875ig84pJ+QgEq
lOYJBgkRWRkw6OEkAARukqW0oYrSq9Zickis2SPhUe/5TL3NKhZfXXuLsz9+EqwKqHlj9DHBHBvl
qs6B4s9eEWLMUwh+75NT09AnzKJDyL9hOtvrVfFalkJxvUXr2IiJt8J2Vr11+LxSyVY2ARz6zCLG
u/LQkW7V9xVWQ7fke3fHvBXs8TyYw65lijjJzko1QYaK/rhaDRnh6pAnvowsXEOzwkHZL5aZXZdd
anfPuyer4sXmE783DnqYiHK1PzGajZy37gNonFlLmq91c3gFY8UqsPdr9TzB1RQgPDqM7Cp9qxQx
4uF2FuKxjuKCAONw3Wn7deo9/BfgiJRCI0DS7vNahmfQwBuOCOgLd8dDSXuRXxL6W4g1j8bYaNXL
WteFo7GQCD1CCyxe4TbkSQ/H6zXTUrM59FPEZnhFaeW4jI5SjmcOFJdKOEoZhdjUCd4GuJ6nKpcz
ZXPOnL/3xKGmWXkPeoZqnRweVovi80DGiuAfqbRCGp5VOrbSi4wIIap5eHecZl0qCHr+3VumX56Q
QxG5iiiHUrXfGvbY3rHTPA2fJWJgeNVb6L1Y/hdTx8iLNm3FV50dVag0biSNbADufE1epmQ+MsvX
Y3Baw17CIKK+0G0uK8IVcJje/zMai9Vedet86VaVo3dO84KZYDQm1MJKpJTn+3lhYvZAr/f6DTCd
AXXISjqOJZNHyQnXNyc4aD7neLVgmuSaLMQ7YAInKtJ52QFjxcjmpq5rKwHM48kiEQiFHlrusPFp
hIeDcbI/gog2DTW8ypjtfsBHf9Vde+HJeJQIelqCigIy2HKp33vxvcvlyQairngoUWGxuWDyg9qs
c0x1UEKHrrt+wAL3/oIEFCK0W5AFM+t7cU7iiNize6rDiykO0GA9Xk6H6dKWtlOAUgr6C5kISTNo
DWd0QAfeLEykv9XEWysievwJ+hV8njjk2vJQ1pomZVaFZBkdy6VtrwE2YL+jCeJYznQoVxqT0ASb
wk2woEaNifhnetCBVl8DyeA42HFrI+DZbsFJ+UXtcEeOKlxRtwdJSdQfYkMfNocWJTdjqcpXVxzs
oc5ithLYKD4OWSxjNSWd99gN9HYVzbibEbbwItLOmJyU/qIS3sG+eOe4kNXPf5ZL4p2G6McXq8hT
ZE5e5IFosq0vejMfAV/i79iyjNqSW9HJyEyqn7tYzerx0c443zfM6wMR3N9zcH415RxnUy9+gQcG
FfWktSofJh7VflOHm7IGEMnXyz/iAX+HZLyPbZ5NTANcCAu9shjLtYd7wl52PNpKDIG9GSbP6BLt
sUNht9p1c3Uw6xrVsXnUvUEw7x7XobnUJvpSgyKtGW934GYHPDLbvVbJEs+wjw+Zlu1FDqZJjYBM
F11RKPk/uYWsag5o/X8i3396ksWbCRJ0gfcD07u4cymkJ/wUQHZrMUDvjwK5ClmsLiIw3qwcXedx
ww3fx2xIsaVMWC3qBRUlZEO2A+FEkofyuHxUAUl620jOUtsGVdlSq2CTS6YVsf8CsPAnwxcYRGdE
T0q8joNJQIJauC+IQ7f+Z5zsJSB6MCQ9+hCSVBZ30QAEotTC+QpDLnRzTFaDWfydGw1/A57MmYbJ
+vGu9y9pBsTsHSEzvDEOagFgLrioxE6oOlKNUzCLI+Nln2adzhXCJjMt0FJCn0YAs3rEcKml6cPd
E0MxlZ8Gtwxa65vnYVuMLQzG3f3+9BBBMejem7ZYeOGoO9ixR2jifrN6IGaG4ahRRtT9dG+C3VG2
yYikIema55nKnhpHU7X9qMtUNbl7vZoq1vKf8DBkgqeJUquqMUtCJYTwRQx40I9eI0z0lQz76nTV
DDWkY+Tugb9UzlMovpcyx/RPl7XpHlFM9SVhayLR8xNMQTIdBMEoEGqE21btFBjvxP/5qchVgl2d
7mIKiHI3JNhem0MREdHfO3gtVPIiuSlQbb6M6w7YBag0nJhtOm/TkIiLpF95a8gaiGELY1KF+aGt
VJmXI7rJ3CxQ1mPvMYfvhN0dkkpkW8gxMbFGFSOruFF6+lf8XolaagDZTLhtXAuKwq0+sv3BvQEv
zMTQtLiPVMyUOMV9tNp7F4DAe6NtQk3qKJagvNg2ffLlGR+t+XvnML3OdaNSbSTPfrcEzmkAKejM
vkmN9vgxSYN6grvRgyoY+rNAUPasQQe/51e64DFVz2fyJlS5RPl4G/BsWcr4vzdvikDOrpJjhZNT
3UijoxmKFT31Z7T6KRxMYMvQwfu0pvoroIombXlBjdIRCsQdy5QrOOE2zDiT1CVCs0RmsH5t62lx
trcIcyN0qQYFidR0L9yAZKKxO3WhT0AU5H1hYNZpd3hXMTTgbqigJIrrKqxr3bQNcQ7IqKvFoHqU
Wg5xwMIpHKKpH6ii1Er1xxxL6/UQoOWLxBIn8/rb9qvZBoVnVgvfgqYMS59vsME/fznBpLbGDV78
7LOro6M6cjltUXPyIXTMyqY/XS4yEh7vxgNlUlLjNFERvbtOxw8uWaZ34DM1qDbySFsTweSzy4IF
YxJIReJIMzENRT0Glu0gbilz4m3ghuXF65v6YIEg0T4+DeadxU9gq+jx4J9WnuTDVAPBGhnYX6TJ
j/Y+ByCGTZvtPTismQHFa0lgELMNW82aVbXFt+3uK8g7GXHbTFR9JMHCJ+mUZaDX/0okMqWVvYQp
+8ggLNEvCPgTe6jxKWMvPGug80GycnjSvEgyw+ncXB9S7eQAOSPU3qnIYscPVydkyJkz3nJe2Sca
aQysfxeA4LHz3d1eGF6oyVD5M7A2Tpxjy1ZU7+cXQ7SBcugm3vPsIC2olMKss5lP6T4ApDBDoCt0
VUjzTTH4UhCwn3P2r4C33epvfzEdxK5+JhMWp4Zq0BjKn3Lqf1zoL054N/5BYOk8zqr6FslCenQa
p2WUp10fvd0kJw5Ss+ebW4NBwbT3rLnYxOjJisk6hG/EzEvNAGTmDnGl/EskaE7OM3TbizvoWQqB
1VUlJlD5VeaBYIPDyhqSHH8CCmgs+ouJ/ZjUaecKOtcEjmfP66d6wH+mBXUB5DNH9PAtcOHWhCTK
h1baZORR/TqUK0Hwn8y0YLO6RChsKUZ3DKNSxseP0Cp/1c+1xxp8tPqpnr3dBUkOmzImmNbwGj7n
HzUz+6fa3RxO3ANhzPJlhii7c19/JFYnD6uNhSuHXl+HavztfoNCQGlw1oU2B5gepSXgs5mFvt6H
tI4VFIx6T5gFF9vVGV3qcwo5hx/fhIG73UR9bY8YcHSYjMTsNl6qWGQGXtiDU4VoWWtG6VSLHWv/
hjDVAEbWL1YKd3oF6iDjOs8s/tA0shkuwbsLPqhd9Fzrd9NpmIudRZX/AlhC1+2DqVcjhAgAAWvB
F57F5z51eZ5s9m9ATBgTv98YDpcytSRMbxu1+iKTlPO9kJG/lH//E8smw5AZicWzkhMSfGMSoe57
FEt6VIry9jbeL4iHUxRj/Pk+atCEopWUj8vIZ8NEo3JARuVjVAJduaTobEK8M2c2tDdJkalVherg
DTUSVw7QCsxo/12VULAPgry4z/oAA/zfYBx84FfO0a+78kcXu3w6IW4jG7fMMGveqVzVBTALKSjr
UW8DkGlZ0iok9fjIXGVKgSTR4IDnEKgjA3LYt/k5g6559dgW5/7up9XVPZKpH+OcuHaTAGbnjBKg
olrsQTMdvLJ8P4rHWdx9GMiJ81jGlfzpu9LEoMiN1QfF0brHKHgaSSimSupPBr45kWjjQ3WpK6ZP
MJybcdSgEPL7lDrmisLxVkt7uSZgxU/sdU2EK8nLh38ceVpxkzUzBBQaMANklaAnZxW5edQPjdrU
RvjmdP99RofJ7aQxA55KZnazXicDl42/f3NALv7hkvsHbNjJgWY/GiGhSIvwtlP5zcXAWze4Qwca
ePMRkVyDa6iDWkQYNATsLw1SEfAn4jYhpYm30+zh4t58tcJBtpodCcLFLT4mK5zWeQ/A0txTQJhG
qwueofXPZ9Z0VV5O2aLXh3WWZHtlBK5h+0fGH68uDtMlSvrgvZW3v22wHnIyQut0lIUe9VX9RoM2
DXH9fkQEeJ2oSNbQIjiV8y+Luni3etcF7h/UAHteDMGFhChAWoaYx3XeH5Jqm4yjg8q0Y3MCK7Y/
Xn6z/awHQ29OLMIEnhkkCvE32r21lEG2n9qN0xdGTmLXIZEHbPNhqLRuvX0fbPKyxOX3yCZGJk9e
azL2aHcSp30RBQxlmRWmXYOnQ83vtnpDi1KpzPdpzqk/lecpMsaGEqXfbzFUxiGp9Oh2Axw0awyK
jSyRlFokxOAQTK5geUlNW1m5mA+yPsD5Vki7Sr8BWhNk1sp28hKFOAgEnWsfrwyITXMKdA6MwZ0F
2TtfbWIJjHmQUtPxTuqo+c4nZcyyoH3JbJu7YGbkh0NV9lC7bR7utCHQqrrFLBTLNTIQzpB8ovnl
r+r7FlIVb6gX4U5EyLlmx4t926iwbxyXL9u/mkUCbCfbP+8Vs0S3cnYXendCJxwJcxr6a4bPj559
VO/holihGuIeylRTOav8HpVUeeKDKYv2Vbsn93b7V//2+IWyRxI0oQKyZu7w8YEhnutimGTGZu2y
loBQo2WkQ/P6IGYesAOWv80weRFJDuc9ljqSXBgECAWd6RnGwu/cmQSiHF93pjpq1jRRwgCX6paw
vxo54jIr9xWp7fHkAY3/ozAIewG9D6KSEeqLLfj+/fhrLdsvGCDuxQ7ODuaTgyuHZvmB5UhTbX4w
wpp9ZyEAAAI0QZq2TeEP8mUwA/+LbZ+vC8BihaCHbsb51l5P+avmHIBO8LHYAVeAmmVi/pAlWsqD
T9rXmza3Kr+QeaUeoflyqb/7VodpEbaevZHdQ+9HOTonJ/ASsn45F9A5Mp9zAUyD/8nN8rYzswRK
8BUiU4b9JNmkjWmWISaRso7UkDREoW7g+/R3t1yUs8zxzmSe54ieC3IH9MqwsgPCsJkEno9jQQNa
yFF64O6hnWXpJOAzMKsr+XdRLTszXdrgYxKEC19EJUH6lVc8j+AJkDAuTMz8MAiA/GOiil/t22uL
r4RE2YMi1NSUGMVrIACiiJmJdLeKd8Z/VN17AC+sACpDCt8xY2UKfddj1nqVII/BfpXspacNR2Ev
pfNwkHAgyPOqdD2/RxOXPXSIBDtDe/euFJIzWdDN+Hc6xXoYZljO7+ATVXODbzFeLnoSxGhcqA1b
5qqOvW/w933A5sQ/T9npoH2CsETeBtpFWAFmEpf8td1FV6y22Ih5dwf7DKhHiDLMim9cKAAKr9f/
hAGodBrB9iFvELlt+jXOF0JDtSwmsGd/ZyvHmMO1WXNBNrNwuADcGX3Tyb23UMjxjKxE1D6JH16A
wrUEba3s9K5GClPgiPMkHzR+O0pJ4vVyYzk3Wl379D2WN0RgazzW6AE6l7uxQVxkxIjf+BAGemOb
xwOvq585RYSuwPjxAK9rgMUF3k9UuvdF6h/KmLkJScgSqAotziBUYXH0Sg05RcIxY97vS1R/UHmG
Js5oAAAlBEGa2U3hD/JlMAI3/2G9l5pJlM+6nb56VlsB8eDWkYJcoAs0Yy3jGomc7tbaI24GMm4W
MIb0yMWcA2QaA73SqAoEP34aec6xNjKRUh5rfeg7pGw2IMEgwFaokWNv0nB+h40Y+Wr/OuSMUDwp
gZcojvdTpqEtkkj2ybevau+EjizDWSyBX6CT44XG3Ao2EpBnKF95dr2B0XCABIc6p5Avpth+UCXk
+TMG/7UpsuUhkuLNLzuJ8/L/k6XEVa6ukT31OWpjoCzr5MsFGyLAK04EwvlPjesgtHVzPlPB3oix
OloZeflhomvjf1LuGA4/vFxNaI4aXtW8eov2vktcnW/KjsBUePKXDx2l3YAH9j7iScAKLMmIeovn
QL0BWaOw007m2J7sfYoRJGDdMeloB79rfNGPU1wkVrjWfpwWO+UOHdXn71fl8es7qD/5ppSefamO
ltZsfS+m/5YdSjD0co4RPf2V8u+r2xdsNp3ANtPf1eWggGuc2Wgfq9Pw7Kp46PY6OPptm1c3+YxR
kbvRC1CduX6w148gGa9NZmoOF+uAdsiMCyvAuHdzXGNiRu89svgTo5/XZCBKcthPaGUxqOPz5N8o
KhvXRom9Am59YItIusKeQGJvzamJYvkQ31iFemmGo+dcWM0/jTUZzD20CoUWut8onroheeVilfCU
y0pvhpEdYkU1gAjZfggQ9O3znNqMVftllV6QnPguDRpj8OK6qTbsraZWbNA3D7x3j3COlwzqUr7O
hiyewmwOY5XMNoJngVsCXBbdRTneU1UMLrGwKS/78Y0sflMTn06TtdPZgUtQYN2QuU6BuuY/LVew
dYN5P1WzwokSAqiyd3t5xa20ivETLjJsYal9CgQ5PCgZRBjwdyXfoI/gkrYuVFRWKNNkxMUoqehg
87W8gazeNROZ999fxfN06nrnImIDFnyK7Y0GS7ArOUXJ8BrrhdN6cqyQXVLNlW9GbWjrWulCsXGK
2/W8w7CcUd8cNU3izriw9LQR5wHa/CElnnOE/v55Wy+PMSb6B75g1QmhnYXW71Q5P46o+YoJgq7r
SsgoEavmQJslA/7RGbVzousWozDC2hs9JIh+24uBBXbfPN6/LOyFWP6SnzuOAO2owmV+8VyBc6zY
PkiAyQIkRVdOmZHTHxO4EpA+65TtTLl/YSwt+8P/z/j6onvXBtowK2KASIhLijoyUMJdisZkwB4X
nsYAXsw/yk4ds3mJ4RNm1eeV2nqiANzoNkUPopwbpBVT6jPB/3kBCXS+250jboyE6R1peYq0oOyS
p5ZLWlufWRfAbJaK+U9jN1tyCpay+xsE8p9xKs5zfPudt5wFYwJW3wITLDPnRz0sPmvSsYZupmzr
he8YbdlEXJ79AsEobom6FY8IO3NiVGMpcEKw0peyoXwIxK+Ze7AcpHUcQrBBX/jAwH5pxtyaMT62
7wvGlwPT71XI5TgTJfmPJ8J1kTYT+dTCq6q+InbMP6K5fuPGykMGI71lBhgTM6GcAVZP5w3f4nvM
0wi6fMJX15uNIPo5HMLBAPatdEw2wMWrYSa4MrDWUTpsT6otQV52RKyn2MPOgVpUldfLCX8dgoIk
iTkzRz1PqIzuiuinDMaVf4fHnroAIjsfQBhYloke5tBqxn804vCRXK1nYbNCGPUnymMttNiENBHW
gua4xXPT3+Tmo8uEb14+wgd7Rszp+KVe6bdRFp6f/cp8kss3wy+jRACtczg9EK3EsembTZrrRAv1
3M36W0YpSmMFKtlnXTN0uIqioX2VTFDtr3ePGrIgYbxY1s3bm4qNzIuTqAt/mdc8UDsU4uWDkJuI
12P0VamxH2GcyAfqyn7EpvhQR5xeYvXbFwzK2G6CuqqdCnGWFeGniAnCjCrrrOXtlyIbIgPj6bR2
ttS/25/INqofX0MHVQAgvenGW5QJsa70dsUhESEdPU4qNOaQ5z9ArKPLR4H+yGLS7eHP+Cuap/sl
96Mi8lrcF1lnvllfqYafzsylAOxTWvxgO9xef3JLVEPyhiQrXfHdxJ9xGJr23ndp9L3ifvNxzWg3
J21mBJ5BO6+Yw8zI5IwlWiMkHVwhmtikzL3elhGTMa/fffbiJcgV8qNBd51G5jlGIWewwoCqbOrU
3STu0KDuB4rOKm46aBnzPfJxgbn/Tq/rYWPyrpyOVr9fdWbj+bdAZhcFI51J2MuaTfxIe24RFXv5
QzKplkNtAnzxK5gL1pRFK7HmdUZmZUfXYdeM6pqjQrJ91kakOORaHdLbF9E/HiKtjgA0xi2njrfS
qFIcP2+VJX49CWVQjBErN2qh4pbiuU45HvaxBJDu5/QUK/IkMAFQ5G6ey7eykQJ4KVwZ87kPf1jE
cKpSmrmZsybWHpbEsRtTl8zSDNQgsw3PRpj5VZESiOK8/4v6+fznrnYSGLachE0IyAK3bgws61bY
gzjwsRTUfSbGSNC6ZlRJDALSUVltU1RlTjJx3KywTFIC8qz1S+yHw1+YxdM68w0hv9HXweWWWP/R
OdzcvclTzHVgBUbfeWpNXRtqVWqWeXPYumJ6oBcvqOjGQJ7977+Kj1jOnIDffhaPlYc71rfnubE1
QAVGmZ+RG3GUk7ZK8QuZWNLSUwP7c3yQmNTMRHnCBI597hz5rqJEu6/pMI4Yu4j2Dxh0BQtFwck+
k9zBEhEYx9YeTt4XTT9fkNualBPeE1tOu9FHC7nSIStEYyUk9xQ5UCCIxhB2ATtpMFb3u+qCbAhA
RyD+oSO8fqdnkjyRl8uVhmJEajhI32FI1+wRkyH1q0DAcdFbIefmunxPwI2ao6hV276qjExGfmhX
F4+jcswmXJfH3sWPJBtnVKHcLlSDenCG1F32IcoI0T7Mbgs3cSwTMHgNnTdCjRWoV2uHded+JszX
QJINDelE+a3fsy3UQC5FRr10rlihMWgMTyWpn0bxkhUNpExah+yCjt9zmmy17OsarUHH4+yvQJYX
7TU9N3ZAJS1JK9hvfvc7Obpe6exmlMHY1SEHY8HSRwFf+xrJNHtLmSL+MlvSDoBzEvkXpz50/JPp
2TSt+38UrpLT0MZxtmg8/liDkWIeByz5jrxyeFMnsCSvNTyat3OPTIUJGxZcG+G9itABZSLobjnd
p1rGNFsJDl/+lpwPvW13Ny6Gf5w2RcIZPMUZhgMrC0oH/CiiGMbvOcTcfPCOoOP+AHkTGaGkEaur
xrjUQnvq8ag2m3t+k5ytXhlRy8BKFfM+bFVsEl/2pJZO2n7dzcus7n7fqo6ytdanr+6jS07RD85+
I8WHPiYjVjIKjp9PFxHE/mNc5vimPm/KNUpafCNLFfM3i5TkEAp7dL7jhEFmcgEaB7945OSHjXOU
Zda8EqkxODUQXi2q/cnn1yD7PDft9AHNxGoisV1DHltZKrGU3lhI2x70MEAYzpl5Onb4S7UfOzJt
J7vJOHO+PtjuXMh7ueoQYFy0IfBmDe/9NmEixJsIuHmYrS//+JjH9terZycwaZL8LkeiFl5802uy
G9eV7aQFroydobvZdAt4YX9xAjZ2TjRaAIByP1BJOdIwxZzk6YdRJVAe3MwyoGUV6LMdyIlSTSl2
2SZ5FD9lIPIOP/SzE13ssogvCN/3oWBA+N3f0TRHBRnkEqhdDXGXm9hyqxRu1Le0Jnvx7yplInPn
N/BJRk/WsZaR0wr1JFal0dKPZornn3tssQrxytuetbPuIl7SKDOe4NwoAY4Ncb3xPfgU66c7b9R/
0hF1uRXSeQXzhCw3YK7ZvZsFDZa6EF8IWP/posd9MHtDQzHu0dbfJve9i23SKcJuA1Zdz3qM4m4+
qZA/JaPKxR+jLFsWNJBn73D2jMtfOzUr50OrQakPy9E9I+4ZP79Ng40ZEUmG6erQlNSf0M/yGUR1
QRWT89frFofLGP+UQt9gm1Y/aT7S7kN2N8X6J89m3NN3bn0splw6/hZMLpeH+ptB2ECYjjxgSsLw
HWzvklxouA0TfLZTNLwizH4afMHio5tymRa0iSx7odYQN0Zz3PUOmUlljkjlofxbQyBwGZxwFwh1
sjgOyAeGvtfDsbumbtR3/DmDD6y6u66jPs9XaYDv19IHeZyLQJvQLvjuGeQSltVPnbTBixwGcHE2
QQP0V8DzwaTgZ04ea7Kz6WW0D4SpFBDvAKvH9fL6XLf0FkP0YMnEyYQ3TOkeRU9o8a0dg66LU2ts
WtXYsRzd9cUR0owJSYNtGuaLYAETBGNwDv2kF9hEzo8YMZvB/Kwl9oVER9B8nSUTXKLstnUCsl1P
+rpgtRkhhtMrEsPy/ToFswEGW+9E89mr/ri3q62/uQc62zf1qOlrcKXi2kFm6+Hq6yOfJYX2VWHy
VjEiVWkAN3h0dhfZPOeUPUgBAVV9EalkvFslDVdZ8k/X7PaZ255fJaTtn8QWd8s4qO9VJvieUSfL
AGleV4vCvd/MiseqOdMtSLIJXFiZnMBt3RKakZ15jXIk5VAUkEi5z9PiiG1hqs4Cg+aS3VPKci9G
MUf4V/oUvEgpdunh7ArdO5l2eEqPYwDz2Vb+CSdy8j8HCR6c8Jyo5l78NOpwzm5XQWEDpbqxvcOr
sS5VC7pAfhv5nLwgTS5nios861L4mAf5jDuAEePxYDl0qe3q+bZJdBca3e8xvs+lHGmMEJechFum
4mfznBY9l8FHH5sPVn/p89GK8wq7J2FoMMdt+LkNXI6GKmYWpfE5qFOMmSuOmL++GVh7nWUteonF
+NaE9wLCTB+RdfGxkVPjDPLyM7xK2RAT08ou8uLdwZUSVtj+XLn06HtqeULka9ypKZAzXzE+R+w2
SQDri2PMyiHOodGKwrMbIxpEOEvVc0veludJ0bPmB/kB9mEygdH2PXK6mZwehuKuIwmh9vSAmJsF
TycipUfVFI3qXASbMJOjz+IkYH4xl4KNHkGPZXU+dFi1fdjMA4cZe4uIvM3vYD6w2/UQbdEOY/HD
Bh47qm2fDHMt7EMq9ezianzUCL7pX8RkQsiEvA7YnYzxAkeUkKgU0Fsz9iFXIdAvrXIQbBCmSTN5
Qfo1og5ei3y+XBrTmyZkcJXqfU96Tv1BlSqv/E9yvI2LVRMepwWLPQsPlpGuM5US6V/syd4FBlNL
qjCUpRK951m4F2+6Zt8dzNyxxpWAkCHI5xQM7eWpdMLhJ1OAMBRUcSUT2B+Rgo6VaPAqWlpN4lDr
/uMlfzMTV5gaSt0Luk33xlCldRhGb0vqaC0JIruG9WFMrQVbzC1WbZ0Jm25DRpHFudeP5eihRxHC
bbbAA7cCkgoNfiQqErvuevL9bsikeQO/udkGHU8qK32+Z+50PY1or7rjgl6DMqhp6G9vP4s9gHap
hGIdYJh8l99TtfhJmgebIZ7r6Yyyu3oGrwbnn4mW3R8Egj+bDLS/TaZKQGnrAWAnFeECEa43Bc+6
f7Zp2Os18uU0nms9+BodqtVM9BFxPohkJbTSuV/IYuYTIKYxFzLXTiMZe7ZpDoasbNCxs3e0N77L
sY01P22kI1SuoVZ8kmukvvTm321bz5SRvmFYSwo3QLePCPkjjq1Gsx8HNaU9yU1snHZLiUaVrn9b
2eMfwdOipHKBjZa+jBeM6VAA5Gg8nwxS+69GnsIpSc5LjV0EPltmKVldJnZNDFVri6/kb6oSVD72
Ti8iY0QqurZEk9xJjVI3Jtrz/lYrbL1v5nl3rZwLOivHw/Vj6MIYT4yCRQiazwO7Vafs9+l64uKz
s3o6CFvewHMJl1etoZjW1R4icSEM73aYxDpneYduGC1+b4+R8HF083+d5dqKJx2p3LimXaHeLvoW
JsfuZ+C+8bmon8YPZPrNnvCqMIWrfKSkLLOjiNLE7oaFpu/Eam2deS29LcDTbFcY/1DS34p4K8Cm
gewuuGtGuzokFpqEFTsiO98rVHjnzCcDj4/olpZE2Bgp5JRu1AVrM94RdUTBFTZWJD/nDQqa0rNm
64Z3YsD9CZrJZYOphAHiqPjkI0KNrwj2/yrehJqTYlBbN31sgk3cz/OraX1e6ANxyLDA0+9Md9g9
bDd3Zu+7tnfcYEUuXhUoxo2LhQg0paWq5NHZMKW0AUYMSI3bByHv/bWGG5lyQtJAfOfm9BK7pCf9
0+cXwRBj/UftfVFSNzRQdP4fbcw2SWU2SKRDaEg402hnUhZ8kHm8d1tULBbJ4f5lwYX/ggFyNlk6
XrIOzX51xTlbis7b64YCcQgS8/F5XYXbCuHalpMP26n21Ag88/ZjaXqTXePuBERzUUVMTdWZWepP
XnbyWcdHkeLpO5WEPRQk52FNZS2gb87+GEhtxp+QH1rLhKdOS2OnrJ3Bsi+DhmBSjnT3dgN77h/E
siBOZxU6aNkGOKFklRXYrsVrWgM6O/d3HBeXgNdV7FsPiA2VOacICMGYG/XZVEh/RRB1BJdCWqIe
fVw2fd/iqsdW9Ie68qoffubOtObxPXF3WDpi0D2PdhqMFcHChtTtNgFHpRiqakszTMma9JxQ+deD
0/Y2/16fJuglQhxn2mPS748TcszZASe7DihGo7pgg10SJiw6Kl6b5xW5lfJSsiM06b9jhQ6LFtVi
zHdnKTut8uj2gT0BeEkzybH2jXTxMofii4pGTd+aDVUcxdseFjs1AzkuuQyux64IwQRKgkhW0A14
BATI+x335fVII8frPGvWgs0aE3F6dZGP21UrupBImOwoR1BW7N7WV9L3jGDUMaHqXPWlWevnS3Sn
XRR0NIzrwyFUGM5ZaQHW67/8mpvTqWLXiUIqjV8MR7/50iohG6k31hUi8Z+Mz0zrLrXZv/eVpm+U
ZCAyXuY9bDb/cFqsk/tJb6OXgeEWRJIzBVeNFp/LNhrwXYlTszHmUmBIjpDYG/H6XIFsG2GqCh/k
XTd+8RV1nxNgen7WzeHlh5rW3tX6LG5S5BYkrZOR5nchJ6ct6W+XzYcb6PoaZNonpOHjo24eTz7E
/QHCLTAu/Gm+MzouShD4/0jolTGUjI7YW/0JphfcEWMD3Wam0mauwTqE3ZxU96ypyGB/bjmMBf3H
AlFlsD304EBeuFgkCqkD5sScIQb5gA8cQpNVqKTvvVnER4+XADClmUCIxfoRFxNaAzKqdQb+xnpd
iECWIX0oHlfmXtQbU3HRPKQEVqNIOoY5+HUNHIgvoNP2Ta7rZhrdqigvryxSlaGMs2m2OKn80RwW
6dNiwSHaxZDHjjpLty5p2XfFYeJjyUQgKyjfP/IVYH3/1JHfCKfTQkGtcNwsoBkNyrROyAg8lnPI
MileNyVnnWt7ZS35099XbCBuV2sADRmcq9wLQevcHfU+uxJYj1gLyuEY3ytZvFtdyAVg+464QT7z
GnVmOyri6zOD1y3FrE1dNTjB3zLP0xEhM3ZuOvh+iTWvmvZof8Mi4bQ+jt0uwiAqqRY0QS1UsGUW
WDZpoq8BhfEq8plg0ts2jdh3mmWgyQRx2fNkPHkr2wV/ZRPEAxipTq5MabBNFaGCLghfdz3LMgjJ
kcVzHLlvorAgTBii9tM1hkvcotisUe97hVQNFfd+6zaAZmsipmo9Xb0ZB6WffQ/2Lw2o5FqrwDRl
rDJ1esDAWOmB8klXZoizF6Wm3Lrw5QXJJoJ0jfOT30zxUHsuPQBHHwNiD6+T8EX6v/LGsaSF9mrC
8a8RXEulE1TbIqrJDFRmVqwq3paXZ3O0Db6davkd6/rSAigftnYiTmxz53pF/GPPmBu8i4NxAfTB
aL32dz+D7BkRsIwJYbdrEVkFPywgcjrjwfWclf82qAUajWYaJI91dYekkdPibwWzmoxgTEMUCudS
E1uXU7kepyxLR6MtUqu2/drR90YDsK7EYaIpx+WZx0OS32/5DrJgYk1wKLoKbJQPEyHBD2TwYYyL
gNu0c0+AII9WVW52IVUWqNdot1u9xrbnX5CAwDn682nAQ/mcY0Cg1SZWtwHc6szsvQmGiBxD0BFd
jjmeHHNsXQUjbD4QD4y9x8GESISKZAZSP5GEG0BuDryjqigdGN9rxSt5HOkgDfDlU0a1oTnEcZjg
6StgE7sR2TsyXtchMPPohJfUA9pBeq2vJ4NCfG5Ud43t52eBcDoAebncSAz+1FlBufBdRlN+qazK
WIDzG9K/alvQY39sogDhvvpoU67aXJjqOEadgnZUKerfswCOp3KvAYlyJzJdy0hZZ1wDf6Sh4GIi
ov1akLOgBViO8w8W1MqQ4mR3ZPzzpru/1+UES5P3gvBY42BOwN287dJcgMv1r4pOQxmkrSaexau7
mkMwi6w0Kc8rwyoOVVJZ+hJCTPVe+fiQ7YLZ8cIzX2am2uf3HfYO3PGZZz2kyIrWgxDSdi7xkhKM
wmtJ6oc4mam1z95sVEp/CJpt4frxi+Mph6BBTxGVYznEtGUUYuZKahnFEU0IcGeNr0egRjPtxU9g
yYY2Mt9Y6K6GMSLJ4GQKG+VeTsd721NSf/wm5atkRUi83f19jVPUiiUXkqZdWflrzhbI7dDZ5YhE
n/CpzWw6J5DMD+S2HJ1+iXf71c0x8op+5eV6G9p6z1/YUL7720ddCKGZ3OHk+1p9MY7AhL+FE8G7
bEWMjjrs5zspVGkiRe9Rrvs70J9mY0UVB4089AiaQMaGawf6hm1sl/zm/0abjLNCeKzKknHxOdBG
9W0u8RPkCLhJPoCzOVuJoQTSy59uTDdJ0tucqAl2gKV17IueGGXE/bFsOcDKx0x7nhdeSflaghXS
DhmQ/+WLMx9e42dmPNYM6XUiMYu56VV9lfrAQ6F+mJ3YsN9H42x/Qu5OVCOsltcrdYsIK4KgLARn
zbSUQwBE7KwyimDMnvCb9S48ri7+QR7O96lwJSJSPrkVVOQIRXUOg7B0vOKG2aGCEwOsXQFCwpRm
RFxr8AHVL+CpTBwEoye366YROU9W373EM9JXEw0vQ3FCy2Lzw3QV9HilP71Z+o+sYIeFXtnEhy8K
GHztMjyeu3Ob98XGdP584wPaA0wANZpIDBk6pKVaVZumtX+FyQ4bcUvnmtVlkrZ68Jkn6RNt9D0E
y/f4CajxRixZ7NRGa4RS24bEv+pBd2/eSPAsdX8iD2j2xDfOWo50IvJ34NItUvWKnmHgcWUUux1Y
fvTMO3PWSBG/K97b5FxX/EnmMOazLt3e3WapOrmjmbKOskFNENvDg6dN41BF/3QOwyEgMMksx6cT
EWP/mYa5av4Ax3u7p6jaDkmZLfV4wE084/aA4oQ/qrBOdn/E+P0NweTnMZiJppoMWQiUp7LfwmwR
jmAJCVbR2MV0qW/3JUvUrEAjimKihvUMsuj7N0ABeqlfWJR8/odm9qSvibWak9SGm0rR+MCUx2gU
gTkSykgj388j5SDEhIWo9ej4I78LvRLLZrwHZywWznxN7sV7BLqOqzLWCFjxG9rJP7zMux4XTRJN
QDAhLK1hyqmpIQft99aSdSM+gTM6Fux2ii78/rH/lXgO98i1LFTJuVBHWVoRXvr+w0+FwKLwA7iN
h6N5HKwPAp9p4hsEOMAhWK8putTXmqEmeTLNbybljn/CMKy0127g4gdivS3UPp7bYxh2s8YbZfyv
5BaGrOyF/MZHp7Paz0VqlZPiAJGzpw/SSYF1Mo3e0sG+fd9E8n5ZiCB4romHbJrNhjZkBYXDPDbT
2ywwOOVNpwYCgFl7JZRXUdN/+glFrTzZHR66GOhvvE6lKRG/1aozbM6Dxaba40bLOLR42tIsD5FP
KtR52AET48w7Rv++EIWnNcL0We3QwIroGmunYDlHuqyjJ3vVCU6YCq9a1HEHg+mSLpoZ2Q1mkyY0
0GC/BPhPDFX1MJcOysrzwKK8vTUQyT5tElt5DqF3q3HKDidKb+TMkQ8iB63MzWJxrMw4mgO5cthl
jXyCGh3siDx85vtO0BgQTE74d2Yn/qwSv9X6yBR9Ni4oozzLfHhF7MiWQ8E+3oInb2YmfaUSDwCg
4/2l0wlP3z4xRiv/Al17uwvpB+e95St4U49LXBeLBxfXrdltuaksbbRU4gWKIvOkM5c9Wn+BNQnY
OVe1tcRP4b/yyxEAaRjdnR1wvgUVB3AjLSLudwt/uly8Gdw77tyPwU/tZ84AX5AkYH6CiECou7Mj
g5lty7FFCVpXY5ErQOho52T7JCOiQUd1wkFTtQ8us225gh7W09jL4JowFvmvL7Vr4ALGAUvVrNYh
GbMEwXsVfI4XUqu902lA6ZPkmYzNA8/MDgg5hj20d0VeNkp285eEaLGuWpsClK7EmV4I2GKaclxF
/6+qGt/b8cY8a0ncgjikp6osPtaVjjcgkyTgaqlP1CfnQz9EqmM5RwvtJ1kaLoYP2DSRreyg4N8R
30lZV+RLRyzYI0PRK/+Lea7GflT/AtQmxnTPcX5GwPRSefiD2pWKq/P9X8P8P6Cf+mGDoviEEuka
ecVn0beN5b58k8ChoeS/8gmhRLOcZLhoxov0q5cv20UuzpSDwZW/1qeUk8ehnasrefj8C9WbgYzp
20UD5llm8ySgC2OAF2fX18P4u3cSaJtaKz20ektO7tBFTx13EgARMCEaAdq9WBLHMK5V6iQqTMkv
KcnRwbMo+EboTuBJ/QT0SZ7dsMCGOeNdikN1Qjq6/u6220LGwKTtmCFivFCBMLJlyV/SRFCDjDXi
+66i9AmKcfTPybhqrEbiKmc9htmG4MrF/tgIEY9UR4oEQfJ1G6Xa3AdonCRWxK92IrdH7scQTQHf
bSIqj4+j2hcVQ0XmfPVNfIwHsGgW31SIdiipwgEIe6tDr+vWdbqUZXojtJr0Pfr3JBl5mUAYwtoJ
ACo7+gWlduISngKNFgxP6MNmeMqWniZ4d3+K0oYvqDCtrIOn2BYyaS8KvyUxBr6MtVGRbRoAoaJW
MnvVROMksfPnp4wUOoG215bkrXYJZdkTeOigQVpQa7rYbXh+jcBsR/zGUIkjaiarFzpsp8NbYFvA
w24cFrNG7I9yb0X8H6ip1OZua8rX2qW63zJKsxgq/BzRmD5VzAg2457BDoHZ6xKGf/b6uvn18MyG
bgDDUy1RBG5mf6f14iQM121dpckVO28SfZBieJOZDGARVrzChA2yDFQNs0sJIeoUhNIWX/QIg2yW
c8A98AWfzroBEdWCNdFUSxz3e5lXvVeDTJxEFnpPyd4EcewZ+ZZC4nWLTeUad2ZJLlFVEP6gTMz+
gqsiKnPsKFtA+Qk8VtYBbOSEZia2AIMN+ze0i1SinV88DtASm+E+2eMw+ZUFT63OCImPu1Gy/zFR
1tmnL1xOtH4psKXx2+0tS0Ftf3WSL/yxIQeOQN+ESAv/Bb1zrtDIlG9iqVaHEy0Ezg0dBlJgUARq
WrdDsJ2hcSeaA2zzrhbfSRV7YEFajw7Ik7KqONiJWS8Jq8xpqs+JKEqBEVhAy4kkiD36kw50EN8M
N/shNx1FHVdDCkzQ7BDhtvptuLQPYj+UXuJqyHCKV3KxH5kwkke3lIClK1Dq1iuj1L1gxPHwHLdh
7lspcuRwyZwX6bXMjXzxGi96YLWY7TanK2dVKb7cdViEc9a6ikcPgIQbmMbp1PCzUXQR3ZVcGG4V
Oq5jYE0djWtu3KAiToLVwEIjHtWYgsD5VD9G7KCWyAn6uVWDIIABNnVgh1r74aa5BhhVxTI2JbmK
P4LpNAQhTCR1EFa1/cdvLOjFUExL0/nm0sgPzwInP6XvRoVd+bEkDa905OPupkRSYlQqRtpHjR6H
7227R7zSNZiIotxjS/NDbc2gl3ANwP1mh+UrixonQK3e3GMNBhldW5REbcbH7vFAxz0BWgXN6UB3
Qv9DTV8JGjdpAVPM3OwQ/2yXtk6Of1n7l62OLHvTlcMQBZXUyuIxFE+fank2yU4NhaK5mZQYQcF4
UOjqATSe0kFe6dottDBZqkA8jeacP/vDLxDgKkBWnWp3/gjdeaskSi35ObTplXQAPq1EKuk14f1g
LQpNJm+nxeZH89cEtf/h8PbUHDDtUhcXWe0O+7cgd1pt4RyW9E1r9Srt5J0ftkkgEVlEV8qrY9Xq
iYCKUrKv5ARL4gRKA7aB5ysrRQzWZlriGnTMMTcW6DrHGx5aLhrP+ykwreez4YHpboj0zwPD/o4N
Ia0mijCzyL1QTAH6uJAfsKtQhS3sb3sdCpwRopNQTr2q7pwkB2qS9W6JhGoj62cT5loaE53+vSgw
PQ17TGoS6nBrbAlqdapA4znUa81aZPdY6g/oaHbjnLFiD9kVEUIWChi0l4gn8YATh9Fxd7vRppBU
uSBvefqKIajwdnIrxby0UoXgSbOj9jqNWCl61jqZbfA3hWDuvaTsEWjuOdWwUoZpo7NODcEMlNta
vEeoa5lAWhfOILG6TuBtoIx80lUc+gQdiSjpIzBu91NKwy9aNo7Y0WNEI2x+3MDX16i/o5WjsDD3
n9uc21fkSGxISq6oZmqU+1LQrHPW6VkmdR4CT0dnOHJmr9jzymVRpTjFITpFLq5E2B8XALhJvFA0
OD898/g/RWlTwvR6tkKOAshmnz0pUL3uSKGzw7DxWVXaNlqtHwDGhgndn2VoYiE4G2gaS0K06WEs
zMq+lGPnaBZn9Mv2RpOlDPBdvbNx0d122nc8nCFHxengenhTckHTd8NSz8SKm4sOkJme/BpgfyIk
N1k6BJhW8nCoK5Qdq/S792b+SMTVcygsCsqPVMnEfs7Kq7j+KY3j/H+wi6leaZQ7dPRTZtaraJLv
L3ZjFxXKDchk8heuNW1zAKVkABdhISqPsc/f8/9JcIQ5wIIQMH4RUiBQFEH+AuVvWI30Fmw8VVsH
fHXsddegmH7G4p+p4IDh+HTnQX66242Ye4ZqmmnhfCeF8IAde6/JFz5Qi7QESn3r70fSJl4N9pl6
2iU/keLEzs2Bu/D8fwd+n4/pLlUbonXaCcoIiDsIiMcG6asBUZ1fCtEg73Ksz7T2WN4eyi8H2s4t
9vU+18/D3NVOzIGi2cKLF1vjKYAAKFGI7XClIwTEBBCAxCAg/eYm9LOUBe6Ef4+4xArn+9O3D9jT
xA78DYkeIMdhPYW3hk86m0x4vrzjPXmaptvdLBcXbUS3teNizSJ4+Ljfrip9xw97S53en1tAh+6s
WslsCgy4sVPKgw8T5JT0eZoc7cT/YqUgnMD2TdAPj693XlSAKxcn6V5qLirXy3HRRF8Kk0lH9zJN
k1tPlwACAKFOIUzS+YbYfcfIRFuaEuuwl12EvkIIKx9d7VdBrGBfERSnSlOhG+yg7Fb0aDlUDDwI
voO2+hZjzFtm2ch5CGYcwfNvpX0n0gf974gPkPkT6f6cAH90Py72R+WfEHsvy0I6iBRcAnoOQE9Q
jYgeEDwgcK0hOT/P+iThw7GR4QPC9fD7p9vlAP7u18z+wEM9WJc8WRgAooFogJoATXWyuv/HJhfa
P732j7f3Ah4S+JxDDWMD8vkeXlwEv/ThZVAl9B4Qv+bbMgzyCSkhgI3Dbb/1zF7vZU1AP8dsDbP+
9XaN0D/sAAAAH7IAEpRM2pToJZA2gNpyEsurbsHdlBT+Ub2t5e/I+B2C+EUp0pTpuImrh2/m/sdw
tvT7Y0+29AzEAch9C2wPrn0oB/vAfa+6fa+6+5/7PP5TzeQDkPoW2/48cAH4+WQ5D/htoZ2JnYlp
ED/0H/2YfFswSV/3/7f9v+4PIZg9CH92YNtDjpP5ADTn3Pun2vuoBQbKAKQhs932zkGYNsCtGBWx
ZQLRZpZVWwdtzCAf8n4g+IPiD7L33yJ8jyF6j/f89/ABTWtx2hwgKyMEQgsB/hIFIFfi8MEWYate
7dGQoQOGHZFjXoSPEpXIds/wDTtB5D/kAAPtj7v3dPtgNBDkH+bhChmPMOYqIB14OvhRIPQ/dP8c
wf5aALwgNj+F44C0wUWDbQDkG2Btnu/+OYP8PQK0Ltv/+AAADL+c24sI2vSkwemTxGCrTs2vqv2N
YWI8TllICyyhvzfj5I616RxbLkR1pt/SHxvflW9uaffG2avsi6Pl/yczQxyZXhYAJcBWdz2NxWIB
UJhUEGABbAD93LofnuFn/9vz34/4xItHAIYZi2zjhdOAA/9w/v9Y9d5/KAMxbb7qTlQ6DLtocg91
/z+7eh5OLQTKAYH9g/sP7gDMYcg233bbP+v+IAAAEUUUTphstb9w6vLMlNrWXT1nKbDq2uPtURRN
DAAszt3rp30UrvngrvB6HAFuHa+RzixnhqwzcunAaHAhGo/t/ff4ATlrAdpAUjsICMIKIGrM0B4f
ziD+D/P9TwQRIuHJzuokQ4OXQy6HHBIgqIrcIEA0EmgAAGYPduELtgByEADwlpyKLB1/woZNZ/kz
BtvIPduOQ8AL6BmPhC8gIWJWAM/w23MRIrKIAAAHhe/9OtvQJlF3+SFF4SLw96PvQAAKKBlb4h8Q
PiAfNj5s+b+afSP7AGxQtMGxPCB1/wnXw8IAfy3e7gSoCsICsgCsgCswDcICsJiBQBMB54ByEgVh
N7CGYV6GAf9f8AAPdf8m2AHIdi9fAA/7/nP9uOMoPDAHIP+noe2f9P+v+PoMzI0ENO07/f85bGgg
GgeF6/aYPC7FosBMANiz4DBjT+D6nfwAB5PMefy+TyAAPCUWAOv9fAAAAAADuB/xDiEaj8c/9/QB
LWuR2kBOGxyEGABJQMO59fHoFFg47AJAgeFosBCB5IJZDEEQItEHHAEJHACHaAcJQANikUA4UABy
CtCkSlA+l+5/TAOQ8g/6ZjANs/y4BK9C5BmLMeTYZCUUOQZj67s6jMqeubYqIVQYQmmiGn2zbWBF
zAHIfddteHhpkTQNPeHnsNrvq8XkAA/v/uP/wP7uOk44QADjpCZCEyEAAAOv9fAOvbEDwvhdj+F6
/sTjgPC0WDYnhdieEtMHhPCdf8KAfNfSA+lD+wCTtDjsgBs4CcNiANhBgClKoUDr4B/nAA93oKwA
B7pkyHk8vCFALZPugANB65/xAADMAAG2f9P8NideANs/xzGAch2Lx1FFg2Nsfwn/ezH6AHXWn9R/
4AE41f+P+NOdg9R9q/YpxxXmCy/4U4AAAf/4ABAhA46ThScdIAAAAAAAccIAAAAHHSAAAHCE4QgA
AcIThCAHIRqPhS/r7QEza5HaQE4bG4QYwXQaFKgaFDkH/X0DMX+YnhsoRlF/zBxwGQOHE8nw4mgH
XwD3bMQAHhKLAB9L9L9KAAP+mGhyDkNblJ4aHtgAGxaJgAAf5yLMMTlFzHtnIcnSsD0XoYf5fQMD
Z/gAbYHIADMAbaQKX0GiEUQCikeFAAAf2n93939w23bQAA23/r/iAAGYgAA20AD/ryAOQAAe7k2F
zHmL/MGY/8QAP7wf3//4BL2MBWICWaQ2KQ2IBOGwuKwgwDKgDgAzAABmHAZRAtEhm7FAlAA8IQAj
/EAAPCgAAzmcwAHILTgUWAAfS/SjwpAEDr/X+vhsYiAAAHHQfS/SAHIeQ5h/x/w4UuY6BLmLMeAF
20AAB/d/Z/aAG2gHIcxf9PQAAH/+H939wA/u/sAHIfdNsAAzFyEAAP+oAHAhGo+/b/70ATlskdoA
UhsciBbLq0GlYFCdabFspYAAAO2wNihW5SF+H16iwbHtJBCRkOF4R/k5AAeg7YAbbyH0LMQchD0D
/PD6YP7t9NyEK0Lk2URKmcWB4Xbf8dtDkO20SC0pBICPC+EtMH+UkUu2gG2WiAAAAzCABtvHS8JD
2zTrbtuZxAAAP1nMPvst88o1gqhwh/0/b/n5Varox+9d8rY4GBXYEwn7G+eVeWtL906U0sQmp4Ug
BkXsuWhHNTFT8m+gwf6//wsIufyOED2KAHsUCekljclmcNlAVkcQLCw4ClAeebyAD6U5DmIgVhK/
RoIz2H2vtgAcgycXbQAA/6baHIOQ+6f5gAMx8cB1FNfCf3/2B7pwpcxbZtuYfQvdAAMwh6Btgch5
B7rmINszDmEAzFtuYds2wAAABmOAGfsd7lgAdf2IABaaOOAAAD8w+WABLJegigNRjllFF/83kAEB
AIYD1/ufcPX8XvoGAVACoHAhGo//b3fuQS1sANqAMisgMQADCimqAcKz3ckBBJEAhI4QR4B2AjYs
WkC0oBCRmCfAMASoYAlABsUmAGxOvbG6/1/Yvhevh1//vkIIB4XwvX/ebO5DZHuvoFBFrWHwhQzH
/htmY/+mTS/5MnFtom95JMUimLMotBzBRMb+QAC0weEAAAkAHXgDYvHQUTYAA8JRAAAAAeyB/Ywf
SAcg5B6Btgch93oFgAAbHAAANjgHhNiWhA2LtoBmKtWZg5DtoZhzBtu2hmDMHIdtAMw5gAADbNtA
JUCWWRWQA2cBWKRWEGCxrtsBAGxiAJFp4gjgEcIDhmY8x5iA+lPpP/en9phmIA5BtuY9tzFoFN4y
sBcdB4TYmxuv7F4UHXg8JsSiUUWiiYFpAooGYM/LwANjUSDrweF68SADrwbH2PaYLSB17wvhNicd
RscAAADkO2AAf9MxgAAHXwAPC8KAAAB/YgB8380AA4QBMAAAPC2kAAAAAA4hGo/n/3Pm5Tdok1pA
VlA4hAjQaKFsUDWD9QHXiBS/4ksMwiyVwrCbC1vlCWpxpHG0cCLXQqRJiXxB9L8g+QfTvyx8QB8g
+R23/D/LmHAC5PLWxf+pEpf8A2zr+xLSBRYNiWkDjoCaLBBEgA46AkQhFhA8KGxuFB14PCAHXvCg
Gx+Oo4SBsUKKAGx+vAABtoZgAADMP+OYcxcdL7qH+UA/65h5BtgAHZIAAB74A992XxxdZC96Ae+4
4v3nvOyw97bovee899/0zB6AAcg2z0EAAMxbYABeRJgSyOOxgG0AKQgNwgwAOaNbIHHZRPRM4TKb
bQpyAZ06i9DH/4AbbyD0EOQAGYdszByHbf8+YNs2wPQ/+gByH/AP+mTi/9STGchzBmDJ0TA53CB/
MDtbMfoIAG2bZmEADMP+XkPhevdetBHXwAB8QH+x+XH2vuvun2//X7gDByEalLWtx2kAuGygcSgJ
LqqKCLQP1+iDr9pAJyJHHUEchQIIgE5EDYpChmCOIsEUQOvUWDYnIAzB6H73siiwbF2IB/b/f/YP
7xsXYode2z/DMGYvd9t2zMXIMw8h2wMxZj44Wgy0CXMXIbSB4UAAMwbYGYQ5BmPkAchzBtvoIe7b
byH/JtnIA5CB/f/cAAeFAAALRBsXY4bH46i0QdeDwoUQAADwnHQUQAADwmxwAAtCBRSAANj2mDhA
de2J4UNjbG69scmBFEAtEHXgtIHX+EAAAGxQACyN4JSSnIE0UACrECVkljk9mkViANiBQlBYLYoZ
S9H7vYH0oAghBMEgiiRRYMw8gfTvpnyP0gfT/IfIPpx/dT/oGYvQtt23kPIP+vIcx+gbZyD3Xbf+
nodbM9D44zhZXun+bMXoYbZmLbPpgB83/YPm2Ytt5B6H7rtgByH0AADbQAAAA92AADMQAGYP822f
5gAPdswgAEWOgABHiSACocAhGpS9tcVokdkA5lFF9VYMAWUP1/dQbb/1rZnuhIpaCKRAiiQEBPJi
i2YmzxZj2zMeY9jdfzFmLbdt20Mw7YG25j5DyAP739h/aZg20PQ7SB18A6/sbr/hevh4XY/hLRB4
XYxIAKKQAeE8J1/YuxgANjeFDr3hbRRxwABsQOOgAAAfTfT/IfTgB8gAHzR81mPMQbb6BtnIOQ+h
ZhAOQchzCHIeQB6GG2hyCtC8h90zHtnum2+6eh+g5g/wCti+h/48IL3vZHvQ7J992WAAHvQABLns
DFrtqTbI3jAqkB6wCeMlzcYLEoP9AjKbALf6fAB/THIzIIgWmCgC+h7ZyHMOYeQZj8L14A5BmLbQ
g0Hmk423bQDkPIQDMWY9t5Btu2bZmIAzHmAA90zByDAi+6f48g23MXIcwhmDbQ5BtgZgzAAB/0/x
23kOYdtoEu2gAf3f/oAP7f7T+wH/6H///YV7oqYCqC2VAEpCgEAcIRqUlcwDYpCAXFY5CBXGJDs0
vQClC6D9/hbAzF7oRkWPC/UrHXsXhUEkPyELAy5OZ6DQBds9B2JsbY+xvC7G6+GYds5CGYQDbeQ5
h2zbAAMxZizEHu/+AAG2BmLMf/TbQtEHHQdf6/sXr/Xti+EAPCdf6/17wtog2J4X5v+xPmg/tf3n
/7/b/cf3gP7xtnINt5AGYtt2zbQDkG2cgzFyHMWYttzDyEMw/4Zi2wA6+Gxg2MHXgogFpgoqB1/+
xfN/2L6UfNB9IExUlFAbjeDe5ISB0eES4cAjUKOgKgATrntshsMiALiBBnAf5AdgEfz1LADk9WeP
70Nt91zGHIdtDMQBtmYts23kG2gGYcxehZh6+HXtjchzBtochDbQANs2wOQUUDwhAAA8JsbjoCQA
eE6+APpQ8L18PC7G2NsYPpPpfmvpT5p81/Yh80A//A//Q/v//v7H9v9v9gbO20dEiA/IW9Q03//2
PdIAAEAmAOAhGpSF0cNicdkApnAdBtgQsQr9fNVc2KKBaQCVDAEgIJAoEKCOOgooBNCLTRZ4uEi8
IYjRXgDPdcCYRYXMWYeQhmEP8fQOQ7bmPbMxbb2X7wA2wAzDyHbA23/HbADMW2cgDMO2eFtAAeED
wmY6BLtnIds2z+8AZgzDtnIds9B5BmDMfIf8227YHIB/d/YD/9f2j+4f3H94///7×1/wuxdibFDY
oeE2MGx9ibE6+HhQC0QbH2L17r/hNi2cCOr59Zhzv7i2lxdlPOWuMccye6+6e77aAcgzDtgAGYgA
M+a0mSD3P3Gmv7iESYgAgYlV5rMmZO5cI8B2lzWSSgGggZRiQIAABT+fasl4Nt9A924Rn1Pie85M
FsSDY4x3B5xNMMCcZi2wMw/3/2n939z+1/YP/0//f/3/8AcgzHwhcxe6Zi8LaIOvB4QLQB18AAA6
8HhfChRQAP7D82PpX0gAfNAB/dR9P8i+nH+yHs/ZDNctw+FqOaqLP2OTyOx951guyoSARPXrktMp
COB2Vx15OaBcEsQvmSL1rYpMHCEalNXdx2NwgRxiMBOR17XIAgAH19KBBPymPSbT3/ENGfEb0jHg
tJ5OZ7r/nzH/193/xzH/1zH6D7p/kzDyDMABtm2bbtu2AABtoZg5DmH/DMe2gHX+veF694Xr9og4
QAdeC0AdeDwtpg2L7rtoAABmPkIAHIeQcgzAHuuY9sDkH9p/Z/YH97+4P7AB/d/cABmHbNsDMe2b
YHIOQ5hDbQ5AAbZmDbMwbZtm2ch23kOYPduELmAA23bdsoEof2H/8P7AC1gWA6J6Vujni3mhPT4L
jXZSbEAULAWARwFs4BoMkskmALhAhoGgwAA+/sEDjsDjoPdf+uYdtzF7r6HWhfdPdQzF7ryHbMwe
P1fq/jPpx/d/pn0r+wgOv+EDwmxg69sbY2xgDYwB14AAAAOOgDr/9gfSfN/Sh9IAAPmwfSj5o+kH
9i+lD6T6UAf7Af7AfdA+79oC2kTu//yfkncT9Z31vXd53HuPdFFwAkAAOAAACeFBnvdklFRMn9gF
P7lvnZLQ+dBUFCdBUqWKYP4f0pXKMTWK+40aBwKljXAKEEXlFBBfXhUtLwvKQKih+t8prLlLJcgX
2tc4dhBVHbALbP9HTZffvxbiQPZRF4AM+RyyryW39gVEdmhuYjOS+u9Qtfog6ilBvdht9v9KxoDs
1LDP3dE9B/ZyO1IDZdqReT9mqi9frs+6cLy3nL7ayXKLP8tJVSg9c+iJmepMYCd0PfuIeGeE8mNw
Ly2cY4ouTlG33YzUmcSVWScJWyPuvbdjn8U2GCu4nGGMQsHUdscEiGroraYwHz0xs8HahTZIA1L6
kbTMxrfm6Cuzcq1Qr4twJeztvHJLrpM+AX/SaK0yrI+BuhufqiDlPAavb0VrzxLwgdH8ACzCyGDR
8vqqRlbZ6mioqcMv4N8dug1fPvsOYizgkItHIKt+UnmDW+Jhdo5iNws9wA9hVG+iiohDhN9bUPiO
sO3rooX6d986opxSiwM8KD4/nQASmY13aZysItlpM5okffS9r9bPqw9djhzAJbPBlPQtL9lVtA5m
xCAGNxuW8B20JAtwsQn5ci6JmXofHIIW6e2okOUVcXrBNfkcgtYoMmKDHGChJBZ0MGxliJmPH8af
mzAoJOwCi2PlKJOgaIGYUxFSJchV+rDE1maWSIjAbszkrdAI/zhkH5sRJAThQAI4FqbVPl8qRO5B
UP6rHxU5Lwj+hD5un/R4YnDFC19cT7ZrjQUccvpP58hlFyXl55kv8mEZD6/iS+2xHIJe0lWcVKJF
gsitJHAyMbyaJWS/OkZSIePTt12/kj/u3sS9vKUiRkzHBJfNYV6PVSsxpDz4LHsXd3k0wIl2liwL
/5eu1cQZMd4veL4PZLnwjJ6j1b0dxSbC4pY93xmaFULJApvLyrSBVuzyrga3J2NvvnafRwy5eC90
w92ASfbZloRr2R7Qf+FSUPnFPVusmiuzoKPgYba+PrGvkTwFj2ERZQeP88F3Tn/SKH3QGIUofc7W
esiYKn0tJ93jEOIYr8Gv3cIaYIR5bYcRB0DxojHvOIUXclVaU1JS2v32ciqolOXZXk2mNQpJrPd5
nfd1jht5aJdibFd1l6e48CkTbv6Iy1F3jVq7g2hpyYdSQbCBqkqFIvTjgLMi+OnuL4kkL1xxq3VD
fvBCpvm77uheStna4D1IGQhpNh/Qua7+1t3ig0KoNxmcWrrVCFO390cvKqliyaR2fme4Q/469J9h
In3d86FrouXMcmuKwm7Pk/0ASslNwZ4yJWyhSmvgejPcr0t7DU59yAfjE7wV8Hy9LMYk7QS0TgC+
c2mKm98MZCXxb7HMLvNDWF4gr50FrbnMoW29Q02Wa6cIl3whtFLByVLocmIBnjVbhpnNUG09ZJ17
GJLTCb/UWpKCJGLceu1++LYS4S6ucAemw83ZVFmjHHHMVDxLuARaiICIE38hUuBrkFKmBT23Z+Wt
6xigl2xU9MLFy2b2P8JQc6Yq8KUXEsOrgMWoFyOoBAZe8YI+PzHtw4u+2MCtYD7L7bR/PjZGjp0G
gJiMpKqP8per6O4yvrK6roTElT8CHc4429+PkHcAShgP26DbNESHsVI18ZdBUJjRIcik++bwnypD
PnNymHQJGGXM8dQGGqhCfl8djVYDt9sMlzjeGIX/8//tG7PnZF5lfPkg9zxHC/GXKy5x52rnbXEL
FBBRTcGFOPcv1SzvDn0TSzdZKLksIn7iDxyZGZYshAwfEugUQOTAyHpe0ztpF61pqYDnaed2JcEi
dcbGj4/9yYaW00Guv0Yk1pddx3abZj6e1xuy5n00MpukqeSyCWNlZNBqLqXHp5SznPRBa+MMA6r2
/28lTbO4Kpdebp+m3KkB2TZbQgk/7Xg1Quz+/JaYKvSrMuM72ed2V6k81vjSRL/Pdb6CqNAQd7wU
AMxTCEr3n1Lk2b3X1HawJCm6f032vM6DeUI4tfCVtW+e6e+fmLJnFQPLLUq7JLBRPme7cuVN7GAD
cK1l6Sb78IM9ObV3y1w5PJlhMa24taEnBX8Mz5NC5J20LnocWvBmVRsM9UYoBEZlZlyrhCGbFkc8
+w0v5O1h0ryU7QeatKHbByH+ZMtIRRIFU8a3LFtES0KVrmpvR42ucfWAPBZLmozUzefnB27QUJlq
LHPSWt4IRrZUuRdi/1Pqmh6lOmRBDzINx5Yf+czBFtruRFsPYk7sIU5v8CSnxMm6avnjXqU1Jvi+
6JtZRnHTbkFoqGP0emB1F1h4oTKn/xyPPL2ExcSIfYlpijqnjis4lrg53xqmwJnj+aEgPETJxxvD
oFH1/SuI6WC2iJFyGfFD/PYwsYFNnff4snsCIKZK8NfF8sKcsjHlQ3CDwQkL2uX6qJsXkzx+kKjg
6yp27uEQQelvbfY3/UmG9+eazX9JMwlCSwEtgzRhYWhsXztsxcYy0a3ZpPhhf8UEq3kb+B5eEP2Y
nzjXAp3TqneeX/UPtJ+NwIX4kzN6je+Y7glwISbz8mE6c1EGgqSzca7TCNv1EwPYCtQoRsgqFE7z
hKyE0Vp743EhgYdwJ/FW24Tm3gJZzrJO5aKs90MPp+35V//N6tx+lXqS71ICI/O2NqO6lXnCJcno
iOloj0+UPK/BB5bjFLZXB6M8ksVQ5pNfwTK/zauMTKBKaeDyDVeoIgIWyoOlnVvVO0b27P5HIjws
R4rsJmEbs67e+75EVByfYdlChotxmZarRoagC2OGe+Rv4S1X6qKR7sWcM7kMAD1nY88QPi3tfxL0
yHMovGJUfTL9loOsEn/1ELSe1AO2ZNJYY/M+BaHpW7oETcQnMKLJCxmBQylTJ450MD/cWePkYUJe
U4c6yuCDK+23kTxBssL4FwcsN3GEX/oXYzWg+E60+tXBnzMp+bQ6jh+R/iEhtTK17tqjGrbMxr10
kY5r6b+CIU4jMpJ4w17zpi4sXsqtYkUDCaHeqhvx5k1uSRDQf5XbRIu/zV3n0mfUXVfpfSEiogIr
50bHp+85wDyenuMyYbFYYeWm62uAdT9Meq4HF73mIBZschZ2e0S/GHdxG8A8QOJoCmODaThoSAmB
p1K3Ye+gc81oRS0TGbwB+0nUYBBeiHDi88qYj30c3lMu3ZDLPazQj3zfqthqueqJHywqOuegSQUt
OxP9BiIdElSHX4f2FT7taC9LarP+WMNc+4wAk2YqSIRMqWP+JekqVHZ9DZnxWoSjWoNvbQKjPp9R
DysYIw5RcHIhDbvsjN5AYl0zCH3VCM/nGjchM7k5r/tCtgEvfh3DZC2VmhT7ucqRxbizAeZ54ywy
ydjAu1eGc5fK39etInM5yEq695Ow0RQ286MqTbLtcCNs5kqCxE2UMU5sw7Rh5LiaKJqXM49c/z5H
Zk9hhyiClUT0+T8AAAnMAZ8Ybkn/15itsF200PswzNPygqSahUgiEwhg7PblL06JKJFC5AkRBhd/
OLlzwiw0seAqS1r5GNEA053b/AQezEqef2xc4bxgg5L2uSGW6daQwOnw5Gh81T5DnGl+CsM3qwRe
kMhcKYImTqfPhJw1dfysIkit1fiXDoblNpYN6lVD+3NS/aG1l7fb941nXXdl8MWX66WCFu4Yo20v
xtJtI6aefx2sw+/VbGajrEJT3Aa+dHBc0k04jEI/RKc7uHht+PCXPq86oVQPdYx7iRy6oh1HUPWu
knIRQa9BLH+go8ihNSRv7LlHvc4Gp9yIb/i17RkLoJS2etENRrPjMfh95RdLo7/sCmUeSjOxk0jV
+YuZpaNwpjOuzs/ELbs6EYJ9covHHDpNP1mw9RAqvmaNZdfhJJP3kuSAZFDSDnsveU38LyUvOueR
qzjL8E/rFo6rKEMwx3FN3jP9KOLUXKD6dAEvZ0M7VKdqEvnWUmXiFaJhIPovLNmJu4As7S5XES0d
GL2PGq435GKRrCaUv2rP8Mh/oUsOoXA1lyR0ggfdW0/ed7KHtFA3wAkTXUKbbAXiLO9ewCxe+8F3
WTHuRrK6gW/0YFhF3XXjSBSgEGJEE9dznsgKsJLtxUxnggkOS4NT1VgwI5w83sEXdRW2zVy/oFs8
MN3Kk52221MP9kUcvHdZpjV3sJIVpDJDWJ6d5nMwEenxjIwUXO5ApPxN+V+1VKqZCRe0UHkvhC4r
/fMibLDPous2bbD888eNzr0nuBqkWP7KtrUQf8mWrsR6RKfxyopcW8BAIFYot6hJNEXB7ugBm9W7
JqGM2/JaK7UpWy4F/3K1owD8d1aRLt6BrFOwm3Z6JSPzRLv/SEK16aTaEDNcXN6N7K9F7xQxS+ri
1h5NH7QUL2K+ihcq8UF9P4/F8I5eJ1vmg8vLiboL6iFw4pFCz6TZMa9gax9ruD+U/4r+ShZF4t/d
1CGWvrHoEfV/uJ5DsaG209gcoXVNclCr/ogNkGwGsU69hExMKxSvjhrAsv1ZGitKwMKKDqHP3mDP
Q/vczmR4Vbzo+3Y4Hm5uF29HUU5HpEISJF1Gl7utR4E0csduXocIlHL+s5saHHVCfkn/781EIGOw
3eoPiEK8cGl8x12JDwWSpMN7WDHD03FeB5Ig9Gu85RJiL/wlU/wzK/Bczm1AxHqUzDi6L/N01yxY
jT6HcY27gwYR7xNgywRa4wVpAnFQX8U8yoGCaHOwjN4BGfAY+rkr3YxDQ76vH+8Z/2saDGrxoWWM
EYGy8B0rHUOSBUcrZ8LGIGmleNMW3HwfJ0Iwv380u9BG44apbuffbZ4h/sDxFmzo5icSIE3hU4kl
1CqJmtOSNJ3U6cMycQQA55Da3+LMm1wYwKDsA3+xehF91ii1ahVaxrTLU563XXSd9IaBCp53//51
32yAsBetTvgXHIZ85jV9zxKnhHfRDv3VoyImITQtDeN7gCrzF7SYht6cpW5SY/FJ8/eLLhNfg+Pf
08GammK4j3x5pMIz2nMz9cwDUFq+YyKrcoFTqoGO5pFl0xH9hWq4UThL/l4P/gyS8/WsMrdGoKcg
Ket4jRmJRVESVPq+A8BH+5AK+V+obLq06y2WZz1I7SuOtjycyA3Q0MvvWxTThFXyP/zFJG1kQp4w
peK92JfMrXdSqZjxXI+yLzoWw36ANwBqNjPMzXJUjwk67Pzc2dMPMFMBEQHrDf8HrsWH/5vajSN8
+VUhNQTBO2ylxvK1IA4XGf6cxfiw2ieK20wa8A74uQC9O4ZqNa4xDk7axEWLbA799YWnbLanT4Ro
VGoKfL79MYAKd1R581qbufRkjrgmYLiCAuxvzm86uqbn17tgkO4Hal3OEKh7BfAkW2BRnqOZBfyW
Wz4HaYOd//esNouL9D0waEGMwofxAYfblqm842N+3Mv7ii4X2FyO+dy3Qo6ZzyvqHkynvsyjWWO/
KrXPwaZgUevYjm5r7gWKAuePAV2RppZAoXaa9KV2H0q0ZPjrBiGWQ0vSdoMZQIQANhOR/JBKIYZ0
LOm/s6dBaCq0deSZ3QsW3NzsM506e93LMjlGVg5KMi1z7IC8jArt1rwS01I5qKKUjVrGE3OH/zJA
W0iBnFKpzxyFxEtUwv2XF/Da0idHs/ZT/zaSsZuBXi9I9M7moURcdmx4Z69GC+nbkf10ZVDfpfPS
exVrdqAD6Z1hhKn7DjFGDTLuRHFvcvFIu4S9kbAb8dga8NvactpNm8MeOszZvU6fvmdvvJwnaA08
Lav5aNbUHq8A6tq2labqOngSvZPjvtBe8YONgxIui8YlnpqfvNOzpX9US7Da3uHERHtnXJcIT/gx
8wL/v0N8UZqhkC5AWtRaV8LAVkKP+dswdz5vsjEoTWYm5S8Z7k19QYPLA3GPCA/AaLrlUCXJeDCb
BHRwgp68QQbWD5FrO9xhO89tcRuOZgKYJ3RmWVO+kJlhRa2KMGvzOrzwfTnOhCGgjoMxZ7ijSdsK
HhbyiEBusTNdGIkybvJh+nphLdR9dV2s33gTJ2lUa1UH5eU9h4twxqwcO4Bc7Y1qhA9OImFqJJI1
uXp66BV5s5l0B+k45JpTdSnarnxa45VnQI2D5QOlIqKAZ86xQ0MKpqvuH79WhZ4nUQtXezMYwzb0
rtVJw0nJ4xn2hndEHywaAVBqw0MemomDRJQZAvxcwvf6pv92Fpp9cGmYe65+xi9KQPgPkmal8rvK
Z6qWkPkZEfP9PfNgkygIDS4M3Kw1qaBx0F1tVu3jGMMqwNprF+D+XZMU9yIq1HwxgIyeu08lwAn/
bRNdsn+WT2IihAbem5FxNCSw3lnznbTfkqryMYbUtutvqKGuDjuc5dVNFmCjqHxwTfHlQZKXOne/
GxqzpG+7s/iDIbJmIa3p7wz2Fk6JkVJRLL4n0/6sBnlAhbSnEM94c1sU3NFjFMyxt0yffui5w2zE
1XHMYz7bfhtbOyvnCuoC2wIkOeXxdCyGywhr/4lLg9xDZZ9BCbYJjn64T7TVhF4BmglXJ6a/Ovk7
yjpf/fwedqMPLK+TZrq8OQOKT28Dh5EqzzrMeFZyl7Jjq9Dfqb4TfUw4csinZcvCR9fTgwFCassY
nQhGWP+DnG90BYwo/J6wrA69cRHPi+zAXDr5dB7hien5ICoo+kmkX5wXyxFEXTKh9I65nj7lchbp
GTGz+KKbqNDEiPzxU+S/FA2EceqQCrM2kM18J3xOBroYKYxg3GYtwV49MrHdP9Gj9Vj6BIf4Rd7J
pIKwwWmrNQ/lcCm3cZ2LHwIufQxzkrw2Rmuw4buArNL0+Ro1wJRCXHmBJAWoBJwNew/S3jGteSEg
C9I1fGAwRKQUmMHQJSDAAAARDUGbGzUILWTKYCiY3/lBltSdA+tBztZ5ytdjz2hFz/Njo4bujv9r
c0y/Gh/4MST/w1Oz7Z6HG08ZQIraWw3gSs86ciA8idmBxQCcBO58jUgmFkv6Ubq4vHFyFb4PyS3A
PzvdKI0r9mD9d8JZtGSpr46QEq2gN/r06Q1hsBLKVtmzjosb6nSKxvn07P3Ql4A+UClCfMF1K2Y+
I8M9ydhPNs4m77ibWfMTTsb19z2C/ujEEvamrdqBxE1mc4pboKs4Fd5O/eIKSXTicmbFB6VTkDn3
QImqnoQF46uJCCYoiApTy+T24AClEKWjkecBGTg2natJ4ioQxFZXJ3z/F0UF4yRnwbkEv7oYeubE
+pTt9CMfCqWSJEeEoe/mOxGJK631NGbfglIOsf4tpo88S4PUN3xuYqVvpqowRjSp5PSndLW1K98L
N6MIYQxMUGanPk/JtCEMRNLYliNVJcWDBb7XNoWVcO20M4f1wfjo7HMZeOsle/EOAq3hlEL4qPBd
bvmA+0sbtClFmyduD30fSvUcOOXywzpFVkr7LcnftoGhSEU/BRyKyecsmpCYHj/yaqZ0Dkxb73/t
mSfBfN4DVDlTb5wUEL9Xm7fsjTKHy76l/uqFPZNu+OHoq3rqBGknpVh0++L0QzYrKpQDaxsHv+4V
h7JJnFzIrOeB0h8GcFeQzLwc4ujniMXf+G4oR2BhxJkNxGuhEiJhhXH/wmGZxXNv0SmU6ULWJGN7
MivS3/5C/OIDKON1RYoBWqhpgDBMbDLAdY2IW60/2nn9cuBo9hxOi0uAYW93aq+0od5U/WQsA1i9
AkRxzuZs+YckiT+i4Do0tEx4fvrjSC9FmFS2avfp6mc3okmshqbtJkDVjJ/IaJdqsXPlTcuHrte+
SvPv8i+QKGPzWV+wrwUnW5dSO6zsMurVpav83R9X7ko04RSRawl26TSflQPYbzVaDKi1+3NRYito
JwjcPjpp3y1ip8wG2W0CkYEW2rfEFfJJ3fhI/WidTroTKLB6JiwgsNTCQ5/iMG4r7Z/asTEOn8Zv
nJEggWUhWydhlcC1EEdkzVRXOAztP9RWxjsL7N3ytHqv2DxzzOtcq1MsMytA9b39uKCRvWnSZNjs
qV0YyvQJCUnSoBzre1fjsD/2Rrvm7M4kwnnGLIjf6ydjvB41+VVw0pnw9qTQRArgejrE4YeyHQAW
D5o54v+Rvwahm6uNm04+HaBe8uAFgiWEWEW/Bx3w9obwByRucn0yOe7Q6D9iMgJWC12laWqtqTMp
kHg8ObpVZYXSPnGXtL44eyo2NaOzpVHeJZGlb8x6iHn4y0rerbEZwfQG1hFaWnfneM8crGueMSGJ
8N/1mZaozmxIafTjbUaNCQA5mPm73KfZ1unfKkNFiHuCEIhyTddyIPkGglpQpiwwJqMhpgX7eEAM
/RFa/WJN/5LUVKieOplTbe0NXx8VZNmk5Zk1437kV6lgfQ3fq+tz/ArjCr1DQWMDy5LqGt7dWzmU
vJk8Jbs2UBJFs0Tp4lYq2QOpnlJdoI+SgHsdjKSmpCpGkuPifFX2wdYkg87ZokXyLwgDjb7kDp+r
7Zn8omZmZUszW/argOA/8rgUPS+4rtwrbXEHyC6ekJAqJlvho9gs/KuEVNBAiX2VwxbpZuP7afSA
082tDuaicrh/V2z0U27jGpo9f1wqQLWrEye6CP2pzaFltWlD4h7UdDD/JfW89BAa9GglgY+vCHIg
6S0T60g2K7reJqrgvBn4smzWYlX10SrzXuNLzkQHRpeymO4Lts4Zd+APIb211LDBcWhWmSpELeGB
bRmaC3h5MRQoBXwL6h6Xr/AlMEBLy11MsD3204T8Ptd8hIrNspuWm99On6qrcj3G8cvuvamuyQF8
EtQZ/FFWLaSkEgXt9tlpaQePtv40PX5wj+8j0IS0kM+W1Y9VXppCNVgDnbFj2yhZwfUMHlrd+/yw
fin9Q5+bntG4EVgBW9ltjokgkEqmjSHmSInVFvkMnZZvsSChGfk/GEz1/efk+1TFqrGToQFSZ2ws
kT5zBxNKyBlc1aX4Jx4PF72DHDrAW8q9FgMnp9HOfk49g2HiIjW2eZ2f6mQixpKv9atx2hylrjdY
+tGVQJDqaY1Ztu9Y7PXLmZMgB4wd4YQzvL0VTKuo4zEzbMsmozah8RZVs5UCIw+wbnB4ryEsOi39
0M0Ij63lZGzak0T0fSUXj9Yo+a8r5hej2uolKpY+IwKk0oFUtVQv4JcB/T5CjJ6+NSSWQk5XGaPt
/aGzl/NF50in4TjZrJ3LlJ0eiiqxw3d9XLFpViBB92zz+ZqHp1Ig57JSO9uDt3Do840QynMcflf8
DKI7YBqjierFwPooizoWKwHrylsmN9zyQVRr3h1GsmAmr1l4oubkge/J3Oe7GSVZNiUaoviq0UQU
1E1KCJVyIDvWa8x4f3uS6BKQWSiYxhtzLvLHDMYHINwdvN8F2nUtodCVa4OPT/ny308pqZxMNXW0
o14qSgfP08ozZqwFdoUvyyCybAYWcUr/UHQoZfrlYySgbjuI690FY9zVgRjzjWxs29VtWn+Vui/k
GlaQdSa0xzPrXf+zvHu1bGQxp5EewrsyjLJPq1ATx0krzqHuwUy2tiihKf8egr7+9H4aYdPdkn+f
AuXkc9tWU6A6rXa09CvL7EZK2rCuRVsNycCj/4gMGuW6ezuYZJUqQLqqtCjUB5vv3bqkOx2qpsAK
Gjk2DO5icM/u9E/jy8EWXAT0FhitrMZZqVAAUwLLhGWiiyJSNNzuoKaOrXIc8gcYM7hak9AG4KBz
QbOsLqlf2Ogk3vTOZg6MCJcTvx2OcaAlNFOX2GTD7qm5/otbZgut4a1GosH1ZAWhcTe/Wk3lEsZw
cufdtlPROP9ZPBoPtUFvpiohqncXlBY6CASTJWvC+hLWhddovWDyJsdAfJEe5zcuXzTToCDXpFwB
Rlo9/s0oWOOodr9ZK09BrkFJgFcL7WKJf4KP+FzeLvApydCxLdvdfqO0fvr1nWf7/n4suhsou7zv
NINI+Egn+alYdF6s/waxGpns2udUUiyAEsFLvcccb6zHOhDMkukxcr5Lm7hsbLdqsTngF4q74aMh
5yxWb6c/mtzGlpz433f7qMlv1dHQLuJ0XCDlvOBMTQ/WhZBxcg0envBKH4Jr/mAgBx832ueYmDIS
tL4Ej9qA7Nt+wrq6WWWkfybwUuBGeB6cdBzAm7rx1WHrAKh7CbA/r2NRBhobp3wnM9+Z/P912NM6
reeLJ6Oyls41A/CSuwUO0CxoDntpos7EeSwgxfYc0jfrZPvBKg5qe2zjo6MjjnhDQaaphxlujQbi
X0+MhKQfhHVWheHqrJK362+8l1LIu+MbRVPM4vnKp/u6elHFu3uSLFqltcehfcNoiN2rCkApiBvl
BgvJvYpMU30OoR93uneBqUB0W1deZU0e+iSf1ydYxiaRy1VehwlP7VBwnTTqo8oqOySr3gG/nwpV
9/Nn7lU5IwtlJZdyfJicANsmsW+yPzAsNrUIqR2rypeycozs5H3gT7ctT3/xbxCNWVdzFjyhN2Q5
lT7pgU05TK5nKhhcLrw0oaMFaih/9e/Ewmx22j+8as752g6zKy5ZBe7JbZY6khAIo2AHQrMoVXz5
y8hvLEgmu/vdDsV41BhFv8jGRKciPLtKYPijT0c7JNNazrUuH3DH+3MmuXF4M1IOrhtei7FVbPcg
jlTu9EOJbLIL60p/IAR77epU0aHf92wO3aZiOKYtbIdrmT2CxKyQhBo0XwK1e3CbWZTwdNggwbm1
v5n95Hdew3vzT0IT2c1OaqtHuP8MGyDuCd36OxG8uHKj/j763sZpGn7Ir8+1PaL1cVJYBqhMTubg
0AMPeiJRDj8kVx8AbOicT+i9d9ohCzPyfvW4CSgbBciyCEEObNGoMcsCUwD9w+al7MdI3lNuN+ld
dA9f6q1oHHydgFrJ8wR7dXwLSgizF1WI+RbJasxQoyvpvFSbnmjFvkmOv9OYHaVXV6HtYpIfihQ3
c8HR/c/3OBCaBeQJJNfzSATqIiZkhxllR5fW2PSplAVu5CUCryroGEn10GTFQxWzXhwlThtRQ4tO
mEh62snnDWfdHfAz7wtMdv8W8btAI75MPNjGHn7BUnb+arP4szIgMsIi/OslAL+sO2PsNsKlwCN6
Kt3gwGE/ou7uKd3x0kYYb+wCTit7+zINur5+bsVzg8+x9IN/rHAmU485mVhKPSR8bs1eh1l5tWg1
9ZOwrKXJCJwEZNbWsXC3+BXi3bSfOaUtvHzYEDqgezcclmUeJKtlPkUaxdtRucNL32y/J+4uInfh
ArW4et/OKyF5BSroybB0Otph4xvj8vOfuxnbiFFhLnSM4hKs8Z5t8d0aR1tXm5WtbILHIUuHC9Ab
SSWxX2M6Ds9eNFTtrV5ewV2T09JTZfDUleyvcqZm+cwYVAw1S+coZdi9QhTynWwQGjQfO8ykPYIF
tLBzPWjjif/K4PvvhVPobWQ48bAQnSTPGwfx8/d7URI4MID9Q/cnoaucfBeSEufb9BH59OZ8rli6
Rbas5bzRv1f/LAmp3y+XS/LXGYQZtuJTEvflqEkuXOPkrFfrVzFzn9z/jvro89+tJs9blMKaevwU
3GttXItC7iflGGxW4bIwvNtQjDYEUDWN/3m52tMbo2CyVQ01bhM7J2X0P6V0P2Ywx981Q5wpajEB
+Nw20KbfkEb17CAaOxaah6NpBqH2us/TgwG3AYJElpCMpMIRmaxOS2RXrKjx99S/FpCo2tJ/+DZh
LhYR1TTT6LKktTMSYbEMjOZkaueD0NnpUPMK+Ro26/iCCOaKJ4beFzQYco5/DEX9XdXL06hnobIS
VAlABRm8ia4M3LMEl57O5nlNbLZwch4ThnGZ4QlfkO3hQTY2uKPXekBjTKi+hYjCmbPdLsYaA5p9
rjERwFs+9w1iJf1pPGKXI9zyMMeGYzy2PuhGExSoDElDK0UwYQVMqcwQheV2t0lyValTAqjf6cd4
v5qrM+yEZd1SJHrEiY3N1i4TNesSG6e4ipj0vR9UyYOiRHcy4qiOMScsSkIE6aH0JbKjigCv7YJ3
yZYoGPRKIChhoFHvC+t+9n6psjZAe3VrgfYDctZaPgba9LsbVKhjnOPc1iDswtCNdc4hnb2Zkr49
atyCyxbnlO1uRDjhHyhQiI56/g1iLgy1aPwFpas8oIQOVkCbLitlecStNpnwMTKKPcCJNvX8q+xm
Jxu0EUarkm2LckuG6h/CXUt7wmsk7MqnbNS6TWen9hSr/8avE++M5bZsrz3ke/25ObJG2FsPFMnk
j2wpv/nZ8HX2wQ10h6t9nDZY/QZt3PGJ3hpIa/1lJvENysSsYgECZrsQgko/fJ374/dqS60jqVKS
/g2zBIO0gImrNlyzyjcr3rPTRiaIpBEvC5u0qQbxB7Ufp49SZDPPR3NRTdT1jiIpC0hIqPWg/Vvv
mwktI+xc5utEkv0EM3wv9nesEy1RQF7fveQdIIytk5YbScZfYiLLK+4Xghm3e6VKL1Cu6pTf08Y9
0XvGa5OAJFxXaYMzCKhJWUTffAUBZPkyHKauoJ5pyL3lnz/2IfAkQedXDYRDZDa2QjRVVjsjtrNU
kVf+pBSnTxhIDZQflythVf8MNmD7b9cEf91e65P38w1VonqOrBTM3xN2tJRnDSGxpVxpUXdkcOiI
wrvcgOflyEF0AG3HycnkBTCVGeqWV2n9ypjF+54sTdEFMUgNRGG/fBOCU4MxKJNUCX5nzU6keTdE
ASghOm+NKsCH+rPxfQ+LZRa5+7FbxAdkdvFxxjfAG/l7Lq6b7UXOn9edRFVmlClCpUG5QQAAALsB
nzpuSf+sRwN1or8dZ94rjb1ikeZk5jkLYUASah5Do8g0tzbdxs9k3XvHGqtm3LAvXb4CZKkr4aBR
GgkulqYZEEgVvkY7dD0oTPCuHw5/mveS+I9PFHloHKS6sZ+jGPtp21dP4XuXUHc66DtwqMvtzhym
/kixeKJr7kD2BliFDfUWK4Epmns/P/ychrLZCVUEIeVVBNm6xb7TDePeYiZ0W7BipNwOBhpS9J1R
7YzoCoIPF1gqF5qmPwcQAAAMtkGbPDwhS0TKYBP/8iMCIIrMpIHuEzVe8hpPyv/sFIlX/dn1hxxk
srKGJF8XO5ojEGYM6ycUcqbP8PZ1Zm3WrRTmZqsQCQnYPAfRQUiNdkLRXKhvuINmpuhKRUro8Ri3
CuhqxYXWCt1MO8kvKMbhkYN7+7CcrOIwAHbPU3DrmkflRkAEIXsoMtrZA/+vOH4pGF+GynA5jQSs
acOc7p9gNzZN8lOorA59l3xkxaxP92zQ2dEthQqJijp3CoSj2xyV9jfjg7uwO+ozwTzck9EntpfO
PTmtfOguUo5N037jVDliBmCQxtzJFFWHsWIHpvjWwLpyti7EVo664JWGdeIFiajcEQ6Ga6s5RM6Y
rtWszgvFtOlhvgodqi4WYC3rl0IY2U4KU+ktxw48ZYJO26Pj1ZzCJPHjFq1yrq5wZLJRFZe54QlU
/BCmKYvG+ZiaQAm47IueCSDDJoZTm309f35n4V7aqW1RXbpDWNTB6lp850BX0QodcPTFiSQPd5B3
as6tc8AE437JKxu/C3CRWSz955Yg3mT4Wm3H8veUYlTgwtlXz7tweiWU7OBCIhL+Oifp+hxSiXh0
ZwjK1mX1b447UwAXsM9IpXnhr9RFpNN3XKyo3OXxDgPzjJcDWOB9Aj3IUFzbatGfqgU33eG97rRF
9q9aWAHVn8xDg3jaR1wGmzgiEjyoYAU5n1IAYnAZm+xHm0zgR95/MnpvQlOFel0h46yS1lIUh3Bc
+RgZc6CTCHYvGZrq+7rRRlCOOV6phIYkU9wWusGLCXH/fywh/afqglGnySWtpRZXnsfya43A0Hcm
f7iUWf+uxYBJ0Sti1ubUV/2NHnJ6YYHySyWDEX02KBsD1AacfognjBWxEgSIGOFx5HVRpKPnFjZh
V1gaZ/W6vlW/5VvZ2rDjXW8eDi9jr/AfgwQ6KvNVd+rXbsnCJTS0reM4Qzcpn4pe8tsW8q2pJGih
WztquPB/cxDngEdiCog7WdvBWbOT4lLs9nmFdWICl16LHlV2nGKPvTB9QDB7+C3ZjohLIoIT+qGe
rLY35Pdi1lazI1OIb1xiEHB8PkcQzuRJ91U5rF1HKsBFZ0l3PfNdAkSBRm1uJRb800NqHtmdBH9x
tW72mnwMWgRNq8zJvjsjOucDY4kQyuESKDZZJXR7G+r1baVhKoDUjpEmpj0A0DzBWxXHNlhigNlf
x8CRlA9jpFPm54wxOXbwtIpwLtx5Coo3VqvR3KdKBpyrUK76pCCwDQrCwBQjrvsgLpYxRXprkCig
ag3sKL275npGcp8q8VakbrR/xo9UwL44XjFYqvwIoNe4t0cjYX9M0F52ri8ZkGd0PeiwCPuCGMA5
ClZN71AeHeUKTBudRxMR2b2w0/asTyVGjmIPXoeqLKz9/au++KHEHfA9iZBbUr/KNts9/wgACNJd
DDNbckYDN/lluBazrv9wFCZrEAj+8E4GJgdkhMrKJrg+GNax1001c0E2CwEoGIrh+7ci/PU/sopY
ShaCu1OSYbOd5fqEV+jo/M7Gcrxkr1Tfi5w06G1wQrDsop7jfvUBLuSCPinYe3eeTsIG5yhd/9Ik
KXEbhZAtnk2uBpBc75wlwcqYzva986sk4kCFCRdZNTUMIbeTjfrcU4faZP/JCAR1ccutBC9yp+8F
t5yqqJi6fJj+iZ7mJqvQtdsK0OlKWrfTYSeYeWS35K6GfbtZdmU0DSS8RRCX6vu682RHJsAjL4cK
KAddxlnxYs1vdktjMIjmA9v8x/OjnTwFX84gOF18pshDUs2Ge9EIsOa5CcsbQfjDBrIC1Z8wJ/7g
g2uwHtFFYe8nbG6W75eZJRltUAHBWJhZImXrP9u64uI12KLpF5nNQ81qFSvGGNGTAAkm2oSUHHuf
e7V94/r1zVxzVB1tbLsoKFsud60eoNflqnU5LFDd/bDsFrCcG+PxycyVQVk80xsnzjGVS1ZNnnqm
xF9+UQ4b+EjeQPPMphjh60I1RgfwZZO/k9BaAP96ig6gHaKRdOa2x1LxpZysC9MwwTVKR7ByF06z
CaqqOSUo/yzGBGtQfBkKOm8HdK+e0BxRvFrYsQSEkQx12RZvfC5/MCk2LHoL2lral6O0TnfQVFdg
l8jiS+vQtAEY0y9/2wRjMW5CaUItFmO5F7L/G+3sZ+vZKAxsnaOIIvVGAGRxQD2cVvbnBsvcbwgm
Sz44ZZRqQZR1vWhXME/fmILeBGPDMLr7hTCJVfTB+KTqJ0aT1/PV4XSOfDAE19WXmMXiaBD2160X
fO/T+s6ZRdHrDycbiV8MGnszyQ3icltzGPTgLcC68WVwwXXby2meGpLLTi3rI9bDNfs81TH4Go7B
B+03222X6Bxb74YHtZjFPqTMFx5yii0VG9YtgThWLL2AHMogpHYxnFIEvVJYPcBeH3lpPVHSXvBv
mUjXBAqYrE1FnT7NztKwHomX7UVO67b1oP3rOOipSeuYU5Fo1vKweRUIoMveFC7j/on+ktE6+X36
TjoGXGb3r+HSHfSiT/bnY3LR3tsHNpBeno9scRGnwWqMxKFR6STndazdL/0lk+8nXKjrPW4x6F5V
UPkitIDWOR80P3Q5K/codpzmrPA4D/etAPostTUEuUalUTvdReAFXDHX2IGe9x/G36MVZko0IJ00
oNfLnTwl7ETQec9F/mbAqAtWT2f2jbyn5Jix4J7dDq4sDdgyT2zcZpSCqOjL0FQXKnA98C2F8V6u
ZXnZk8bKjMrSGp0LXAicY9KzPtdfMv3BS4iHZm3D077AGR4c7hTnkBtN9uqHDM+ZP4Um/Cz3HOmw
8T24Vd7pFrlgzuSW4Ky34LSYer20SYxbk4K1C9+FJFZE6Y1mTm8R4r+fsVOM+n2HontqvtQXkj0d
E0AfxrdwdJm0GDm/sTJQ+h1tKNTxZbWA4UbhzLkFikfnWHgW7fiA6i6Q0g4Y8AYNZCFxJN/x/Kdc
Br0Df4NKxERz1xB0iYw+bHS1RyyLWdOf73vlCyPKfhcBspmuz+r/VhNLok6Qf/cFMrSLnP5sYmWe
fd9mJuvgkljc0G5AozJOQfj0gw3gJj9rJrVBSd6dQFr5/kq9jOlSafjDzW1EKoBhbC1yLAZG3FxU
zJMkNDsAPHXvLaZcooZ/NmhRNAUiKiGVT8WYiO/hBW35wU7+f6h/qOwqEm6ZH9JrRoFsLVVRlqIk
wsfHN/MHtHUNHhplj2vgljTkhb4mH+gYux2IoJ7muC5m5zLPK//sxMuTwSe8Yy4nK0QLg3LdWe6h
48eFodJMqSX6NOLpK9A2aDiNIGJihOIfTuiUVbWT9duCA1AL06vjOBuy1/E+9qVnn7V+hVu/R8gw
4RpNRIXYxyQ7hwk/CECD5pjHIFgG1Rsf+ne63b1d2EJdk+YIu2Ck+9SiLcYj+EpUJq81/qm2utLl
GQ5J3R6hmmA8RVluD/jjsBF3m373+jH2R0IuFMXSKxXya9bmwAcKdJUyq+Xt3BExAmqlaPwqAiMs
z2FzeeEACoXuQ18I5jg+ooM6b6vIDYRtfjPB7J5jRVz90X8t8Go8elh980crnDhBG2HZ5cToSCHG
oqvcs6sLYyvaaw7i43n6ovjyf2qytDMkGxK3AHf2y/eKNazpQym2KK03yAva1ZUp8F9kv37/5kQu
n6CkCUN+eHK1dHfsdEcABr6/VVnqj0oikrb7FdJheVUdHunyjUyf5bCOpYQUGiRSqN5s0lZ2LDUI
NAn4roDZHL2dAT/7jr/tKuTA+g4pVRKqt6eWTRyHzL9GnTyo7IGSv4F8ZOZyidwX4P87qDnnpPh9
iJ0vChfSRNHrjmvqwHqlBmj9PqafZumviPcVIqlgGOqn/xt6JB2VhXO+7nAHI58q0tJifGtpoEJ1
qzJ3ydxeHrgfobvgMdLxRhab89p3XWR8lgD+WQa0Z2Faf+Fe3+KSWYfZeLaTzvHmjNtbXHRcXPKG
kj9cng1IjHFSz6Io9iZFxCx02U16OWJ052Oxf6T6YAx6GYscLK6cWf37KOC/0N1TRMLwbP47Oa/6
g0W7SyRHfPjnCbHyZ84Z9xp69zzRF9lG+foElS9+KHSEPuUmbKNcvwoal6X8cMFY8O0eFgzzw/ha
4CamYXB4b3pOq4sKc1XM619nfHj5yk+1y32603rC+PZXgk713R0DgifdmE/2b2jY57HXXn8ogkJU
f8cXM6yx7Y/zr3VMiXwdLUrBybeWrYWP+ucyLYzs6TYZZvpE5nc3VFTAsXBBLnqA58uWIlggAve3
zZ/C3q1OjJ7itJtwPGeRkP02bqwboYp5EE83cOPIOiKc9EqcB370phLMgr4s1pRHPFUyeP1FWe5I
fgnFxH5zx0oj4lV0nhDHa45zD9QM7nrhAAAEJEGbXU3hDpaJlMAJfwRLcQdpaoSr0MyZEWGjgoOZ
5dMYt4a/bvAgwTaClam4+mMCraJNhCCJiXLI+oAOQVXP+axactSCoyU8asOWzPnORjtJnW+eFrRH
UxYXgXXl/WfDwlpM2kB9yiZqpnBNJTvDR8ErsYZUvOBSp2gVI/gzZ2MoDP0dd+fsK5neEkIPKSlb
SiMDxcojFuo/HT7ulINWZEyaNPPzybTh08dQ1Ke+fjCog87jmDTdZlzGPD92DQQ1OYBvV3tWGYG7
9f8FGj3cIvrhIpnO9Lgzh3y2mmftrO2iecy0Fcz5jk4HLEI+3M2WGpVf5+/xB3XMUE6d3k/X94FT
CnzBOQuCzw9Pdhs003/mZ3s5OztzTo+FEWNnZI0gY7n5z1ExSTaEPf+K5CkxMLf8lm2Fh8wCprkD
HIIMg3FdKKVmH/LQRGKRJQjz6pX1zYpqq43W4SZ9Cl2JxFtiKKNd3J0fEcxreRLcLb80FNJdilZt
PReePVi7i3vPGNHIwEEWuLBbyD9HCOCDxOFJDlzg7CKiftC1ti/mmcrc+FKUlGWtV/HjzIQeEUsy
0ZSp/EtB4aA7fEKsYDhmukdIywsCQAf2to+JdlahYMrYyCbzgTs49DVCJjb1k5TGak7YnR7lguXV
Y7szVvKhd4YZX1hkQs/NmvudsQv9jUyeuzSFyw2qlQhE1widV0dv21b1IluOY1yBsXfuXtarCfUy
aaRvhN9KUy/OFaogQtXbw1dDT1KivaT5FgSgWre2BwvH0vFUqGcL4aj0SfAi5rbTIGuWuqahZCYU
yEe4m8bsrsjftpBI3XqolLBszm+tzrd/7DIXXa/aS1oByDB7bZXvIlUiKbpwKi4hENHHEW3R4vvz
+QBxF3z9MZdin7rD2EgJdeEJpveTzBeT+5kSBm0L4+/rGrLCnc/577T95AGwOYQMmOHAdVOGRbuh
gl7KiBxOFyd8WAzMJjzmvreFnC8+vQo0xiBKPENQCN3D2KwiOO/vfx4KhTErW6CeJPMJvKhP88df
DfcJyj8mqsyqpXtteuHgr5BNUaDlr8xUYOwOT9fqaR1Zw6a2ZPAkJDlXUGH10+229C6zWhzuQa6d
2soowobrsic5W1V8E5IG/8X5+5mcwi4woIMCPsgGTle+Zil2gh/3Ql09bOwkqpl9DacAF+IozbCj
4baiihNBHD0kRN7+IxXXmbGdhN+6EAizwk+7LUqXOmtvjDtDIyScdHE6RfvozlMYtsNO7otfeULB
PI9ZlM0+BtaMRs+YoeHWeqqJty2m+12j3IiMTkSi437/7gzNLrQRAOvKwz50YALz7K0SSee7/L4S
qQmb5/gxH4aDumPiDiNo8wZx5iLdRg+5o4qFrq+Bf6Xwuu11cMXA+N7BDBsjxC24QDgulAQA7Oct
6drPXrEAAA4fQZt/TeEPpSZTAFERd/+F5u32vKmTfVvKuM7HiGv+Z6LtLIl1P91hykY21npog3m/
V6JRbhvS8Xr076m6vzFPohG4nNej5xRohZHbyjo5RpIWg5t8GZ4OJ1E5/8eyyv36rC+NOHsk3xuH
RPJRIiuCmnduqOmEunFgrLeQmcqW+kPO2o2j0IC0WhpDc7z+Bi32Ekk0bDMS70ODfiKtKmvXnZ5n
USahBzgKziH77P75YeZcZpH8ngfHccVLgvw8QqBRMaS7adMZlKk0wLKQwuDFTZNgvhxsrxLffVnl
VCMJ8629rTB0xtcg1UT4UaidPcZyXofWogTSwTkj/hifJe2UTMuwzJ+dRI977HejzmkNpLf+0t7r
njojbZ+rSeD/SHVzFy0jsIomWvGSdLYT6KQ/3KLLmztY/DRQNKq2SmQNCQZYsfJT1/3y509gXubC
Ek7GcB2x/NZ6H4AComRoVrutB5OzW3FhZzcV4atqkFKAt+asqKqii78yAhunLVt6oVDiWQNOrKEa
LcuOA1lEzXB+PekfG62L+UQ3dERzWwQlppmIGZZt0XEqKHhKYPwiYa0mOZZ/43ACxNM+5HmqE/W3
ofxHuW8+R78qcNcUb98WM96Q/+lqnWgI/9aHqZwE/BRFnAOfAnSIaWP+RvY2AaMpLDaFUou0nrTM
3QBlG68M+obSle04tk3e9l9GTxN/wY12pc98UZzofimQeY81PZ14sGKYUrbTzvQGYqcDCaW4/Z06
1Rr9f4yfo8Brg6Jnf01B0STAZ5UtY1XYXpT19Moe+2MUe1ycOl9nleetu/AvB1smCoebkY4p9UgY
zfueuMJWF0vhPtkEkZI3RU7Nk9oZ8qknDjcYv3If4USJwFxi2hl3Mj6O2oAT8FVsoSJrS0Qc11TM
oCp1R6p8loUNaLL3cwzb+zYGoa3Prm0oheesXoelFrZb9G2m22Fpo+8Mcfwdtcg8wOGWCN0uAyRo
LG+X9KlH2otWKg8ZuC7U5QOP4S/7u74yxsUqSLWiuPKqe8TXA1vEqN8Ih1Y3rcduW9B1aSHChGAZ
tam8tgVjtqcAy7z7G0XDr00WrrWeLHPeYeCorNNn9OnZVYdhjiR3r0qzYmQLKhWbJp4HHXACjB02
ckA1lHI68zxCyyI4lPQU6IoEK+Y3ayStOmjke9ZpRgCt5mU3Ql5afzGHhHDser4cQ2DdKP5ppHbN
tVIeJ1c1o6pfUXXE/bpFKnDsJZ7Pukpy94Rs+huk2zfFj6YGX5M0knvqru6brE7q7lZLHODNiJMp
+64ECPVoZEWBcSdKqzJ1wSe5wDZ/ZmEMXgfM6MnGFyJ5j1pwFDQuloGU3MuS59vPDMl+XWSxlT3v
qt1a5nA4lKsSWWBGYJlNsVI1Cvk25hXmL/2D2h9ZcGoP+W/s6W09RtAxPU5XuddVQbCxDDC9HI66
ZyzfM+XPLdQPO7x0h8N/OHiJvcjPLZPNdwyDhZUzz+ZVUeq0eWMMzkuu5wU4GIgfb7dyLHqZHpaW
pjZW2C8QYgZZ1FyESzRFsm8arAY4qsIezdh/mbaaK/a9Zxi155YPXpZjasRWI03eoxmU6THxLrIw
kEtpAqv1KiNJf483eq3hSfYOozJBi6feMm296rztNcnXtS64sti0gZbLv1F4OXxcgzK5bDisrEHE
2e2nri/VkYDJW1nzS0ipSOkTULXeTjXxakxbk7CbE/ay4++LJH2B77wcxGbpuuLd4AqYbgrKxX/1
9/xFkg7bWY1fgJyrlK46BqH1hA9xP1t1VSWd6LiF+MxAhaH/yuC6S1BmvayIGHU9OCZUnKFiDqOY
yH558qKXdHJbzPOerTIY1t0aTerReIZhySy0ly+zHXIoxxfyd2KVslH/nWE0XuGVM6N89HIkTytT
q+cA2YqEjQwxtlL01WRwBWAavVL+KglilbfNsCCTzsJQZCtZ2F0MMdFXv6wfw2MRIGr8mvnXWojs
VZ12DTAm0RQDhHnuMVX0iAO21XwKYuQdhMaaCyhxp6sGVfrIl5ztHH+f+pvvUFziz3kAGPb+nxVU
FNaahS7YYVDEVO57VljJsi3Fd9BO84TFxzpEsj1xjheWq4xBpvi8Oabulr3QzGc5pmBE6WlR+Tyr
ksG7BCr1JxEjisk3sqXQHTrO9gi4kBabQfWXFfZNW2FyEjvaaMYsT5BRTnY1FAdlpy4g1oovKsaB
1F3Y2XGheFDCbV+LQuqCFjGF0sBczTryqD7hW34y7ksxXxvJMaU1bd5EXMhf16nOz20qVKHKjvel
wOU2Bi7egmx8WrzQ/dtOFLfB4gboWAMIbiFViKVWSvg6LlI/I+0a/13kdESMiMNdY53a1A/sl/ps
gRdS6t16msqtTKAX5KTerHSykTrWbyZ9jkWmBfapC4xVn+7Dgg9GkyGGII1vjJE9faeyyM8T/nei
kBbQMXv3+fEwaCJaTNo2MxZz20ViY2oNDsk0T5O35uyPICD/dDqe9ZJ3h8+5DKan99mD9So0ZTRm
QPBco43HT44c3bc1qzi64/tykLqqrIXqrbgsfR9xtT3MAQFV9SCssfgiZCfUjhaJhlqoTroXCoyV
rCszCMQ6K7JnCwpWBzkQiAzHGZT9oXDcEMHSdqp7z3cBT0YuIJQPh/DLCw12DB0qgwhA4KcGXzJJ
Ql4x9bFSL0Vh1KWgZ9WUHlvVqfqg4yWio1NmODkZEWkBbmnUpf1pEqlH8wD+GLlapu32s0Cf99cD
zwR+/Q+dgfOJYU4XGVBxjEC7ti9Ls0gG2+opTC4p9jfUT6AFda899LscULXtOXuu7iO/8haUBXXJ
lNOgVgGKashkyKNSkaTypIHQf/dht0KFozazIb+aW++o5bxvNaph8Lc43GM/CA84UTLWAQ6jZkAZ
uoJa+eyBPJFCHNS+R3MBUUPQ/JN8ncUeS29LdXKblZL+bGesOxGTlWSDl3mTacYHj9xLXcYn7m76
x23R/qsRyO5KZVOPs+CeMRhtOn+B24Vvfu5Df8v5fP2c1+woFqwz+XfuYaTWbw1o/a0a8XxjQyDi
CZ9AB4i4kznItomL1IOwdajRvj7/8TMQfsOHskBg1n1UglpN4nPgwr1pETRQi8yNk3sVyTLXMAIr
ZXU5bkOHsFExaUsbpKtKEvB8mhn/K3lsCos2lN9BRoktsob6+1GQd3H7df/lcMkS40dOyDtb+BD4
ac8eXhfG3O1xyDOegtCa4uLiWSv3x+RhUtdCoV+7DCdowKQR6MMoMMnUhxgMI1HbDEJFlE00ajwm
TbA9gec7K5A1+xn8hIrSLmilSehReYlOBAv7Ahl7lpRZlOmNvoBkN+AlWhh8fOwq1q93SKyWQzgz
meZ5CQmB223TSHqmlYCk53rS31jBBI9gVu7/2hw/M52Cw5zwnjtkNFUyTUJc/zksEPqw3hClr89k
JHgjscb3wm7wwDMpyhImmnQorQot+ZwHNvcSjcfqt1/wB04L0i2v5L4TK/RzFFwZJFI0jyJ8lqum
w7Gu4kZhlBveOjhMDfx8QpM5qGL0Wwc1tfK7xI6k8jN3nobwg/T7DzBPoSRtGSmNcFjIc9jqVwlX
KKQoBTzD7XPhbQZiLznMoEBG3ZcLVk2Wo1C9Ytk4qQj0TnPxfDmIvbp8aw4IVh572ABPWfnhMvCW
WDGj0youPOaqUNWWPpteecKt+7ORWivLXCB+eATWqZecPpdsoyh8aaX9iANS+pCFu8iN88r6xftp
27j6OHaPRv+we3n3fbSGbVL4cmquwKMfNFF4zTbOKbbqE43CBxnkOQMdFLE3MFNIrPi2VPqawOAs
MGr0pOKCrfqCxWgAQZw37mxRLB3sIGVLmiGzKGVKRyxmtfSRdTC159zklxSUUglq7CmlHwTuOiv9
bV7FUzTQzxt7rI/zkelGKdKyockVB5AgA6W2d8Uqj3te+RkKLhq9r7z2TuurbWJ+y9pZ4D57g9sG
34SdNc08r+HG3WONJez5KMGsUFhCEXMrqvbCvMkfTaY3gFm00eNOy6cGVLpQUA43eXWSymedqd4P
5DE9alCvGtC13nfrAYlzbiLKfAM5ugczHQtHfqkdfyCHc/l11a/nzM/sJKLknOjJ/x5ZE8y1XozX
yQ72ogLpSXxqeEtKLBwC39Chk0F92FDWdDm3oh3/NVcOQjVFokESTMntUH/M9FmMXP53bJfpr0OQ
Xe766rmuxWyEJ3liMTYS8oYlcq11o1fUS3nOAaGb1B1tjrtQ9FQd8562llNbQv28kbAnMtTSTNF9
zbU3V2eXln9U0E4NxL2zLXKyKZjEY7EffciJFrT5tNnIYBeEWHO9okrnvW/6tQeTiwxjOipQ2p9i
VCpZDYnuaQAfzs4UkAJB7o8lzHKbAKJjVDssvPJNg6j9HE4Typ9t+W/LngonyvmgpRYtg/jgNs03
wOD+Y/tpMlH8xxLiiHRkuCYc374PCu4AcBLcNxpDYhTxB6bICJ6qwU0PLUWqUlvqISCP2dHl2FOl
M50Mg5Up+t3rAGW578LymEQYVR8/5P7wsOBtR5y/AFBacwkuijJ2jf9uOshhPt5QXdEtX6iu8Y54
26SRhejUys4xPjMogMORD94Ox4VFn21rWAfuH5yjM4ziw3UJfPz1g4Byq6Pz+kJJIJvjoFLGJCJg
4gDLo0icAr6NX6inz8HEV02Bb4KmS9NaHPUouMJ/S85S9chllrQuvRe9GBKWonqU5VXjHY4qpIAV
O86HrmdpG3Sxr/cTgrZtpPCyh1pZEIhMk5pqem74sC4mX/wfEpHxKX1nNXkba7U9s3PKgO90QGmT
5f2kkzQxDpP8QscgTFvkZXvB4AOH9xmgdqVGMSY7j3/yAAAAxQGfnm5J/9gBWPy4QcG2ebiC32jk
Pcs4UiydnAIqwzTv3GIi87DfEnHVJ29MJg3x5RHTCSGpWnVqRbplFtDIz/4iT4vhvQfyLTfEnZDk
fbN8C6rZDaymUB6dsAotigaLY0Avj/90+YNoUEB3d6OF8mGPHw0ftHsFcdKlhElpw1I51stJnoIO
xW6ITl9TgqpGqSIYDE6r4oUKGjJvWbNQzqfn0/mGAaTIHYsXp2EQo4bfoFtiXneH5hYlucceW9k5
xrgJvkpAAAAIvUGbgDwh+TKYB/8MI7QdqHfWCSbNAW7pTodsyeierOoiTgJJBuhnxafpqAZAoWIO
ezRkgTQO/ez3/XGhxKJgTkHDWWaptOiCFUC3Bjs2w6syG2ETjNig363qDAEIU/9Ea4a21OE8Ay1e
/zvz/SkTssjr67gK9gMSHNbP92iVONO6lYZ5iVhUCQO1Tg4n1vy0dcks/Ir0C5p+Hz3B3OZ2icPJ
ojG3I1TMAVKy/sgdvlNBvREarm0JzzAdfZFYhcGDPSLOm8XLyKUpF4gQ7LrzDiGFSkdvIW9o8qVH
rtKf96r683sG5ka5JORoZXktVxrcZZPn+tScWXi/0Fwko1kji5B6N92cvs6sc31qPRElHH4u314N
47bBba5JqFXgxlTaV5eC98IzznAmw1F+S6VK3LPqBKOLT4PtD2Hog5/VPDOmOJJv/KwnkERbGFsw
z6Mf893zm/43xltulre/V2k+k59u8Kr6Iuqc0QEAKJTjf5J4K+nqjQZhB6scYivkflHrkvxg/CCz
TPuPj0pO7klAp0J0uL62OxCz9ZEHHfi9H14bGYugEnx4S1TA2hHwcJ5G2JC0lkPJsS5tAvzDehU0
56lcP93SHpUuCcsMYiotNQCzDNWyt2AOqdRjk2NiWjg9374jPqQOxirZaDrd3s9/3yE5YOJ8VHdV
PLSux+5iR6jyICyoadZkBZqI/8OdwMk2rkiGHOyxuB1m0dVp0fg7TowmihzlOkkSXW9yxBegZHz0
TBLCjoidDANlyYrOBYatk3a0BgqsZ4kTUxRN6qvuSWDppQjqRNxvmI/Pe181wy7z6GTbp+vgWInt
AJXxv0I39x6sWwuDeHxA+vYzSsiKtwXDc6QCG0PH05owBq9sOkWMur0zzVvMnNvC5RSR06Z0bgVc
L0dc/U2YwVuO7vqudYkUrtGUF7bSjDDc8pS9WYvRnsDTXNQvg+adYxYDl21YiU9lL7k+B0bDxZfW
5QCkWRr2LpsfdwLqD5rR5qLMlPurfeDkp4erZ0j9oJrhCWN8KM4vYvX3F73t9xR8FHv2uDC8Tf61
owZh4p668yd3Nx9SPStxCL1ANpv7gXdsIS9sWrzPBzwe3fS/qkPFIqzRWNtco4AsOxB23wkYYCrj
YFAFe6nq9C0/BJiVaTqMRiq3MuNRe4iBHCVFS7X1HoOEi4mLBG9+xBnXJ2Jc3RSvZ1DL2c960rUJ
haDQwQBs/vhXkQuYBBw6x8zBxHrOFgkiPY0ohgPY7l4JkjkeTLJ71Q5LFXtEfDyhyt6Xz9J4vpCl
V+FMRL8U3WbE3q5YVm2DsPP2tu5Xjyfu96LL7XxuQO38wSGktjVeKcbx7nIaEUA8Nsub/31XDf08
8Phyo3qUxM0/5QRphD9M17E/7xyObuJ0qQRx77tM+0cQ/ZLQ8rx+1muCIDevkeCl7eVgnOZhIq5o
UPR/NzMrmz9WkirnUXHVUFti19ggT+R4Oi+UBwThspT7wsr0V2z5PU5dQmeMJ23n/eUMUWZbU/cP
dwcwM0os51AGkVQstSbmuQlPVank1C1MBA2sYtvNo67iX2RsXuCORpVxD5Y+6epUmCAXmIcEWJ8v
KFOzu7v3Tgli9JchUVBigFqfZz7JZ5W7SuciK7sToQMTvmgg0Yrd47IVo8wRRIAuG/8/JPWH9wsm
qAPtQY20RnZjW8CMh05VlJ5EgJnvTEkIt/JJaLhwYCkKXI9ACyY4YU6Yt+UKcyNcLaHPt7hxdZBC
zEqzbymh2U7rvs2rInZECeX5NCXWjWGChp7GyV9DO/jSqG3EbY3hGt10+fs/bT4Od5f/WFwEQx17
qNQzpop3tc+4icZY5BAgCwK/tGvVOch4B6/5ospu+o5cPudNijxqsg+wOaGQN8Ig9qeAovfwwd8u
62LIziaXcm1byenZQ7STJdpcOyzx9rcBw7oat8ehMJl5Wta5SEegRfwEEDDB9Yo7x2Y8VOkiWrxk
1lcdfkuyFKsrYKmeqPVcWYHMPC47Aq3zDNdLWWDj0CvJ8vlaeOW6tmvI1Zv9yT66q4nNOLBV/hMD
uq2hpo3eKTNDwknzer/+lP6xSTUy6a/4hEUYUT3S/NyGiAtfRWvan6kXsF9JvasSDXOo1lMUZqJP
TdMG5Y2yiIBcMAlP67Nn3qOge7VTMRf3plZjiMT6HYmoObnVG2nSigsdmmIB/QdvFSYal4SbxxDh
yfzAHK/pMKR+e3+SHZ9QD6mJhXLVBuwuNqryBiYEe97yQuGl4CMfbAEsJJ63yADhzHmFZHs4FJXs
Sps2Xow0di48NLRc4AlLoMjxKrkBAXfqXKcwTteir5RJdqOEIqEEdyP5g9QyVUxHfIIRBcuII72X
gFr8F5Kk9LUwVDQPVOjyn4HTXb8ZxWX6phaRBNMvnGkSo7xh6ulc0GAWjieUm0nPly2QPckNbAaW
aVberMiKvLdCI9rD2nPj7wffcnxzwCyONq4Uy4mXso7dlu5hL3lDJk8S8Vw08AWyovQXY7twGDdb
Jg5h3lWz5H/lhpFGJRMnCvX9wHVBcNGLOA8oVhgqcSG7DJ0GoZtlk2/zdR9ilLJnur/FI0A8B1LC
Kyhto4pOLxQsm0PxSqzWssZ/tXC3vgRsYA9ZJhQvhs7E+VV/riwjQoi8EbzWGz7vtmJlGqMs/ncF
/4cqoV1+vfFc3v34/p/7yA23ccP9V8ihO9d8VYWD0R4UEN/BaTgT3s6JpBjFqlXQGo6gafwT3YcU
IkUpVweE/JA6D9PWiJqq4vUCHcCa38fpCkfuL/epaK5qGwgt0K577iWUuKai53AsfoIGZxNVwkXX
bHnzHYGbaUmTi0P6AJAMBoNnhyIU4EegZFe0UEQEL8TPoPIYb9s2PooNvsn+EoFHhhX1U247STqa
KWxsl/w4rHaSgnI3AiZTspsq/owiZ2i+iXqEgxmzX6038L90XJ5hLYfKVfSOinRUZWIKbHU6e1A9
hKcp6BjaD7HeEHToJbOK/txmqxwEvQuzAAAK8UGboU3hD/JlMAIv/3m9o9M/0itV8dm54F6/QGX2
0mS/tAH8tjkKv+zfAyc/ja18yj1gt+vDQFZ0rAQgB4JPqE6eioiFdovPVs9TqIRd910cM7cyzOH1
Wc99hNJgCRoj5hNpI5jzyl9d+HD2YUTEV8CngFCQ7EcDTtDz7YYJdQXdTXNi7Q/Xnqn4ftZjZPN/
XP+LT3748pxSHEMGBhPxF8X7dSNzDv0x61LknyxmZB6aX9eQ1rODkGpEGWmy7c0FQKkFwxfWVO0P
x5cprckx3M6xGgm5CQuCIXL7cq/tG+MJ/2h6Pcz14hRGaFHbYhJuo5Z+XTkuplKQF29N6OWkDE+0
RnKF4TYKajySJZBhpvoN9OYud/xHfed13hM+1sRSo41ZT114rMC5WB2h1h+FRVLZ9irgjPwZ1A+A
eIPMMxOhPRoDKsTq1u1ymsu5Tront+gNyOia7aeaKFDbIP5dSOBQW1KSGkR3qQOM+hlpW/aBRVjd
VdiWJTAS4gqNADBLRTVtbQ6EZN8u+xbhMYrMdsEdwTOn3D3D9hQYKyTzxZHsobNWondGSew7ugwO
7ENcd7owb3RcF4taR3ijvGY26mpHC5ENufXFcwtHnnYLf2jacg54BkexJoNtSJWadF9GAIRZoo2Z
F/fu+QGL93QlD7XwdGGs2IXCoxDit8AEEAlN9NVJ4S4VjxRQsYfuVC0D96bb7jO1Kl1t44rUK+pU
0qEI9aIYehJFL5w3nB6Rejfb8ofAs+jablUp+RdNdv3rG96b7kSiqyzZtMi+BHQw7+ZPsXFRIO+k
GanrOlwQPlAZutjyIJxqhlWFfy1ZCT3pof/RPh1mHoF3PHSI8/qUll8GsADRGDVNM4aGQXs2Lfs6
uR43KBJ5CiK3jeJ0LgAGqkhQ4l53lDjCD+Rz+oJ2ErSH4of8ulmkDhYQCwtLldmCJ4VP4pf/3j5N
8ScZaXIP18wM1zRPH7sp+jMGg8ozsJ22/KpKxms9eO/gD2vu0/Q+riewVtD1YLgtusN+Cf96Ffsc
BVjlwI+2NP7iGP7IoJe3g1m9RCV5eoGK3+BtgymRENhRC4xvrzy6Ag/15/I1WRy88oOaGCNM3Le4
3CKVPD3hZ1tk4HmpEMMUsTVyb0rpGKXV2ny7/QkywvQbgwANH+YY1848DWx8TXKy8kqWG4vCIUwx
RNCdr3gxlefJB8NleHC1OfVJgB7KXIXj91sXDmBYCv5i18zjuLFNt5txTpN0VwCN50pCI9tjh+DK
SHuoiZMzDaXZMYhkc8Wt0qaFK3CYdCy3L5huTOd3mfXggkZ1BklHN0SNQnRRNSE75xCIU16hIGwJ
nI5YvTPDsK2B2MPz7kY+nV316xNQH/EKVyG+xGdyl08TN5czdkHKFDu2+dXEn3dhjADzbJHQACj/
Ucmu9wtqXcgXMqlcvBykyB7+7Tn4N7O8UxRwHJFbry0WSxF1NPd7bEv8W/jGIh/3wa48uWpgtLkE
4fJDGoO07P7x2Q6TNbWhjI2a1X+ilBGjOtaL1BFDqCPFkRjZgiOm/fSVEJqSEVkcutN9AkQXxsDw
9D+I+jXXi0F/AOu2kkvx4ICZ7BZ7pY+YMiJOQfFDzGDyVfxvkIjQ8D71seJC8Jg3iUOyZLnIOY27
6rFyP1SFIO7XQM5mpbMx+qD686LNA0EQKVz3T/tpgA+F+71kmRhSN7LLZ2u7u9dOLxC6glIqWC0G
PYx0mZoLwjAqcT0Kc6M2wp4Ei504dOpQO16vzIawnJDGZK9kzIQ7xjtKjPMh3bOTSdkThiPYNNOP
2nZ1v7HS+d6QatI2zEJhMrKHj5W4+1h7I3UavsjM2MTfoUij1JDldmoz1V7TTa45eDDB0FwCCS2b
p1/GmNDY3hI+Qmdtx9zk14zeJwl/fndYHL704RtZiTy4TIfb1XACG8Fbr317m7JDiGbTzMh5USJC
x+qLxTECGdG56/f+9gYUdJgmHXRZesWzmUBXnvDWC4jHi9tZhghUCZW6ybAEwb+JhxhKV2GrjDDt
W5n6FGongl/Z83YD7TufpxIWLRQN2lSzDN6cus8bvNsS9zd61t6We3v6e7SfAR+rVNIopPgkwOWE
KQMHJ0bV/DUQDVhd4qxsEO0hyLYlcoiFHpsIMTvjnMuLnAofAzmHfZiljdF1MceS8IVnPHN0ePMn
Sx4roSXD45ZE1VY8+YuAQ9NEFNjnjiraOdAzUXkwlPUXV8LXk30b0GHR3GoYvkSfjI4Dds8/AwmH
HPUGjQQEED+UYHjJ+TyWhXXdb813WavEwlMkWRxyprc6v6v59rK/0Ce43qkE9UN1sDeG+BEQG5v2
iP0zxoAYXDqLh8tMUUdD++/Gbimm5/qsyE6tNR9Qf1QPWd4k/kGd3PxHVYy1f5Y1DY6ilska69He
/yWouyYvU0wJ00eaMB1RW1c7xM0cASQXyVrgplzMUVe4q8hf9J+IkP6pWX994IUjTW3gQuviIwJF
c8vqcm9HHGBdgKDaD6pW52EKh23HN5w9Sk5AugMlRsOTBrSf0yK8olJC5Ji6Y7nU60EovEEDm6e0
qYLSVW5W6Hg6tZwL5EIsQvz21gVwwmDRQFWno2zMLrg/f9KShM2VNsBP9vvMogRQERsO0YKiCpk3
jlp8pAxuPIOavcVuntsq6NtyqSoF0IInTM1XPbVEU0fFpRxsO1cQcj+n6IO5rdQS/KEAX0CB7Dza
2bfRtJdBLuYdUFsFL+KZWoe897IMOdI3rfHOSGI2Mjh6kdrl7SuGvoyt/D1zIZFmNVcB3rTdpouL
+53ivc25Stls/sWv1vzQwueKY1MJSJ8Y5zn9QSRzJKb1eEspSAAeEM5KSNiQ4Nfe7m+lKuFGX5NE
qVNpKi1ojqOEiIym9eYnBMHjJp7NgL6L1KKJ8TvD4DrUvZKpZJTdjocatdV9QwKBshU3U1p/2veb
vdMwe4o8OZaZbyd94FqNBb0SC/Z0piRN6J2ixe6Jm7WSJoe7pqFD68JQAWfsrmHIoYIZw3Jjqleu
K0uNyu1++saLfrhztf6i3Dde2jjOogbxt2S+tyigfw6NoME2+1EpJmuO9eyvK6/F6Qf/oo+/6fXx
xmmMZzoIwNyIjDOOKx1fXh41fwyDLWUtgYer6UHvyKqUAUi38IA9yxLRkLLUTLCiGW8jiQg1EZwi
I3fSSINbR779N8fg/PcBh1pj3E+5psldJc6jZO1pfABUzF7xETd94hMkZ63DPzYQvBmSpbSy8UWN
XL4wt7mp9gZY7SNtiM6I8BPNVIkW9GQxxyXkVVuqI14HYE6wtjZBMofKJ2NoejaRQ8OYSEE0PZTG
1WZhtKRTBKck62u19HrqvmUI2flb7HiV4qqqm16LvQ/CaxeVMpv9ShmRcMA73XaGrvY6hHMswBbC
K8PrLFyadPm+QhBWEa66Zm5HlKU6zvmiHuV7isR5v4ek7Fh0i0hrAMe/ZwWFMI8rCDstqbe+WLxl
YOBISKxaRYROp5keEOXyFfe8G9uVxewLpWAuy6BoYg4I0Rio1ASMLSyNbr3natKpBO7f+bNPBXTM
wbLw4VKLdukqO0pavqbqa4+OZbURvz/dJDSiHgQNKl+Q3yojDd59Yt00+eX8cHa8NNMhrwu9USuW
SWtE2TEIuU3XcziS0Fj+T4LsKh3TdAFnwbPJdNxLB49hpyE/2+k/7gNtpo3oGuQzz90X1cxFp1Iu
p6m9h69UUMVAL3dZMWhFBMRzCNbCMi2l/gs5gNOe8TA+Te1AIRqU9c3PQwaB7PIsACdVQsvHROFL
44f/oRE4nhRkUS6iD6xDE3qd/swmYsZYgL/9Sn8GDmn4BEAOv7H8Lsfwmx9jgGxOveE2IAeEDYnX
tj7ZmDMXIQ23bOQgHIdtzBmENs/t/tH9v9n9oH97+z+/+7+1/Y//gAP7z7X3H2/u/dB/+f2AB64W
sw7zJXDtXq5m0Umv196w/Pcj1Db+J7PmuzcxyxR/G8b8jW6bi9vm7szp/Qyduc9icQBschAgkAgA
ssCA8uXAABaYKLQAcg46zMHoHoFBF90902IFs9+f9OQ5g2wPQAzFtmYMx7YAch9323kP94f/p/Y/
vAf2f2/2/2P7f7P7n9v9j7ofcC2gC29BtkNk4y/TxfwvwH8B6wHtALxxzv5Zm/S3VGaqZcG45J2h
3/Sn3vM/db+sndUf6Vz3vQ5r6rlTeMgNOk47e9j60w7jfQ57P/KAfEeyABeAAAEQ4CEaj//v//BB
M3OUWIAuECiECkOGgjQwgQuxP0POricPGkNvXomLwlOWucEyBJpi0THqQf2D7FLwySMBwkiiQUVA
twXvcEjT6CxQT4CVgYzGcPtn/YADQAtujGcE5DmH0PbfdvQ9s5BmPr3hOvAHhf+3+3+4BbT6cAHs
/Z/EfE/EfEvZf53xB8T8S9n8QAHxB7L8vez9keyAB/dvpz6b5D5F8h8iGnAAafbQAGg2113bIBoI
f7dc6f1x35/t/2650Drvp8LwPDAABcl7iAbC47C5AE4QYAdQ0AQlAHIa3ZwrAAPqdbilw23P2bZe
dzSBjMGB1x1xbegAE8TxPyJ8GHum2B7p/0DbOSv5iZjafmLbNs5AAcgzHtuYuQZjDMJ/Y/uP7AP7
39n/4afbVt6BbFtAB9s+0Ptfa+39wH3ft//n9gH9/9h9r7v2/tv/d/7f+h9t/+P7P7AH9w4hGo//
z7vwASlukVkANicdjcIMCAJ5KIAARkWCEABHIc4IekMgQxALRzBLzNjSbIZOAgnY4QTsQNjcKWtC
+he6EIACKAZi91/Hn43HTbL0G2dB0/QdO07Qf+zV/t+a/CD8j/vNjgGxvC9eDwux+v9e2Psfr+x+
vZjzFtoZizEAch20NszEGY/QdsAOQAAH939oD///t/t/s/tf3h//v/8ByHMPIADbds9C5AGYQ5AA
B/15CAchzAH/XbOQZj5D/0wMtBF2z/LyDbQ5AAf3v7//z+1/aAJm4yYA2FxAFxAwg0lrGgoAA8Lx
1FFA5D7vmPkPu+TS+hhmHbcxVuULbtEGxNOtv85p3IPQPdvd9sDMPIeQ/Udt0/Y4dfAA2zbQ2zkH
uv04Ppn93/uwfTB+XPiXxIPkH92+I+J/7nxHxAAOQ5j23kO2Zi5Dtr7oAD7o+0Af+/3X/qPufcfb
AAHAIRqP/+a/sMErbXJYgFJLJIgIYgKAJv40AShDoOFfUCSUneEeydFIw2ES5Qjm/GpPwltyebv5
Oo4Fr6d7Tyq3hQ21wpJkS1yN6VlQPBvy3XFtddW3M4rb7/tgPuAfc/9hoIAHf1tddTIK2/z9t9dn
91Ppz5H6YfIAH0g+Q+nH075D+6A5DtgAGYQzD7t/15AAbZtocgDMG25jAAAAANtzDtuYg/wDbdOt
rQO/+ue/rZ0D/fQdP/OAH9i+l+k+lP7CAPVvVzvgAAO49cCfclvkgBcVhAMhBoB9+IS0IULAX8UV
L4/DuMtkKo5hgnXNsERC66ti29Otrv62LYDQLY2wNs5BbH562gDT+/OudtDMIZjAAD/pmIOQ8gDM
D6QAD6X6T+w/N/2F/dv7u+nAD+0f3f2h/+gAA/x9BAOQbaAB7L8u+I/74eyPyx8TwCEaj++u9/CB
LXcAuWwyECGEDILDOJIunGyA0HSVbCJBw5LrPJyGDgkQhI8K5GQ677cINnUTKI0cYTWDvP6mRZGI
DRmL3friohWRJwv0fqMzi08NA0/Qba08A2wNB0DTwDQdA0HwnXvCBtobZtvIcx7b/jW5fQK3LgRa
YmUfa4AABtm28g2wA5ByEOQegZi2wMx/9NsAAPtPtPuP/Y/u/tD+0/tH/5/e/v//T+4P7X9/9/9v
9w/sf/x/d/Y//R/Yf3f3BbYadoGgW3p1sWxbAWxoAB/vAAA7wExbwDY3FYgE4gC4QMYQMAlSdToq
a5pAADkH+f/DkPHSkIbOQ7aRACfF2eW2+G4zHE4nE5muGwWCAGYsnl67/P9dadk8uBl2zkH+b0MA
5DmDMYafoIAFsZjwIuYq1Z/iQlF/8f6eWPtg5AAbbmH/qHIOQByHhS7YAB/cD/+/tAf3j+7+0B/b
/d/Z/+gP/14HIRqP58+786EndwFI7DIgE4wCoQIBZVat1yKEsSyDAj+9yfZJD5MRl5H3pKzx0l0P
2kT95+pyeywVuxiMuCQIP91oNogJRZfXAfz3/uy/hoH+/f3f3+b0LkG259+7eI8gyGAgUnHQf9g2
3MO25g5DyEADMABWjNtzDWpfdfQw062A0ENP0ANBXBoAafpwaf3/wgtBzAG2f9QAAPiQ+J9l7Mf2
B9K+l+aPpQ+afNn9j+kfSv7G68GxuvbHIAB14PC9e2IAeF+afS/SfS/N/Svm/pPpT6Q/I/hv99+R
/CfkAAHQdIAAA5ngObpAdADwAeAT9vcdjkYCcIBcIGMIGA/cOFCklFgTFG5FyQ2WvuBc4i3ohXnc
KO/+h4Ku/AE0muO4LmH0MOQ6B39p+nT8jJtDmTTu7SEmB9JxgAD/+2wOQ/4ZjDT7b04NADQA0H9E
NAB/sh7L/OAPZ/E/EA+6D7oD/1/9ftgHrB/j7nAhGov+///xoTVwkljkljAiiAKhAhZpcS0QxcRS
6NQcuuXmf/KSxkafQE4GAIQOsEvCHMCWIkd+6B34GgfnSIhd+6BbOn7d27oFtaCAW0GgaCFBFAP+
tAl20A07T9AAPmv7H8S/yvsv8/2T8tDTtPtrT9BAADMYbbkwu2eh7ZyDkAAAD5sB9IAAPp/kH91/
u/0/0/yB9MfTANOtvTrZ7+65tm2+Oi/3yAIPznIA2z0PA2cg9AwCHtochycWgGbbyD3fbcxUEX/r
yDkAbZmD3XkAAAABxeHj5gHkA8DyA8STs4jsQBsLksUjAUiALhAxjAh+gD/Jyjgq28Pgdy6tAMki
t2dAb/q5Vcx4sp7/33v/ef9PQg23JpfdcxB5ADyB5AG25goIvu226fp2nhoFsAPy97N8R7P4n/Kn
+X+IAD2f5eHffce+HqveAdHN4IPD8LmheAAAHunAIRqP/9z34i05bpPYgC4bKBxCBAf6AsDB53Ha
aDYc/XdTDIDVsadwSZgOEs9sEYACGQAQACiEeEIIAQAAMxf4bbyDbeQBsfY2x9jgAdeqQ344D5t8
0+a/sf0p9L80B9L9J/1/pfifiQfN/S/NAByHMHum2ZgzETEK3xERLrAXCCD33vft/bD/2AAAAAf4
/4/4f9KBL6Bk4pApQD3b3T0EK3KAcVMtMby7QiC/qiH+v8wckJMQ+2fT/zPnalF1xXQvWer+XbOL
4NTHz0vF/PQbn2CYZLpevzSCQXr/XgABwpOictzjsUisMhAUisQNB/gIa2bkGjkDiqeLT2dK27Ox
Wj0GgGAGn2wFthbNsBp2ggGg6eHfug6f7z67/sH9wB9oms5AA/6AGgb+mYGgP7p9MfTh9KDkAByH
kGYaDL9IfSfSgB/c/o3nX9yP8d51/jP8Z/k/0BXAKyHbgohMHSv9XfrgiGY+xfyEDz7lKsRS+KMK
N3/Cenbz1xzL6B/X4CEaj63f3+OlJW4A2gAyKyAUROECORpZehQtgnp9P3Hfv/aVGEY2ylS9qjIG
WIZbOEbUciQnoVAlyqDj//AOv7E/m2zMW2Zj5AFuCD3ge898G21uLhBZjDMHoeY9jB4UADr3Xw8L
yDbPdMwZi2zY/Xg8IAde2OHheveF7c2LsT9AMqA7DwcGg9/d+/76AAaC9kAPiA+I+J/2Xs/+9bWn
6Bp4aDbGg6fbOggAAH4wdrXSUPzfxuEkk3lDrwYdsaXA+FmkHg84CTgkylg/AQB5kFpAAAAAACmk
AADy+Xy/C84nz+ZPWqRWQBWIA2IAyMA2EDCMCBP5FqgCUlgACphyUA2UNEZh4UvuvoPuvIeQ+75h
e/9wfNfNPC7E8JsTQc/dftsA2PsfkAAHIQDJpf8PQ9B07v7QA0+oAW1bFTg46X/tM4LMBbFth/vo
AAD6b5EAB7N/3viQ+I9k9m/L/ZAADkG28h2wAAMxf9dsnUAAKg4hGpSd2cYBcNicIEchBEYA08vA
FrMHX4ea2DAGVtDyewhY4KQv3yF++Sm5Ihtq5O/Y46UmmiTSKVzcPyegmyDQZcwZh93zH/j6ByDh
CcITjpOFIHHCEJBCBJG2ch2zMAB/3APCbH2JmH/HkAAGYwDkO27ZmL0DbMw5DETE/IYtPAP+m2gA
cgzCH/TbQ5B/iD+3/9f2P7H9gAH9oAD+3+0AABtoByEA5D6HmLkHIAD3X0HkAf45g5AHIa2h+hf2
n9n/+AAAAk8PmeDXMABwnOHTzOcf3/2//seyxx/s/s/C/sljGVWVX+8k2LIBEWTVVBPumwuOxgKx
OMAuEAuEDuQSAD/SiAI9vvwpgFe+4efRxj6//f6eV8g8IQAD+wH9v9h/d/+de69scA5DmDkPIA5D
mLkO2hyDMX+T/J7p6B/gAAf/z+/+/+7+3+1/af/39gAH9n9j//B/YAAWS85995hYC7IRM5vYUezP
tFw9qv/PBKrl73joJVWWsCRYDiEaj+3/9/mhLXRw2KS2FxgJxAFwgQA1pVWAOJWI1oAnKbleGSsW
OOaAjmIBBALQkENh54s/npKHPJlLgbCEChLAyAFkJecIYajQJehyVI2PKQZ0IRhw7atu2bMFw39E
kaNYsbMOYcwZh2zkIbaAe7ZizEGYtsDkP/XbQzBgBf8mYNsrdnu9bl5AShw+QgH9w/ueh7byAAzE
GY4PNJr/PBwCcv94+JB8T/dx9O+RfTHxA9n7M+JHxAez+IAB7MfEfEfEBtmY+Qf48hDbdt9D5DmH
/DkP9x//f2/2/2AD+ED1gD7wAAAHlA84+/+/AAeHzgOjmFHbnJYnFYZIA3EAjIBB10+4X6XAL0o6
ADny9PSDTi0B0Fb8+sEg2CQ9ceICGYRaMAlmEURY8Lk9BKDn5nSGn9+EAAJoQTkZAnwCRmMPdcw5
g20Ntfbfc//n9/9h/eADkAch46X3T/pk5hOGzkIAB/Y/v/tP7lsW1bFt6AGng/374kHxL2YAfIh8
g+nPp3030/04+nG4AHLAAeXzgA/9H8j+R3H5H+4AB/+gd1+X/LchGpUl0c8lALjAMhAgAT+SSgl3
BtriOgdMogeubvxHrmuiRpncnFmyOffiZJWuu+db72P3/FMcHdBwNnu3+T/C0wdfDYgBtu2AHIeQ
eEDYwcg23kIAGYdtDkFpAAOvcIDhQdf68RADrwdf+6Ptv7v/wf3f2/3/d+79r7X3T7Q+6+4fdf2P
/8H93/4//P/z+5/f/cf/o/sAAAH//w/sf9j+l+aH0n9g+a+kf2D6R81/YH0oAH0wAHfHegPVO+AA
B08wA5h0c77X3ftfa/9n2/tfdPugAPwgJ23OSyOUBuIAuUCNwI1waKQ0kS9OpAsP+HsvG50DjwmE
drTOSRsmBIBhVkfien5BigH+f3b3b0D/DkOg23UcUg8QT0H83X+vhsQPtP/UP7QOQ8g2zba0L/jm
IP+m2gE4mgTkADTtB07Tg0/v/7r7f2z7R/7n2gH9gP7v/wP7v7n97+5/e/tP/wAAAPKPtAP/T7gA
AOjnAAfb+59t9r7f2/uPtfdfd+59v7X3QPuPugfb+2+19r/3+39z/2fb+19r7R904CEaiPv+//YB
N25yWGU2IGJSgllkmFtUAcIAjAzBFGwI4iARkUOOQNtwPDUToOEgf58mwyaAde8KRsAwKN71hIGX
/kDJjMAZ6B7rmHkAByHkHIcwch2wA/uA/uf3WmDrwASAjwnzX0vzQ+bD5oHzQf2D6QB9KD5o+a/s
P0v0h9KH0v0n0oD6QAAD6QfStjhxwHhQ8LxwAB4S0weEALTB4Xr4bHAAAAAAAJq3uOySMAuEDuQC
ABZwAhL+PIOEBaIKLBaMCpCh4UkCQRQCiEcdQSgWPeW4L/qQlWP8fQ6KHg7/Q/QP8cw5i9191wFn
oGY8wbb6B6H6B/j6DtobaH9p/af2D3b0HbNsrQuYOQZhoIuYOQcgzByEA5AAAGxw8JRAA/sL+xgD
2Xsw+mB9M+Rf3H9n/5/Z/aP7//4AHSOj+L1/4Xrv4gev7R7Xrfxe36/tA9Y9Z638Xr+0Pb/h/h9b
vg4hGov///3k4TFuk9ikljArjAgAsXKMXIQJ+4ZDCSTEv2C4wgsBEAJ9jE8v4EI7cEqAIGWQwOBs
ZfEuOGJUc5/NPfuxOVlOQ8hJMlVvRzGAAFshoG2bZtvID5APZB8SAPif8qfIj8t+JDbQ5BtgB/iA
B7rtgBmEB9OD6cA+RAG/6ds+l+kH9g+lfNAA68HX+vAGxgAOEAHXuv9f68HhSMAHXw8JsYADYmx+
v+FooAAAAAAAAq4lAvMAA8oA+/8jzefzD7wmLZJ7C4wDIwO5AIALLJFBC/3WLGI4tjeE6/RYPqJN
cDhJc8cOIg0+DmxtpBs+VLrYN2qQgS7/xGeeEBPWMv+DgP7sHyAHsz+6B/YT6T+6j6b6bkGY/dds
5ByD+4f/5/f/d/af/4/uAD2QAH+T8Q/oPiXxB8S+I+J9mABv2g+0AAeQPL5DyAD1v43t+17b2vb/
j9dwAAAJBEGbwk3hD/JlMAJfdMbsT38CYODNFun8pS99BBjHGS5x9l/fxJF3MgcnHje8Od9qK8FH
EwE+spVRaM1EjOXEGKHznLeFE+e49A8qNZ+J87iDe1Mtzx50m2c55dhDVhWa2XLNQfmDo2BkFad9
4fSedRFQiOYFarRMcCGQS4OuRLkAv3+EXy9VqlbCi0lbmeoqgqJ5n/2Ef+KPVw9r0AzgMKFQhE7I
6Bz4YQFXEAeJLKZ2lslGPat7C5AXBgxcy3K3fa/c5+7LPbwYTIRoyJk+XPvJWevoVAuIwsJ8E6we
fBiqk3le74HALMd0yvMacDEry8vYARG0qoOvm2sewS4SJQo7tVVBFQhW8EUzu2dhR4E5V+hPkM8l
aPn34snActJNNh+Wqcif9Qdao9e0oS5kgnEcBwFXtb8/X1tyYfu8kXZmBV0BBvdQ3Ca0Ld01Bjh0
DQpe/CT6y+a6mH0JCbFh8Dg9LGSKDPVuC+SXVHy2QogHRlL0H9WAYKVdtth8kQQa+HxLYudANXf2
OEG9bN2R7wK9m8DpZ0b0rwfqQFvDEcn/yRn3mqZ5DfPDgy0Q3sib9ezfOVGGBs/qwxjAUdRg5ymV
UG9VofR3TZdxpDnsa6EzYsm5mD2ChbUIq20NyIbJmAJgpCx0dhKrB0+BjrrZAytLXWrhBoubZ9nP
ozpxXi0aivO2Db4xZh34wVYEJAmQxs+A+e3uoRMNfDaUdiqY81q1kgVi5W6jNn+oz+/Dd2sidn7Z
VCkppLedy6VRGpUUM8HUu4CkXv9GwP9vSWKi5V2KgXbccrUa6qum4wS60fIMCcHEiuIEZYgRPZx5
g+C9MoT84ef+Es55YAOAr+/xgOWM/2YZhrPyY7tCy7zwxZjh991Pl5vTo3ssKQ4hLWiMkvHhiPVq
WUcc2nJ9NMLbM7SWkcodyZ3nqEYMQAcXEF0Mha9tOnE2SxgGDdAiuWkWcHU6Zwl/cJEWSj/NnMmU
IDFHiJUl3BWD9ecI6fDoVTBRlS0z2QL4RurfKph5wRYim3kydsEn2EBnsTUFBSxJ+3mnp3TrlIhP
dBBuPtM52xoHdqrS6QcYxBjYbYnWcMnsbG6rTvrSq2hemRFL9rDVW8QZPyVwRmPav3NQnS75tif2
oHOL0D9WTcM19kuj3ccKsTnJ5HHdnRt4p3dUMxyo4zq1ferBbZWrJkPvApxw+0g9cMc0fA7hcaBw
qun0mdy+IiWCkjMbmCb9fmEqJdA/ZDiSMvqaBx8cBOFU/zoP8cVx+24fti9xIwtslvMbIG6oPass
3aSlZbIgSzbmlUfCC2U/a0uKY76+PdnXfyCe5/jf4sixSYiFAEkdbkn6DWkYH0u6jlGT3S/oLa94
rUUA72OAGkd8+CSD0kzuV2pD9mY194B6TZX4bRDcKBhc3YDWkTPu1ohKkx+nibChetIjrSFItk58
MutHw2bRHWp5rOwgfz//xY2MpZQN/PmWOzeXPgkMBrWOXDXassvyr7VHrN72glsqdKMo+bkCfg01
TQVT4t8vQzl117zmilhAm+HcuhUx6pyEYwCHIKtps5SL9LvvLSvFqdV4Qmb06x0LMN8+R6UuAheg
2gAQHJERsvEkINGmn+Gx1cH9GKs/y1IOK5UWC65E71oTlYYWmMb4vCtWWE0CENDbu0dYmXY8qlnW
RGBcrzMcYzSPgBFqDF/NrLF4PA9dtejUbfLqCS8XQkRx/Qg2RGDLQfDPiEldAotjEMdiI1ZFES7T
vnuE2xeJV8KhHEFsmbwgdVkbNqSkgdVW74bFB851ESUD0XhMfrDu6ITGcRLL0Lmufc7HRy6XlDHf
LqXa/Ds0GGbHgGkbzRoOCF2/UWm5tk1i4FfXXdnEFybYdBMVmZmxL3UcSZK52VrY8V0E4NStP9gA
qsh0FYfPn94IlEYTSvruf+vvww0TddXIYIboXrxlNZiKN2uzTiYXR6z61ZEMgI8oOwQ8SZ6JoYEV
PE+wmJ6Oc6cseKYjykOrmmzucGVighSl5r7aGX+ufaXPgiZNMmEVNzjaHWGtywZGBm52s2gttD33
waKDc+8nxD/vtBSyoSBfwNTgHfGEeDp+noqqU0pLG6HAwRiJK+yDa8aMeIdOb5ycWYgLkwytsPuo
glRM5MK0tDaI3fLBmtTtsSCGLTQ1SgVoYrRumQbmeYk0mc334o2m2iqNZE3t8rAv2EkZh2GTbb1N
maKD2Em5tMrjm2j0ZMVjU4HAqKLbx1RzhgsdgSIzGwUib1WR4Shsmc/VnylQaFTp4tOmqFbfhBAA
DZatsJmcQ1oFlZV5qjn3Hca4l4CS4b3Ropd7V0FRwGfyir9IJiHD6NBdY9fily6ysylBllEEsRSc
4Dy3Jdf5NM7X+xfLifrq7/CjasiFB02DQbeRH8SexwF/t6pc5TiFHD0GF+0sjG7myWxBtw+fUfsF
TbUnXwcWQQLbTPoiz6VGsxrMEZbuMDKXK3us+NDxbhSNowWIcsIeuohgW2Avu0bjNDbfVGypxjpy
uIepLx9TCcleW3BsDFpmlirhkO3yIR14Y225ptOPZCvxspeO0PpZ2BMdxYhhIYLiJxGZ7zmno4Qq
FnQVHF+xub5n9sdIowq8a5cOpE4Q0u5Ciz3ItnfHTqyrdhY04tpvcuGT5Gtx5lo/oUrBiCFudice
nWmxhnTVABWrwdvvSbuzLtdnCK5MEz+VFIVcfLkOw10/J3XVgyIHRg7O4f587HIYVNtm3bLTibDL
qcVOHHAaDNHjQVsj/ioQzzfQg2XSw2FwBvy12/s6FnwoZ6faS/n1cj6rc4mPFDPtXLnxcCLwQ/cc
c8PSMwMinMgppuL4EdL9+Fr1DtFIKxLXwXEtwXCJVdrKAfL5c3lnAC8neIxRCtV+s7JBhgNX1yBp
S1zEcM4vxhRpCFYFSu7kPdiqD6UOTnyQ9KoBkeAkHXQWYgfd7+pdesZfhZaTr/f5/SNqQz6o6A0s
D+CVb7H4vp7mj0kxGTRgKdnRR/SEJosDeZN+f1hM+9+IfzUE022rAFNMSsE+s3CSt2VMKeitdRYv
OJJ+wW0Uv3eRclwVHWsTQ7NUFl0QD5TOckwPka57wNwXnTEAAAKXQZvjTeEP8mUwAl8Bu1rWaMJw
qwyTU3O2DqTHl0Rco/lJontD4uBODVXFOHSqjVMkZDCG95/KE559aD4L0PQjwXyLzBWZoSRFQ8UH
DBQnBxKrExvXmcDW2/swi8YBtlRH2g+WdI9ZuzP0Wnsx+ghNN3sfWz9JoEbf50LPFQ9/SJPkX1Lj
VrU6VI7P3YWZABzoY0f/sUuhZZZcYwUr4BCmyqBYGncsGqfw6GpJV38clbKx5IkbJVhlAscmRw+i
ZBNr7BTs82NeBM+cw0urW7wkVp6KdfR/2W82MDZ6yBPWJmaUxVWPkAF8FrUuwwVAQuKjghIGMdN8
TiGDHoNdq6A5QVyJd/T5019MC9n9bNVZv7hej+HlxnJk6+tlkRwXNeXlOkXBW7/wb6FkIxw0WLws
EoqJETT52rIazStN/2+DI8hSG7AM70Rv66JcSYAqTdHuzs2tM4zRK5GpVRo9bxA5lRRy6TDSXT+f
OxvHDpjePjofCLKzvcabjZQRZcYseBwHfT+vMwgq9CD8uJfsrtyUzvOUFmQilOOrwrS6TdRJl8EL
GOWRa7A4sET9pmp7xXO9zK08689YZyXW/cs/lzmMRfq0OhU3spjPo1595HSi1SrMQsZ6Tpfk/JRq
a6zxZYjdFVv0Nklp3tc1JWARKgB0G70bOUMRX26tJC9LmZt699b9FOGFlNNp6eXGqmMYqkcwjDaI
O5G+yPQJJjt0Xm1VFgJ+ik1dTh+tOG+vgIFY+6jCW2WIIolthmvTs7aada0Y5vpPJ3VF7FVU6VfU
r0m5Qm2LxxWKc6s0P9E5WzV9DvgRmHR+fDAsEOi8QPoLr7aWjQXuXnWqlO8/18eJ/h3sEmEPeawd
0b16WP2H0Om3pS44/i9RBHWvAAAgNEGaBk3hD/JlMAJf3MBjVWmpfYAV5iSIrDAfgPVRtW/wqs7u
5K3uEUPnCKdWyw/sZAu1cNYpqUH8eS0jsbLc38g0C1iD3FhfN3etNP9cZP7yZr5maAPOO/5XlYsf
cmyGwewxsLRcaui2+8nyom0laXemncOkC0fri3Bgoyxvkr0DBwynuB3X8mb81V4rHhnaBmYCLXT+
R0V7/mflVsDWjdGqtgTi8Md+tEZPLQt1n3o9Na8BXKv521nqIV7RuKRD2bJLRNRN+PdF3XYqfEA3
54dAU5KI2nv007ZFIMtRWX15TVHYWtu9H+p5LOQ4lhc0r59bBR1ePwQiCCPjNVzlleErHAStuYXe
8jhsrVcraktBUl1qaQ1Iy4vWSi1ipH1tU6JrmOuulBpEbd0YEBMabRvN3LbLYsMxdfGAm8hiT+DB
9Jxs66qxDxezEkmaLbUMgJGdejRRKfuAtRuXBXCcPlYBCqgmVFwtjCmvAFchlLOzql87sfROJowf
TboQnUK63fCmNi9J43a7KqDoAogG+rZ1veVDtLVUtHQzBQeQU44S/RV1py/xBt5JlF1Vi7V7Bshe
rwH1rHI2PWQCYD/JHgF9+0GpbZzVw8DmgGrQYQtl+GFDIvwD0MmHoJLuHj86zC7sOsch23ZQQByV
MrpCpR1wJeVcAZwtfw+fL6Cl3dujX010LePUCVSGFyS1VGbgvV0dMjMSi87BvJ3kZ4zQC68pB0al
UHWArNBYXCnPC18D5WUGSsuM/RrWfj05TytX4g9lH+4VbV0OZqONa1Kat4tQpokujHy2/s86e6cy
g26xv9sXssOvwinZxEqaR67AimB49AAXWF54Eihs4v5exjxW317tmm7yZHtQH934KqbUFR+hE2mQ
99CC2mq7qo9qS4SnTbuD5amnHKhjURK/FZzZ+ldEkq7p+uY8nFSTsFr8hPUbyFcaWOXT2zyzX8HT
DJRSqOU708vQHPywB8KzqyHY/tzsXEaHcGVr+MQA6NXeT3NRnT+5cFG+gogsQDmQGv2z+DcXJJuo
gsvyU9CHzmoakEF3sNdofkgoJMK+X8WyO41rwYGMbvVflDjt0WkvsYmDdswIp9vKR9Y3tnyHE4i/
YGQqrdu+c/Z/xWenhj/tsxKo/Ex+B/G3wA4yC3S+RruSmj9kBbtizryhZr7jcRBf8/ktx6P7oA2B
nxvIVADnrbng42RhMHiySW0kAYsfkWvBlNDSohsvRbzekqoWejbKCD9LFIZn65+Uoq8gqkwEK5cZ
XlYShDWWNb/7bwX3Y/4tyR5vVHonF7bdwrlwUVdBg8ExYvctR8jIbvtZuo/8EyESy7bmsTMisWis
v/eJGOqQkjKW/NhnoFKQ3NJVz0oawlAz3YLVLnBf5zDmFx8ETGgS/Bp82HhEOi8ohlT9xEmQ/a1Z
BgxRZkYxoKS1HnFf2uZkMK80h9vMTIYHBxjFLJnKK/WlY/OHFHbCxtTW11yTydOO9fabcBjDk93i
qHTVgPkCsTRifoOAJ5mO6pveNQLfSHZ6llagf15oLe0yvRCZUdJq83xgQzsSBnQBAOxGU7wZxe69
9Qhpl68Gcif37sloPwE0NhAt+wnW+R9m3iEj3jOfRy2VOESwWYRKnj/5oylwYiTL8TYvONvzbIf2
c2JAh8PsgrLo/oWFXPhr60aInmaL0eEpEuHe2lMIIyneEA22/Zef+m6q2KWJF5auYJdDQIBrp1o/
czLIibIHbMW42EisC1P8Him3qS5xzGHgYIKBylDIICVjTiSD9lYb77DBZnwTdAsgxHM+/FCAY7wB
aCueAmy/BGPT2TwoVWERDhQyrlH1QTif4tXSL8AAvvKgGG4Z8AzHff4TEvzIhe28PwBl6Ezv+Owg
DUnInakji7Xw0pNqqcv/iagIsrRGWb89ydQZOxBiA619qS9ULo+O6m5tLSmv2XCcueq3RsoAa3fL
xznre0kjczVa/kWe7/swSvJ+idspvIzLsRaAH3Of70MuOrZyTN8QC03Ijja0zKCQXRPrq3uV+aNv
zHLuiKYK9dHbHmdndUMhGUc2auwREUh1PBXoatm4Jl60+43784+7RYFNTpZJdBhY+wj785ciCt1O
VPbYay0wvl4ZfjEQy1HKmOoli/OOjsJQoKqd8PcYyPstmeLtEiiFg4vhVgADDasUkQ8orR+3CFeh
TMaupO+fnERW53+i+FFae19ZkobUhQ1Zeiqbp7CJrQXrZDF5YtpPgvthdoifSMy1XL8Mt0eHMIvu
YP3HxCzyD65ZreqrpaDvNXc0cyFmzURXh/ePRT+0wP5jzzN2YkFJpIDb4KoZ6ip+cobun/mQzeT5
9afUxk4FybrJksxAC/YwML+ZYh7scNwqbKy+NMy+oAl/ORGoMN7TxxwdLGkXUMfV9MLmQFfToY+w
jBaIQ1fljaASmZUWPwQOd2hu815pyDCAx4M/mrhhd4Yl0h0Whj/+xDwGxn7XsgcQEquI5e0iYCtd
uwFK7YDBAxXGMVa0UHTH5KPLhPBwFC+1wHEDDGWOM71SzBQ03spxjV5NKeRbW5gAb9tzH2OmqzmF
utYnahTwKZdoioaNc5SGFpH1AguEmaM/W6cNIfSabITQF9Y6P7FFV5amgCGQ/lH5ZNplNgwf9sWT
E1qDl6ZfHMi13NO8IU84IfTeTb8lyeW26pOZSaXJgdYztrh1v0MzZclhi2bJw+UXvYlQTlqLp/rW
5LJ96iXpsR/vyP3NYNqmZrKf3sIeEFsKYZrXsLY1d1oFf3biShgkiD6HkV8p8jZYJNVjYzYPZn27
LjX0ymegm29BcAnSzXPlKyK6/iAHlvh7V4wDp7zKK6P0lP66kQ5Gn3d4isr02PjyVNz7g1a4Jv2o
TcVedgfWuLgIzPzRGZhoFhaq7oamlFc28vWtdMTqQjb9DWPBFJxVA1TjS+QZuWeQd/PaVm+Z/pOu
uEeBGpfwu/rrbvsVLAKXfUf/HDLfdsE1Q0AUGB05s2yuqR4b55Uu0tZW6SbYEerjIf3QmjwC71iG
0wU7TGLZaVGJbRVAHlJEVCU15iuOTSLjYN2Lr6QImsY2SF8DnADJOjK1pSix1Q55vznNti3keEhO
0r1KLRG8JsGycybgyE4QW8ik1bR61X8a+cJckBFaa8CNehP1kqYB47dl7TmzYul4Pw7jsjiMuzpC
ZHu8TUNCVgdtMxy3QHhX2gOOLz10pTmY3bdQexnCDDcZEssg+NMieUBjDR0q16/iFbU9Pm8tmMZv
i4eKp15aS84PO/YkzVdlRolq6F/9J1WYO/oJhuYnFSK597RyhIBmdx3t5/roJi5zuhUkCT861SZW
bUBHO+4ZoOTqg8RpPY2RkIzf1IpnrUB/ujPZ2Tu9HAkw0D2RM/Toocxai9mx1uVlcnE7N4uEzJto
4ZCoNltZz+OJT4uEX8xXgi5iv/VxyHL0R79kivkNw2/NsIk/dRAMG9mFhgwhLZpMhqEzjgh3CZEp
GiodckYxE4Dt+qBYl88nT/f8GqGM4hWi22CWpBCYUjUYiqKRp/vdqND124mb18/UEVP7eGDdQWpn
0LY5LCA8mjz9aooD3Vj35mmCjgN+NPmbsn9srXhB9zv0bGOG3Ey++pxegF1ypDkjeuydcMfJ0han
rx0B/qYGaMPmLgqPXsxKAKAHlZqsVijAGES+vn5vp8FSNI2p5lcxLYGrJtwNQuNz1ydqCNVD4nGB
XYdMytk/yUgab2eF/+e44RuOpeZV7uCDVKtFZ9dUycMUaNqLyaSUtw03akdtvak8unD0+7EHtdqg
sEcFUqTfqRuVzh8Ls7CfOufWEhz5ViXxfPvdci6sZTSbZTBfKquEdEK84LFHJzQf5XJbVNeVtKJM
H4iJ8l8T1HWyDb+KjKp4rAgx3riS7xmvy6s9CME+eq9IvvGbhITwunAsNvzrgOTGISAD9Xki+n5y
FgbdIPgrqZFXnoaZ9DerWGHwZC6SpLF/TUYZsqZyIc8uFckrnQ7abBBOR7irlnlidDDjketo+8DG
CqEavbyrSRBb63xdxr9Bo+mixqUkn3X6BhufYjYstSn3se0XxD1mOT0tUjrfiKFKe4vI7D3s1++O
M0w+xXdtgfQl8mKIuNGkhUjG/7dXldnXA1hGDU1nBM7ICOig71mS1N760AgDczGIpqLFQJFh8ozJ
Jc8rQa3lKOeGhK37hAIt6s8P0AHIAN1dOktnrEhYskE+HPlaHaAFwl6SDrnKwukzCQDp/QrMIlyl
VopkxjueziYaBqjsqC7GEMQRLTmd1XoT/ah/zjDsq2DNwQhTfidpIhj3Y/AbuVfzbK8Vkdpgfykv
8Y5BPcCVm49+xQUZRwvKzLJuJsIwKD75Izhu/10QthPKX53e83WpxE2fNNqwnXvJQqVGm+xJv+xZ
3AQMncd2L6mOTxHg/uqIzURxJ2lOBbC4hmY1fRoBcgrdDl0UD+BI35Y4cbtPFVBgvbR3S3BvbLNG
v1k/q1v2qV4uZ4myo7Yb4gu1HvxNbRMs8IimWCV1BODRyJDYi3tivh9jCs8VzMK0JT4LBK50c8Kr
npNXnRZveMsn7+SIxavIlE6QkkXvgMFEDOcx1Ec8DHSi5G0MVIM58K89TKOgqqtQP7/rZcdF+E8Y
xrZxbkUK2RraWUHTiTUTHQw60KOzv0oMNypYmxq3kAawaMhc5wVD/Il9iZHHpcUY4ZFXj7EAVaOV
ZlFFk0YKCw5RZ9ATdk/T1s+EY1SjTI8jvfnC15F0ZsX+ia+/NmQLLX+KrctgpBSZcmr7csV/YWGX
YRkjA4HBhkrFkgJz2qKpGpBrngfRoz64Iuudio5vdDyrad+zRQQUHP9aDrSlB4Ysy6U+mz0SNs+F
VAU59AUGjFtGEowWZQ/9EZn/hs2TTK1mkG3gawDFt+83LN5G/sV57eqX2zmAU+sWqdOCmi8RPOSF
oJ459L8xzMq7URmkj+p1X4FVYOIjJMfe8on+gQUjVqyRoJaMSo0gMpe0f3ZTfF/w7aDywRuDMo9a
tcw41Am+nTF4cSwh2eMTZOUiBK+VabPCD6eIDnUvH3V55bjYjNVN//H5GtpVAsRkcBR2mXcawXgE
bISzg+P+Om5oNiB8Z+Y5r5grt3pLgvI+RwgQxE9LxqNOuh7DgFMuKBaoqSrNtgQyoWrcO0y4Sxmt
t+MVC7z+F/bgDsnCv9eiTXeJ/rzDOmpvEzUHuXpGYHAuYXGxBlja3jv+sS8Qm6vwXUBJCv+4qp+a
SfYx4K6dzcCbvCKj+LDTLIMaecL62hAihsOwMujsu36TiH/eh5ry1IKciCGhti8p0iceJmZXH40V
dphXEWW2kQrN0vET05nEGRJnjYFJfhsNw2CCk86KrEModp9Sh7MU8kG6Y88+sIXDmn/Qlff8jxWs
LWf3+rx8ygMZz7uQKSnUlfRvatrOIKnBU492Js3bAFidBr1t2cXe1WFt4RNQz84F8S8lU+hd3O1P
/J95UVz8b0H6OwY92QeSRFiGvubmgCT8FWg3y3HTxO+CxyT02xYcpm61V3jjIouT/roUqH/cyCdh
IrhfBFu+oJlnOGu+QM/8okzm5StSELW/HVBeI5gaM2a1KJgTU80KY1KkqX4ewyAktfMNNE3OwJqd
2zkZ8d7LfSPxtQObHBtqrBQxCwIxVlxB9twRtqRUdG7nW+pODE3DxH3Qs0VK7rCk8LX6plFFwo/l
0iuQFBmZtUco4UpgT4+curQuyn75xfeHLeIATObxSbQZpVq+B7IgXCJVzRyrmma+i/KWtWGnxRRQ
elx89BdWXhjFQcF0NfyC+8x4xpXeofIZM0pct2om/2UukbYsf8A2xLnpyIb6ohkjR5ucdpDTKqwe
Z0CwfrzIwxo2al7M19vHqkPvw0ymPHjE4N0hqX8W0bsvr0B48jKtjaA51/7L1/zGVx1gzN2Dvrum
QdbmSfZx1toCc8IZPxq9+Bu+U1Xj7lNpGM6ZOp5F5FXlT/hlP8yuHnAdngnd2uL60KynjAfNkwdV
pL7Kz0LBzbuYw9g7Y9gVDoKD3IGMc0cBPLR6aO5r8vfuZHV9UxI986k4uVl+WpyCPNj9L+pETxye
aDbJ9ftJ71K4kemg2S3BlD8U4/ZQ1MozAitGZrVthVDDEFDAZUDXcdRA+3nXh9d9AdueGQ/RF/Kj
etr+A7w3wADSWpRpZY+6knPl0muSumM+uNmfSEl6135qzVY0DVmItPLnrIHS0EzQi6XHZmgd35O5
tQrBh9ZjnKP0phn4zn0ZIEj3gO+4SOt1UNf6pt46ckPz1Ma8GMPlW/gxof3b+wrlj8BqpvAXKOvi
kBMH68l4uZxnzvQHEbuwsHb7wPirNQiBN1u0Oo8FseBqv1/qGwICXlI2qWeYbl2ryQf22aVqj5vK
SRlzsWsnfV5w6M49QcbTTUDdoig3fliNsSdmx1caY7HM7u0G5Wn7cf4TP5L97E0UGycgJGB5kGJv
owDyLx9R1VVpkdbiznocNP/jlwQP1g0rEtG9oiNXTH/0PPg168wcbEVWY+vV2m2itlq1C2dZhnmI
LNQFYV0Qb0Lb+VnOZV7Kt8lG95srQFxzbOcfxgg4LHd2qPeW5ZM++WVRbNHBX5bsHjEytTMiTSI7
XXQBtCmAatA2hq3FipQ388Sonmc0E6/oEeBNWFjDLUdD9hfbUTe1KMqPMRr+Npw2ngEk5CqQOlVZ
UqHIMNfAPF/KSqd6Gjfm2TTtmjcrRQajBfebWdjunxnOYGxr2bFc2UNE75eIHC60Wo8FnBLsyc4V
e2QWI9KbXAy/zc35H6vYy4KThxwDAk99lEzvfpKUkLKvQXILUpUD36BNOVQe09+zNiBwvIefjRh5
AfjzM9JTVCQ7wsfTnCTar0kfK73WpBBYAiHPRQcn5Mt6a02nchZrLPwSQPaYNHOwBBR5N66h1VF3
iuVj54oAUJFhsPq6AE/9OZ3jltmKSZgVQHCCjMchpnbgBpFi/dlg/3Ma7CTCYXBaWN2Z+W+yoHQj
PjNkfwXdZx2GOnymCZLA3OIk94lEhgpJKA9JyuBJZ64LLElxzyR3p5sPn3CgaGnXkOapBfconSvN
/xYuEPax35W8KD4htkx3azBsYU3EBb6n2N9lo3YLGSQ6f31iFMQyuLO3H0Rnp2PprCv5XK89WAPB
4dckugWa2C/QtxJ4jS5msNlMA1O8rXCwUKNFgh8ruoUA2JgMw8D4T942UiCzNvjn4U82JFJMybiC
hJg9j9s1rGRqX8Y5HOTb+hl2pGWliosvdnodD4zdwTn6AD221D/JcY2HCDp4OqQIOGqrhV5j4P4m
9HtgZ2i8ib0oalYE4vMF10srCAc7EQZQw4+uN8Nehw7yGDiuRSnfACdGK13i50eFWetIT4kFjebA
a2IXFEks+WIXERunA5nsxxsmzlpgAzy1t6I37hUo/UUiS8hXdPjbj2HljMVU7UgI2ecFJ+ytL5vI
L31OfwMEm28S2e3g72/iRcOqkLYDW8B6Nr6RMi50vgedLPf6wpAKR1DnrChw4uPMV3/X4cceJMZI
iKvG2GnoYJy7oUytdx3IHQBG+QAHQKUi8aq8+oyBascwqHWW0UxvStuVWXJeqDAeRdxvlrcIh1A2
+Mbmm/nQ88a9GgHUB/4fCDrvXnGPNqmqgNfCrQPeQSdEm/hHtcnvbA/D5TXLpd3zKgbuUjUppmBm
jmFwJSu9/zv48RbQM2/8VhJrRVOKXDE2xjqxmWg2qV0ejFb0huXtXg7VBTJQjgvQpnslMvLMBReT
7+rd+tuCcyHYQ3+vLbb4P4j4eazgcvuGl4aaAHNgAOzaHalDDzDGU1E0ayKxMxjJpl7RJgHZ8gIV
vBZTR0b/x8ZMMdU6HIu3DdjJBs6F+/7C8BBauebD8X6giRh7a1u6XcuavmQKAQO34Z6r49rUqJHf
fsq8MyjbZLg5oVAP4gzV0hpq652zcHFBf/CUGx4itRttABYkpqykIfbt+O7Tt66DAVhaF77zqt37
8cLMXmWhjOcTkZLvsXosbAfzUUG2+wTVRzUDPTr9b0n+VZ9ywk3xG0+pfEggdkfGJ8PsOKmgc+DC
Eji2HcsbKtbqNgVEJUAGCWz7yTGdk5TWgSXp+qFUuf/6nnQ+ryjcz0sE0JbhTMmUesUvn26SkDyY
0VL3GhgQE8DI1Q9uqxkfJJxHeZj/PE7QC+acGQBD9npozkSGmG52UcxOzXJ5gi9z8OgJ3yAUT1QO
aT707IcbmfCnaLq6NVWL/bUSPGQoAIHwUzzWrCGlFtcFnF8Hv76gKJ3QHsITUAvGm7RzeZafSFf7
3nsKOUBoAmcFJGBw86f4CzzKtd4f0YdRaoF+qzU210izacYUrXm2JtLU6GPpj/ZN8EmSCGS0n3zP
hK7InkRc61/W5Rvp0Qp2ClLYL2DeIKPVyOnkRQ7+eLm4BVhRcKGlKoz+TYuYXhT2z7AsKPo9hoV6
ydWuDpIYO0JUt5AHu3qj38mUuVnW1vmh3xltaY7ZNeRno8OMbqKyZsCiUXuC8iOMoSXgTFHgaNG8
JsYn++pGWdlvLnFMXwPiJSZd2+GHxJoGQxW830MvOMg1npV5R7QyUCapdkSv/4uLg5hBw9xWtUO6
wfCz0EO9cZQdViHDFaewNjkJ9OkmcW41iK2E8cD+uUDEmF0Gn/Iu/2q4aEye+p8/+2pqX+9UlfYO
y6XYDSvfAvsLl6G6cX7QKdb8+Ac8Ymg+kShQhVBBxHW70YMvNKdKDzVYYNIQIwYWG+cxMfU1KpFw
91nDSmRczY6Lw67LMysibeTgRlEPSMOY1ss9aAFheykXvoHSsEDC184MuCDV6FHkrbHgloKNPs30
ulE10gfZyj3/Jnk3ppYcXn1iQs8dS0rTs58RbxfvOxozQIsB31WBZtQ50jUuTfDKJfxg9P+XECKF
1mrNy8HoMSNQ4/UbldPvLxKCTtc3IsCF3OSWJYkGIL2hX68YHTHo3+fUGNg2lw5QC52n2j6HUBg3
Z/xeCjFESh/9S2AlZ865RoCzXuRA0M2c0Vss/xwG1QqIlrKmcTfB+CVjtV64A1EAf9hTPynpVzo9
tGIrOcJFClaUvWj7BMMChOJQqFkhGdFJq/wNFudt6jxrln0t5SqQ6eo336Y380Dw0jhIi8r8USy7
19tSTBcj4TAYrdy+wtRgggB45b0AvIde7pvYqSmKMUoX6Q8JlWvB93uVJ6DzB/S0vQbReeyrbd1W
tXLGmMP+KNixf4a8wVM+ykEH82P1RYNnBCH/JuVw7hY9yoyON5Wnevoi8HCkt8omvJu4jcJajPzF
MDpeZN7fRaJfeXl+XzlNA0CC3FGG3V1zC3onf4B4RyaESiMWceu9y9yL1yuQjEwnYBfh7N4aij9I
epWYODwP7/3YeAeJxs0F9UI03M882ZOfIhKzJZ3Vzfl6zCX0puR3tUOIc9JdqgenY6BrAoPjXiQ4
91DJR4d5zqtFP6QfA6878IT7Kxc5+itsoOzSqu3TfyqJElLGtU8snf3quIplh3FgpbhmGup1n9iM
mH+MtoVRswUpBwkg7FsVBQi9rmOO7F0iVJDQOUZT9H72rSRUQv6djE4gsERv/nIZZztDO4KjRqz9
mPtYHxf3WE8sWQNed2uhtiAiQF/vPT4baGJTYuzwdgHbJ3kQQf025NA6ocBXsE4Tcw7es7XKU91I
+Ic1fQCC6zg1CtCszRt5gEJwPleMJH2n8efu+ao45oLPsQvoBi7+6lV0cV2rgZ5brPgQt3nU/bbL
g/VDBD6aa+I7B9Ac6A9VS9zuL1UTHncabObzyEV4uJciHEqGfVOYEqtRH3xFhdLRXnqGcTaQxyqA
kl/lcxUe8nm2czd/hpNSg/H/pWQ+XYoFf7D6Az6zni4lTHlHxVhTSMnyDJOOvmV7BGR5mn+pmIvd
nVaVsklGD0HXqP060HY+mAl4S87T0R7gTAtaVPQL/CwrV09rRpkiO7NsSVgiG7h8y8arcx5FVN6F
SkjUzqp64HIJ1azLFCiwNPSLki322295wVF9AUlyDyZ5Oid2MoAoPdg2Zljue8p2f+Yz+yxKX6qj
NGqGe2xS3i708yVmB8oHwgeXkFxziL+08JRUo28fN+Oj04OftJ8SYi0ot1FGnB3CcqVu1z6PwY3m
FTRYqVAT/vUM3eFT4BkeMsxDe/WNKV49gdubFuVbrYft2T+3thJ25E0qiDq2Z+/gapu8o36i6Ief
YtvxAbPjHWuXN5C9s5iEZaz+3Wrn5BCWVq5YpSqHktxkfu12AyMN9N0+nH9e6MJ+2NXNF0G9H0Sk
+Jq6NGl6laoLeuFUb4ORza5WJBEcTlf0JTM5MGWAeg8YM5YUUR7t0TwutZDjsh8JIEtA7VIyZmpI
7YH3X+SI0hwyv/wpVAWwoGXYNbIIB/KyHv33wZygD+4B+sZgmJSl/LxSKIMdjFS5swfuSUwLInxq
WcEQ8p0qroX98WYCa1id7RdZdk8qgQjmvrPwZVfRJ8E0AZqyIAYIO68PgenCwqBrythPASTBkZp+
GriyEfMoB0rd75dMYppwtIscF1v9h6vU2hSl6ZRbO97f+LqPiOU94n6SjtCh48ssh4x6siVltIVS
tBIHq3lJIoswPbWW3Y6hRYMk2XGUf+TBUpyaJsClItyST/v3dgU/7wetbpeXgWvl07UAs9waNorj
W/xioiI6K8GAmHGSomTJGeAML32zgsBpz2BTvYSnTkmQuxJi+toUKvfgZLad5gK1Q60SnP+VrJX3
Yr9/bR+aMnbCjHEvfoaGjjll5lvO6W8GvH+sFRFdkuYwu5vvdHVIsC7o15aN1n7vV1eBOFEoVfos
g7IuRbsAFWKglhBZQkmTBwSbZ6XqoZPidjf9U8j1+B8Sfg0yl/sFq2RvGUMWWVQJ7zaZqfpZsj1b
UHY9e9QpJpOHtzuDNQrqIpH/bC1pA3tbrHrozWDdz9pIFf/nogAPPgXcTISPN7orToL7F7VOge1i
4EqTC955R6GWX9TH4Ftv+9PafkvhK8WwRpyinBk1sTgTc4NVI2JgqxFuAiANTzCRtfMwmAPwpFcI
+QAAEgNBniRklFRP/9BZG4nYAQKH1qRU/GQ3AZZ06ZJE31/SPwC2NC8jFjRyt3ZCCPy1SqcB1E/G
OAzCLQXeH/wuJ10Jjhq7kCJg9tlolQ+KptOgI1XQP8JVmIl5nlGsZ0iBFht/W6t4VNwKhHm6fK4W
NZW7/ApfByf9cHj5SgdNs6djLKPTTC+X/tZYM5gPEWMfCRsfQh76ETL9ji3Wd+aal/idXDji1Zla
xOClzD5EZFZ0lSyaZU0u1WeLSTy/9h05opTyrImIPyWGmQnBtNeKZvt8ixrkS7fHSrTfIbXW6fOb
x/cce/FazC0dP4K2jGX0BgGRQtXbYQrLrqVNCSjuaNLFUb0QEfdqaxtfXDwpNBLtLDDaNcY6EjRG
nJQ2adkEFczumOdhH9OXaUlMhS8NQzdszivbqOkqXc0LKW+jG68KZLWjVMPLDJOrVI1wtqSh365r
slZdIw9vTh+gg0lREdsbKyKlr2ad2CuTZZ3iW2GjYcBv5bLYThNDxC1xy/+1vN6FZNGBLosSmy9h
ZtlTzWEaBsLipnwi9Kgwlrw2DE/MzR2IK83eLtt6yTW8aX5m7LNOnUbandSK/73MGDZq/cFFRDuV
56YGLmlwfVPzFx/DVnled4vwH8jZhzr+oG45ZzheZRMgdPsOTmcs0fKaZwevcnH9OlOJi/dRFW2m
hN0LBfOqy0clUbPVr1uMc9GX6FRawbvwf+rfsyMlpXQ8Ja8YhkDMT9Ne32wRj8LU1Ib5Zt+2GEGn
6kk0Hi4Rdfkwgl/zcZnw+Yw2RUvZorOeWi8hFCCljdYPazbWVRLCv1RH4TDfLN/5IgQcLyuP7IDp
3E5QJL9+hEgE9DiNeO1JnybbamcXeY/Q2m+XVvRx2QYTvmITGnH0SppiQYnmY0kx52UTa6bJoqZO
Ku05rd8FrQUmWaLpjnw4+7VQuiSS2cl+Wa9tD14ymb9YV9dDkbszkXh/iIjw04esMu6Mr3/ZO0km
9CXKtx58C1ZgyFtFfrNiLnKXN5wCMU8Rr8Mh4q0LVHDs149DX2V2pjd9I16XsOczvVWH8SkaoQAX
ZLkvCMDxQPkWXXn7RQVvHb7L8e4Sdw7aRWgmpnwo/+OEdP+gZZZe84LOzggQ3CvV9Mcaaw9FIEqF
xwOlTLzmJNhKmpEIbSfqtlNWgsw7ceYJTpjOxUukKPt4OMjhKcx/ZajY1x+Cc/qTU2vyMPEjaBsD
yikY+DtQyKCFBP1Pn6NW61lnRxDhauOP1+E4+Kexe5fgYWuoEICJrgnvjIY0Sf272HkSpkLIkUQX
VAd1nW8/tO7TGvKKKN0A2fpk9B8q2tk0CPhPLjjrnlastYbXM4jrFvjEPsA94SQgNI6G7zZC0e+k
braqQSGH6lLptsjqfNqDdZ/pN8u83/b1zSsPE9bcHTlhb6K0YRB5LPUL/fhTYMiOv14T8uB1WndH
Sy/6y88DNXhTsy1WJ/dZKXq/C2dYxsTydunRtJKcyGi8JcU89lrr3BhaC3kFZodSZv8j4mIDWoRr
gw1NDF7oDR854aO7kpHJu72FfgiL5ZmFkAmkZsQvpptwfQzzNmXrOBNAdrf9ZvA4g26V07C5cuwA
KFiyybjQliFMJ0tuXc8unFB9abmIopVQaGLQvtbcbY+ngJ/CxkkFskMuuLD78Kxf/1ReT7CBycN0
120BcP1SO2jcuOpmmF7jvHwD9v7G0uHJpJsxz7RzKJTiBw8uN+dQ9Atk0n5GUWaZUI0NALpDyp+k
9fYJDFXOH25pP/TjFE/7qkzpw1nw+kYNxvQEpViADF2WZbxLPJOHRRT9Lf9TWN52xNizYKzP7lry
ZDVWRXnmC+EhhIKlpm7zlwKz6ctWm9xb46XKOirhRW15uIYV1oPqLFoqH/WvtmUt7FXWxYEQnri+
StymnJXngZmrNtTJjbHS5oHCY7/9MEMIqGsphXR+Q7dIlRbAmuMCubKJrox93i4m8MpEOG4vQwZi
VmRCuWL87rcf1NoVuuifWdXJRCLW2B5Idoz2L/B2cQVhMfwCDvQzn2Gpb20bnLcV2Ol0QwcCRu7i
NWB0uG5Ugu3vwWJaIrTsoxqCQd/FKSpl837opZKJz9ktPYTToeAju0y8teTnxgBZ/bzJWjSQytqa
cdTVf3Roffc5VzUc7y0M8MWAFG8ZyQgmZJakra8PRNPwrVh28BdoYTU7MvFfsDxyueF+22htzf0U
w31319Iu8nrKXsvsZUaik4Ei7DNTZIAq1Q85vPtxrnuWGmjhBgz9wIwDM+aPWnocivf01ab1qJ8w
e8JBsdLy19DtJJu6H7LX/2DC9A6Wk/bsPcI+n450V0dDMbDQNxFf1e+ZR8DHbpLSzmvF/zJzcT0s
mGzL1gg9VW3mbap+cefSazOtFkZugCxLNX9MrhzfnEJUXfk4P9QX5d8GShviIip5E2mu/cNUAg4W
jrg8BpeKZaO+i+dm2ZtsOlTnAXkErp6XgMGBZm/6znb1/b4t5kcAC4xtfH5nTO94SRm7XGyOSPQR
536d1uNcD2U+28rWZgvBsTib+xc1DjbYaZFHy7U2SURLsyT25JKwwWZl6nO+J+fZjeVMY1p855iS
dBGqxgj5IhOB3czH7h8e22BL8q0DHh7V3lUEIPCdtHvcx6y2YWL5aWT1ABIN4bu/bioWLbfsXa1K
EItiknRLIhJp4kyGBUptm64RyCfWDrOe7N+vOeGvS8IDvSkwM+pgnvN+PEpa3DW7SooAixZ4Iepe
0/DZFyYvjRe4oI3ia+76qK79mPpTtdf0wwTaTFrYLBWwDxRzDsQCJeNGKWs/V8MuYRqTK3hk3Vqg
XTLtqnJ0Ntd5FKIO3x4tlXK0mtvax3qJgRZHftravu5grhfjZiRuwoG+dnzvlPZ/WGWwkWu0SciR
82k+Kzc2PugPdtQN3KR/eYEphszlAE9HLEyixJIwTd2DRmJVd2kE/EQ0Pr+pgI2L7KyWvpkzbLkJ
rw+AQ3aSzlCvvA9SQnQ48SN9OJxzG4JwDqiwhdeB1ZajZ3I/yIm8siVTvVjra9dXy1PUh5zFayrY
/nIDFwbq5JnNTAiQPkraPYEuBCFf1cSHvtx91KPEWZOO+zOtn2kW8YhxucRf+dIvvlo571MSQ8oD
JIHqqApSnba4LOV+oz8OL84hCvp7twBQm3f/x/QfSVkdTVePYmcs4nx6YYFxOTpPnblie57R/bH4
0sdMPuKpqHvDrx18Nc/thO1Ctt2GEbg/LAMsVWD+txKC2+lauUE+df8GFqTbWRtaxmIlqUz/vJC5
gbHT5vfx4LXoGCLLeiD83/s2TA8Jr7MlDx8hum6PgwneXMBFj6qzMqTaT80Ezn8dnTQzsEQveTIB
paEJWvIqBLEva0WNzAjHCg+6PHfnqxVTydXtkYMWouHbtkspmeky1WpBF3qx+Vl5zJFoBkLdoAvU
roChhzSVJkWt8msVehagWEDtAj/dggCIiZeIkEvezYlu9jEl+WohYLD9+ikwpsmHDcPKNKAvOGfo
5Qu8ej3ruQeZ4Pfl4uOt+Q654/Kg7RGj32Namt9xRegW/rVOqs1BpmW8mQsoJgntnOnq+i4zVTYR
/M434D5+xOCnZ7p5vqBNsutmBi2KPeJr71tSKGueBA8xD/pRshK7ycRqaW71LCsoayTCT0Utbz8L
UbLVXIUqeuB1eGFwbU1sJ8lArmZqiNk2i7tVWBn1MM6XKlLik9huIcILxyZT9w8pSrGAVKHHsxE7
R+d5h42kbecFZdsJ3O8pQQVph57/gGXdAUgYVuGGhcJcN2VCLYWlMn3fBL5Ms07UajQurFwa9TrZ
wJ+LlChOTQgGUM4s/Bhy4izATVvHDHB+Ogb458+59kP0RXG/zDCEMSyHWzikBs6tzFiuRcftMPL0
z+bZqJWpdZIVGrGocOjar8XEYGnG5YF5DbQ3kL/XPi+M19MD2d70PCpRcZuWf48fhgR83prgWNzB
k2Il0B7ifq6/CQKJMJ43Kp7G4N9ztqJoJKIqAbVuWcDTfiexsBzXxnBQagEw6UXsK222UMC9c5ZW
2d+w2FU5Qv2KhAzuk6pX1HanRRcCz5J26fJOsYm6170jplxNLzKEw/Ws5HI+WGuvdg5waQWYHOMy
05/Vw2xSFlUQ9hE6dDaQze8aYR6HfGLvSCM4fEEDQfT+QTbS8i5eNzxeKjtQqhuMYlWPYN48Sta0
pXWj1a45mmJqI9iWhqo9P0wPb3s7RSFhd87UnvpOC0iR4xLg7/pSJqI/knzrPNwMThS37EwO0j0c
vIZaSA1S2Dm6SyxxzpJoPIdkOlQX0xojoLHgIQeXPc/MU7Fph4+4i/0CSmFpLai761q/e2C6zEYz
omx5JbDS+1AiJB7loMBmdsi+JuE4lXaumfTz8hp9lzCgwF/I967vh7zYGgvE34IxcrN4pyVrZ0CV
1tyHx8wX833pmzy4zl4fTvW+WAT3GWIP7loR5QPdc5D9DEc2MW8OHmzTOCWtPDF3iR/oVJscr635
88MrDtHUxy/w9oX3uFjnFlFVYdEl3/2w08RUXZX6vmwmGjoXnv77RP81IW4p0HgzQUdqOgGWN4ml
a5EINJFucNN/g879Zl9E180ZRhairQsYKLi6sJBfv+jzmqFHpr13u0Aoc8/LM+KBTGq7kxs1XzwK
8uMuv6Td4gm77YVnw+XVR1bsjfv3i9/tOZWKaSSSG+MuhBH1qDTnk5svdw67oyFUxjYL87WaENu/
vgwJW46SAuXNg1SSnE/tsFrG6EUPvrnpRQ5pBVb0yXi8csO/3BcwhceHLCA7sEHqgDwEbrtRSDo/
Xm3mCWaofysFrDMHmHAhHVISngEBipPa9rfnQn5GY+X+bb1BVcv74WaOKxEYPYZ/16QaoN9ppriZ
6px5BXAtZd31NAQexXB/3pfyqDC2kH6UVyRpvTPCQeSL7TNh8HJiXJKhP81OpBPMLK68h6/7fG5S
fSHkKDtzJmBTKp7d9Fl6SZSUxeKB0/XO7rFagP51/5bDPbnAD60jFvrYmD/M9PeKK2huK5OBMGFb
lyEQnyzjMASV2OoO3CWOylPBXa67W2MmmpXyMDdMSFR9ZQmqTWo9FS5xSUnf4L+0+zBGLkNz6plZ
Vb4/fT+2yd21qJn+/1O/y+wBAzonGiYJFt3u7PnLpZseUgEpIQiIQtDmxisX3ljgP5UoXVezAbkk
GDMBD1S9SOQoiutolf0/0X9k1KpzIbZS3cOFPEMkpqSqQHRxItdexrv7JKswJPhEC8h2rskSXCUZ
5Yap3M7o35auWA7wRqtrLWejA4QEoKM7uHUaBXjtiUilB9zAssgJPU8Ac5dVmHOxem45tHY3TIto
LABd9XszGznZ4afGpoemWeZQRxuw+dI/8q6RerzD2kPzBl5UBvC8v9G5JDKckhg6LuD38yZa9fiW
nQOXn60Mqrld3gtwMh7yngHTFs3I1ZB/cL/RWO7SH5+rvRn3/zp/nB+24L2tP8LChAMoItC72Gz+
q0mKcG0Dh/5L/Clqvw1/6yjEgZS/p+DHBfp0+O/jgueY3D8ygMKup+qnlML4j8WypeKnh4yOkLNr
JpkUv89feVWKhuvx1KEdXcegB5dKPWnKu2RrKvHzR+Ejv/h/HogZhRNnlDc8PFWi5bxf2c9R4Yjc
WyDu/m422wnvFFyTfIUmGHSnQxoccYkn1MeOcZaApE+wRDG9xH559+X/GuyqqhrzXu4vHvB/7+9E
zcDVgFP13aZ5A4ECPq8TIJWMZEx3kBerfOw8jmZvSLL8N/AymYoxtET/gZnryQ6+HxkFIz4VEyKr
+8iocnM139K48inFjJaIHg3d2CP+2bDQkOq08PU7R8a2MPfc+BV7X+80gIV90eT37ljHBkCo9WMK
j1syNSaZOnGxd3tdWsT6YZL3yfR3626QPltBsyTfq8D0Z0cM+6n5WSuIFCqt+B3tx4AeWAF4oXoE
egcNVDQXJfFcfhJBrrxF9yUtSuQZkzS3610ZBOlavu53HGEioqtMi5pGMIrWKxra4tE8X36O3djE
A98M31oIv8MZGt3EmJJSTyFgES/3E4iH2dk10+dfD+ZxZRP/sLy9g5/OfBnCde42koMJYxiTsCsK
alNuJtkBQLrhC8PwTOrvlortCcHorRBZOtCinS1V/C3hhknBVUqR7mj+e3sXpgS4aohaV6e+4mEA
AA+lAZ5Fbkn/7J7hDg6hrgv1WLNXA99D/ndpYGfxqyjIQBCouHngesknDhjupkbaPqr+pxWuDExn
z/HYGxnhlcKmYPPLFeRnErYSrFBRj8MOmnR9czCBKuZGzIq2351i0B6M8GFyI90TN2rgPfVzu/sE
0VaRCiryKZ6oM4krJrTffSLFchZQqW7FRHqiwXRykJxEqH6eClOvUaOCXwkmfDcw0aGC7Hu6oFxp
WXJbvIkGz72KvTZAn+68vpWracshTmoZQzx0JH96EPsQwWKIQdZrsBI923w9U7UpBpwPdX+ArKpy
hVkm/jaaydsNfGVevQzVNE4aDTHsgNq33hGQLx8/f/UJeI96PgVzgGSJhJ0XccevW1L37/zC13D/
KFD5awPq9H7z7sEyYSizasKZQF6lzAO9YiuksUf9xgPpX137iN+GbXj+nFum+6wogjA8tdocIwyH
3Mrxnh9Ejvu60ao4kxPTQGu5xkHa5CQnnsOBKji5ofMQIZ/W+QGV9CQEcUV2W3eNswkYoCzuEE04
0VwmT4rhPwiMEjlYYegmPb4S9LUfcjL2VbF/yGcZtkU6CakBGKodB8c9nXm0Q5m6OpOaAqYZmFdw
JR1vTR4EGgnGkjk8voMI4q79G9PNmJ7/730twfAl6AikrStEZuu5j5IlPlaHImfSgrIuYncHZVkH
+QNEAsIc5/HqfdPALtvDudHlzUvK4YYNg9YqjcpJWzJukqJxUSMfUFbKnYPg53xJuglZSml8UJ/Y
fIHjQEGLK6xsmcUcKbc1Ncq0h0Gpr9o85rYtLOLT7hWEv/RnBcB8daWrY2TRRXLOgJX2vW/5sMGs
UOISm1VAboEt7Lzi2vGnPqqmtYgRdTFoQRAI2zuS209ZvkmSCmFp43jF3W9oqvW9nJF1zlceLd+O
fmBALxHgjJJj/EylWSZvTF6yZDa42PAE5hJ5Scr6iJy/QEHYOU72lWewShjq1NVafdEY461zmH4W
qTF2Ms0kxvz3eUBDoq5BvqvBDhJ0Cjl9BHYLt3SsEfG5KjdDEQjSyZfhKyRWMq+Q3U1XZi1Df10C
3SeOsBf0TMM8TxZk6HYdqiAHP3Xy/FqNgiaUY1B2N3PVBbjhW7sDMeb9TasMHwKN20t9EQ9hc0yp
i03U54dnHIY1DOjCo04FDkha8IdRhBE7nx7Wjo0LJp8Bw9mwz4Nl0FY4ih2KF9dlN5Nj4xb+wG+u
npT0ZczWCxh8w0IwXNDI0dAHvHCc2bTYCKiu7IxLC1Zv3i9kH8ivYeAitqP9n983iC3O+X2nbwlB
LQ3zNHM0pIaJkx+J+SYkO8nAR3JZGCPaQKXLhnTvgAI6hJSyUAGo3C1z0og8CMnSldVilFs7Sk0K
GJw9aqETDjZSEjfCEwupiJ0laguKgZS9dWdFK26O651+3JAbBUcfaVjrFyGr5my1o5fNfknWpTpg
YzRiq6HGFw6XDrGfUbf4O5OanKoqfkg00QC/x8KYy4iY8dqT/NKG926xiq3mQmfOQ05E0fQJ7Y5O
RqFVhT8wr3O+cXkU8rHTqtiVEhrYm3pPNRwLeMZ2tY5dmvq/9HQrnU8L8OBNK5G5720wlqgatyml
MeFGMBg7a6IU/Uhfth2LIEQBjwj9thlEi3UQt98yGrHkb6JTSWsahiW/p40UtkvbibKpvR6EKnKq
SuWQ6zq+Oad26YCM1+TXncre1b27MRgXM5DFufkF98riPVFEq1n4tJlBLqBtj0tN5MQEobtFP8WU
2HUsyBmiwKztyJ3tIqjd2XvO+AdD8wnAjmIuHgVwAFflOARw5ErszGQIzMleyYNUjqw7Jolfh425
WcVHTYHcw5UdWq4DblYOtE9mCmtFqqWxTM9Pp+hRRCnaVPGLZTveTAKIQuR2CDA2/2Ab1T4WnL4Y
viImVkQyyKBgRtP7gC7FE3Z7R01sJ87iUGmihLYTdaObZGSkR7rwXciWeuyqqmAHkvFZaoB2EYYj
BQSWPvLNw/KXp/9ysUT8G/PtP1F6V3AR1b1QIN4H3oBFzbw7EIMpWQsTX1AAUfm6qw0L5JpODwEe
wfm+UXJWNsCZLiWIyJjtjmnnX3SH7XPU5Tetfy6MXo/RXBkeTNm7H0QgF9z8LvP2b3J4q22uRiaJ
pCrEm3+XKU9dqAYYQju+ap618X6wwmd22tFxUg7mnAOT5cAevOwPGzeV9r7Q+ZJxCsMHFnZJOHz3
BYF3nvNDnscizWH2qB0RTeBnRIAz+vlRFyfYfwl8cU4oDY/PKs9c31XKSlidcqhQGidVWV/4aKlW
5r4Wm+BsmzcvRrPcK4Q0KIQ+NxxIh9mRqLgQYZoW+ORM4QC+3YGupQWV1OPvdeVCCf2A9rC5AT4q
K9XLMEaeOvDGTGT7fy/A9rY3lAIfJJILKj2Uls399IIWuk7L6MhHI/xNxGrLjdnOi6alY3FQe7h7
tNQYKcrENQBO/kvkeDjYrll4FfxkMHH3KbMvhm/koxbm5v3o6hrVtNRpQY93aJ6Ns/auTNZvlVzp
BYiB65XUSDoMnVlku1mynzPcvlt9zx95ExIPB6Y2mu9srgXYXv2x3AO14HBiJX33Y8io91C+qHtL
AB/ELZIE1kj6Vq57mrcz5jHLdE02A0RV2reDY2w35adZKVoU8qSZbSoxL/NidAiMi19tA9OIl12v
aYbPCSp0/sZh8loA8wP2gPpFmAp4MOroxhER3S9WcoRQcECBodA9vnaNiW3+vw1VJyyXuUHcPrH7
OjXXhgDVegRDVNq037YMMrS/umdX20XRM5n79kYiyQ7/vGrLZMSwHeWm1G3sEsu3s+hNFI6wZwRR
gWVy4SL5LjEYa13ls+wQeCx0JCqFQXdujBeZvAQvF8lUchuISIUDvTXPz5dtOqOij6UQIvrswV1H
gPcUZ9JgDfWNOYox3SEs8ovPWiAe73UUIoNcAQFeQkkFK7e+oQRSD8/HHlHJaKi3S1qNDYwY1JsZ
v4cToWn1CClZtQ+9cJ+zJ6Eht2rYBrueoTELQSOOu5Cmr2SNWDt7i447grcEs+jd6wS8VeS363Ay
Lq/X+HytxegHYID3NhGD3dozF9+w145c44Ge0gKMBV9eyTvzFK2W3yLtOK/PtNvfVy8PjJ2tac8s
5ICxn9nrAnlIzRDmyllA/2bNDfozQQLt2cCvHx2Nybcr9+DjGVtEHs7VOrOJNjvxKtCH0NW5rO8D
3bQeW8J/TTsEXiLL8ZmiuJl490FZwjywsrvqK6QQEUO/nqC24CDffGwEEvsEANcIv8uarpyc+9sL
7z2tJTCTHd5khqkGAHWXr+CRKnqH7Nbj7ne3VAyFNN0ue0/A3wuGCmyCq5D0v7pz0t8yP9oNixv+
b7WsATsWP6YAk7H7niPaLgN8Vr+p3mzpUFccjm50ZbpDUsPHFi8zjs/Qh+tkHwD+0s6j6KB3w6wz
aySjbWqOqRuuFiFxaveWLDJtnwolwdwf3Fd3IT4aPIz97AUzDIZa/ULj6SsahKU/ONzfGayOK5n3
bk18VFR4oF+qNJiCt4G9TPCjjSoQ/VzqVnTbHjpNhuYxqA2Yv+yVpKf0/DVAt5TrDJGNSQdyELIx
ysTnno30QFxyAMyW7LqY5ZnOTM1IJVmkpE04TnwtNpXUz+2/bbwRJxZ5/MzLbfGkdGTIGRIFJx5G
jzObQSxIrQlMJpS2dy8mRBRPMua39kHThCAvlBQNb0hkrwCqISyagMFxZSx9hswPcFl9pGlvPqeG
feCIL7qmlnHJ9cRBCy8uHpImY3t3ckK0I7wK6ljYAEOlEk2uzOY4P3GFT57xfCMqp2Im5UInJbOK
G2d9eZA4xt20vO6iyXRpv6H4RNIOFPDiEzLIZBFiJpB6zdU1IGrOjweeuytESx/5ZaicNzztnxhp
wazr+b6srm3D+RLK9xLuX7Pu8nmfjrmMDKVEXiWFW2z3bMhNGZpDPqJQK/xij+5ZizaS253qwcwU
u/ttYPnWest2/+0rH2P0viQgtXbe4hQsUoif4yMhYMUq/U9gfcmM5ZHOHXIw+A7LaozRyahn4PWg
k3ArzgGS49sH3sFSCxjyTiVouOiRLvWaKZWXTNN2fQYYA4DSCHSqI9PGWCh/XTG6RyiRd/Bx4iso
uVoI+BJccVfk1exIlunJRxJT76I1NsWoUIK1YbahOExKtsuvyXGLI/o/YWvY4yzwboc207fpeuwj
WKlN7e4DN3+IYAQJ4UhAqN34gJYNNA/H6hb5udELnVilfyfRdY7iC8Sq5OIOdJR9GtVq7gTcHQTF
VCSixOu/zS+GTZ3Jk0xKxADcG6PFS9PEMvvldTzzRH1kr64gD1toF2lFuFq4ANr6+68vz5rP6tne
Xn29cfVvdFfqivtpfO1JZ3ymIHAF8OlNqgKFJ9mooE0/4QZE0TsXMoOuKMNwRR4q8uokEwpdxT7K
bVwdQ1W3+JPfcygSpy7ofLFppzcQBQhchFZHaOAS7FtuAcxDkOycTgOS0NWhs1Pg9N6meHbt3jmt
0iEVPGLYRpCmL33euF7kSU8yXV9Quzf64EQ2SCYnh9M3VErdhwWFafRckbdLZQQBfNUtPuKcdOU2
r0Nl1k4bpLohDp7Snh4JLFpQs5OtH/9DIzA7KSILDemplci7vM62MWppm4TkcoTPoBYdBpM3uvyc
Idws8ImfkFjXu9BN1cE4Gv0BMJG4Uqh1I43QYuQc0V7Fmu28h2qfMq343+2rPvceLGDne+U1gf2W
1nMlIL1Nyyzrg9+vOvHlNAtY2FQxjW/ViR43K9WwKGNcgqZo+yNm6Tq+6FGovqID2aOwZewpGZuu
SH3VyYgEwcBTyQODMIPhIoc5qeGvwLsU4h0whPn7BGtach1XLsBFYuSG/fGQA1PT+gtJydMfhAEP
R4oqI1UKr9ggr3arg+zzsi21M3MxsLefamMltD1BbV7drDvKzPKHb1hJNuXGD2/qzm9etlJEgRAW
8hPWcHeMG1lst9ckhuOfuSC1kRr3aWPlBRkjL8VItR2TnyjtumNjeYP/BX+4XUw5UKfA5jQN91rm
NyokbXcS8Tq/erwlMpYKWkGr3T2P8O3ujU7JKWQvZwSpOWSiurcOAuyubB/5EwgH46N/ft0KaZbl
C+XYnpDjhQsR9zytTC/OqdNOYGaiux5XPCXV66XMJ/ovZ2ZKlShztDBDXMShCBN1oMSV/tO3KBCs
s0GAGdfZUR38Bir88zwAICXu929iezoqyUs17l+SyvJWRx56+AnlH0pBaQsC/0pdWHjLZm90wjmS
g035pXMeN5xitqTh0EIcb3qHnNBYG6ZCD5ROIEYX+GHYP+gqTDKGpTl4c28ijoNpTvwQvkSwhppi
ETGa1hvcN5YXQZY5H33QIe5hAAAgp0GaSDUILWTKYCiZv+ojSyTla94uX2yR4n7u++PCYLebtG5t
QSbgE/e3+wK+wiDHJjb8bQsxnrYSWfVmDegJv3o2hyYkc8ykFMfbEMJOSwIK8egzly5dvMqQzg85
llXH6+XpyfArSiXaxrdf6HAT5RVRZiVpZN9WpycjRXoDna4jgHrsw+GjQMScd6+sXh1KC9u0C22J
9hzzBoWNJgAQgCxajciKcNgiAQ3dhTeJYTO9yg+AtB0CBmxLPlv2b35GeyKxXHcP5/GvpqS4WTpO
H4NTmLJNAqPPtJoLz91CLQ52mvHtD3zpFti+2vTypqnEtfPN1LV3vqhkeQXVUsv6ZPMID4RiGbMn
JvMGD0PvAphPNaXVNjp97O8rtp0XbXg+etiRFKH/F13D9URxIpQqA0BAyXSdG7C1rYVEotkvr4jZ
yvVL7ArxgCUys1RcRVIipWAlr2Q0aStIi3aPxqCrliHwBF74FluTLANwB8wIQCJvj1VIgVqneVBY
m0hSM8kvZiiVg5CLqlYDWjGwn2CCtVxAm6WappBbsTQ5qOiNSkO2oFT4BiL7+nADO49iHd4JHhRt
mM6nZlJ1zWPmee78qgtJB7mcOBGu9mEBX84+YFfs/u5RVc1we25ZRKLxofKLo9fkwXwdbisQeHUz
/seNMzGprZUQpHhweBky4RSSbtRO+JcPIQQ2meveeiAHf4zhAXb6Mtgg6/mB184vxAIe0nEgdrSO
Ic47IwVgyeR6c6/oDwo3nZvEWPI4WBFM9QGCIl0DKbBTdxkXl4BYNdhvqIRxyNWLZkL/S190tg09
ZlGOcY2cR4bcEV7vSoWQo5tEj8YhBQMeN6Q5xyIt6K+d2vXpBX1MVWfjzMgLMIK8BrUO+vYW1BBa
zg9w115tx52FbhySsabOKIZ6PCQd8aFbcZ1ThtT8vParYMOXbK5mJZOW93GK6rgUpf/yt/6NNqk5
SqFp6AIj4YFfA1daxFXLHFhPWYJfDK4rb2vUIK3f+k8/mTuoP0+ITC0mKBS2gwCYtlH3g5y/Ekc4
p2eQmLu/nkBelXKqbDkFnFgyjcEHjcTZmHubuEonoBUsvUkffK41zvebBc2rDX5pHuvwo4yeqfdV
yY9Ea2vR9yVYDw1lnysQf+Enw4WY5fWwOuSc0qGDPXQaw1pe5/MFV8DZKJCFadmH5Mw1J1zFTOqO
AZaEae5j12PjcxJHGEFODNRHjqCdrctE6J03YAP/Hu1965sbXVwsG9MXZJNZO4zkhBL834EQdTzv
sxBDCRu6+dyov6X7RX2oeeRJUyAOf7J4dHOULW7HgNbhp/sdjeNoL7gu52VHc0YzoR1zKSGvAZq3
0u9iTLBapAleF8ezCzRfZa2tVfiWMuhiBBKu6z3JzLzCXPpJKBsyE3dx6RqZj24fURkQaaE02h9Y
6xY+SKzegnKeQRH816RBkof6asSaEcsGZwxNVX3YFi8nR0iBSkMaz2njMQig3s/GCQH57FVjaVYF
Lmia3tjE7MISzYrNRqYCbGDnt8yuKf5J3pi+bKX7nqio4dQLH79kEZI3gPiF+kRTSc49aiCH9wHv
7wN3iifCN/lo8aTFrn1Hhu06kQmmA5nrQYmwkTPGe17+H2RzfJw72HUDrt2ZsN7EdxrdMGxrx95w
S1T6IYo27tPyXKXk5OdvgMEkUqMDgu1ajnsl5CFTY2Mibp8If6EKIWGhP35ozvlP+24Kwf5NiPhe
COWx6WZzAGYFn0+dPCR7MpZ1hokDC4iCQTBJJB35sko6VBzo10/F00AsZPdkkKfHQ8JjjogI4ysc
8F/6RuxuI/ceAAnLcJgd63Hr7JZMY6RxfUUzjskFR33FkF3EeFY3Sx9mWctPHi2g8SWy5zs0Ltry
K+eAV0Clc6+nEXq6X36G35acXPfSJ/Z56w9WzoE3G/5efPeo53DQvf9uosQg2kMnHsE+xX6uQ9aS
Sx9Vzn7ythJzmwRpYR3ESusJkumA8ebXkFJWk53lbuvEoDMVYz6/y/Vhlk1T1UO16B6PH85A5pHj
n9iQrhCFJ/UubHcFLRbV6iZ4v/h9wfN8WZlUWMqZrBp22Z4i4FKCBVvcpqB0l9Vzk321s2z6v2qc
EdTBhrr7eu6mIEmUf/WZPJ2zzAp3HfRp6+MrR6rS6a/llpy9G3R/gyqMQsQsoBy8TS+Qog9C5BZB
Ozppno3RvLDMBxHcsqe3NfcP8LwGdSEyLx5qktRHrXsKrunj2GjZEEZgRgl6Totk1dIRqFV7ounJ
m1f44sRGD3UXcICLxD/Cbjm50KDbdpiqeONCQlMN0T0DqqvC9/xy52iVSOsXOXBOgjEh19IUABWB
MG1Bvp/qUWWo/yV4+15p+BTRAQovPKvA3T7f7UMBbsC4er7kwgA10adleQBnJgwK08bxkLgcq8F4
y/zdgr7Kyi0RfHzPGpN85kob8tHHpRN743Li6xM5yD3sqskPMhHGcSjX4N1Ggui25XByjflqTeSw
cj40O4dGDfM2jBYvcqg/LhFXWub9jkgCt2c8hdFlHsRg71rxKbaXI12bk01nsuXlFgtyFSbfpISX
+RBgd52fcaBAb5e0L/GyFlCcWhk8fg4TnKhuKs5899q71FC2IR5VnFl6Bl7CItBzukK+jlfjEFAP
tuv5kltiZJMcIsQ2KQN3nEGzArO8FgUxQLgQCVVgz5cLs1cjFeDCo3H/VhDzOxP5/ubfuTjz9wIK
2Jmq2ipj2y84UwjeP30eXCqIXx35zr0ygu+xq4AQCchVqdD9/YT/dsCQWoHushwoBrS/XRqu2069
q95mEbP74Ml5OS1U+0ceSVLMUj5glXFOyxd4OupJp2f3HEe07Xfyy7NnB2DWUB2a1rYx3tmFihVL
rssDm1cplKLt0s0vLyv4WjkQ7f4wCPApiegw6y/ciSCUfQ//t+ockB2iA8C5049CJewyq3WYN2mk
XSUEkoavPjgkBgK/xeuYuK445D334+JCLXnzQSM03t8Vxv4r3qM8n8UtGVrQF+XTyLXgCp9Ffrym
k6kNHe/yzQPIy4zFAylvwuw3Xgrv3goWnCT4miJwsP0yQ28t0McF8J+PpUKYIN+5tzIiHtIGJb2W
/CAYR7HHWA19daeVkHByU9BJBLlJ7xW0xVv6aXDIIVdr3/xT5vcH3PnHiK2yxHglwi8M3sj6eqrI
v1cniR4t6jQkO3nLOa4gNliXp4jQcycNqBhZz9yMJPbzH4dOnkwUBUGlKiJpudSftw6yhii2DX00
ty7ITiomnR0ngYacD9Bdk65wrGuirgH5fDMnV6/MAtJVOvc/yy05nw+i6FJgbRbTcNEU/xzqYqrW
c7Z0tNsv0tpjkapmOCpvBJHu1gFiR6qFMXEO/gONZqWXvBcAMbrbQQ/VllH7foiE9gVFYy3OrLIY
sAFwED9F3OBkuqWoMiZFx3jT+IGXja2iR10CJx1Dl1lRbfTPSQq+PAa5pdQBFMQv19SVnrxQB44K
0HKdDiavCCewQ9ZbeEHJFArGM3iFGl6uF8Nw46AFaAsUk44Q0axjzXMeQo2EnFA08Hp6zBjPpJOS
Bf5owNY3FeykE+Fq0PlaiMKgshOi8fdmixGEZu6krS9SQWT35y8BrHolUPgCvzTaFxC6AqrVQiYy
AiCLdn/2FAKqA7dgeV++CSqd1kqWDACB4hOaNia2mPS/x43N6xRT+SHVxakIWEaQgMjbQNb5ups2
vdGIBMR67FnLcOIHUdnFawKnvwh4Qp2ioUc7hhKHKRR4xTi1E7pyPF7c4e/ffpBI0REJOnOfV4oz
nU2KRrQN3ABy4Mve2gtDagpXlX7fcTcarPE2qc6VL6e5kDN1sOvAb6QsXE/HUkjjsi1nunm9QBht
XMpLh5IsTPyqu3dzgtc7CGDJZgd7LirHhBXgjvncdWQwL+nm2jJXH99PPsSw35QTrudSXgzIS9KZ
1clY9nu476h6nJrWCD2e4y2oJHNychfZO3iMitBm6DqgvpvdN8E8rlMaSVt1y/x832r2FrFOGgQc
Pgn5ZESeVbyQRBIXg1mrQ5TnZ1UmrxKuC7LuNMVoZ9fdlrSX7+IFxDUrWN0F3o4XOibvpuvG+s75
js9zeDwzbbRqg5VegWhwhGphExp1BgABmq6C0fGEiLIKmQdZjsIc1GiwPrkockvyuenyNby2+V/p
MCqsoiqmsv23crFhoW/Y1YIA4cqMSi8AsBDuCzAg/f5eyYWnd9uTET/EM/bn0Su46cWu1yYwE1NB
gqmGtXi5bYFT8MX+1yWuz6JI5cssL3uF1/ilSgdz525AMNDD+VNCvIjqwWzmmfZ5AqgUAdv3skVY
rk3E4ndmFpLlY8VLi8lSqjaEArsJK/ZnuoV/lPmbYCJdwLW6gegMN3wqTBTTnKCLrIiDM2PiMUOo
kv7phle9uxc0x+LM2pYHOCQyRPgJ21fVQ7qCHZ+PM8mc8f2oDr7yANM+Inmi1YamC5oDUSvggy24
abrDrtr4t2grQfKJ9iOXk0xM1CsFpb3uNJUETjt1LiS0VefKpkvhwwWdLaYvnbgDfUSSPwE/jqen
uVSZiJj6XeoU2Z8kqXGQ0mEfACgrlZeY1jNwIpNpN4v348hqLCT+0rLjG/IdI1jGcG1ncMNx93Er
6S1oZc3AZUmdCtm/Uv2NC7PbyZA4Kc9eNU34+xq9yPzZlI7ln+bKLSwVgAadluE9wFJFQUUPyORW
FDcCAkVgsWybEqC5gSuV96heak96s9Wny2vGA0A03FLDTc3vKlORaxilFd5ZAZHPdzF0CWOH5Yc3
hMlf0PS/1OswxleN9GYP91cZfx8KRYeCk9W7qk5YI2VheQ/k0PpgA1tqlcOMh1i0/Vp6USU4kd/t
ZQM6zjy4pisy8hlB7oZtdWvBC3MQlbKHIMKstTliIRE1qNf7tjNHKeQ8IJZjMQrLhQMq6+MM+HLL
/BseojmozdLGBv4bd3UlkejPnAwnZqLqGi1WVOBh+Q493TbSEXQY5lNBdXCRhY+zMofVLzYPuz3f
IdSyKb/UT34ONUCxLzsl+3gkLEc4xACYorvcqewuYBFpAwB+kqmBKc4jY5f0Cd9nm3pBNpf/TEi0
yZuySJkw9DlBkR3UMUESoNwUbN44/1wM2vBOELrhw4/+r7yHR6BAk94pdUcTcL+njtfmA7bEhQtQ
SQOBPKTBG3eodAzyiSaPZ/7r9KgxIiz44pByRp7EM9UBkqDqid86zMdNtKfkrjeI/iTzaRXlV/UM
3+ZzREC2KEm6Npek/KOrw98bNGZkEU173TyYxfM4vuQGgKaVaoRIqTR2QmDuoSXAuHkVDMMGFbBD
vnaJp9VO6aPHdeUIvIQKM09/3ZZK48ZXseFN5+rFyPdsgcu2dObam6zG/1y41LQgr8AqMQiFHPRV
rQj59h2KouMbWdXsXHl84l9I/IzmxckhIqE5W+OZIkc2YkHqTM36DjYbO5Gv1HZVogtGWw1QwTlv
ZeteWMZ7PluQzPu7TVQH6f8fENFNp9jAtXxtdyj72BToje0BRXeZhUAaAUR+XOFDB9dQhc/yT9fK
/lA3fzjoq2n7/MKOmCI7Jf203Ugz7UQNRcbgVuAufTeYdrHgXog3UWP5ZVJRMrpNyIyFka0ZqaN9
g5Lyu8QyHqD0K6+qU6H+nTrEjV60DixQjH9/g0CPbamszZ82HFdrSUXcf3bMlCqen7gt8wWY+E56
U/OTDo8AciM8RMZ+ngVJEUj8u5sMAIgJzMV0LcfwgQ+uzmYjYiEpEZ0uXYxZmkIeAzFqNlWL95Sn
CBJ9EhsLQXY5MzJmi1CnOvLCQXGij1TaYzy+qKO19mmbLe4vFCkvdlmf73BD6hQqKXIGaJMbAotq
kQxjJwtDjJrBpz9L++0sXUruaYlaZtbtIiItAlQNyRDVgZsclxsVhDksN1gC9D1QEVdqpVvNPCvm
1kQITq4y876FCSqYWNfsS0d6Fd2TzkJq9fUJhrxIyHVCOhLeRfp+UdxSQVBzQ+3eLDxVjcemxysC
wma8Ynl00F1PsnY2gNofLYJsdSvus9UeBrd5UkjbYN6PEi2keEzYvGcW1s3M3WfoNTErJ9x835Fn
SubJ7NVV0lpyvvRsniVHnr7yXGRrU5vQuWm4nHJKxLGVUTx3xhJjda2uQNlXnUvhWcOTTuBuX3/K
WewVS8HZdAq0mUqde1+o9qLLdTRvAVGBBrlMVx8bDpg0XBMP6NviGZdo2r71mPwG5x0Xfdu8CeKb
s1FLChLDgZizPjhhbvyvG3oPgDBkVd552L/bFm+RDEzbbwth2xjdyprv8Bimj1HeWCR5zMuWkmEd
GDysl8JK9jqbAdPexj0Zy9V49dF8C0Vo9dsWQRkzTKHQQUK4RfuM7SXmNGEE4XGQjmr60u/DiqQM
3m4sl7kOZsktRJ2FhDCEXM3QJG46xys+d4t6itx19WjLFB1E7syXVj9i9phTNVnUr3TNj+SKyxbT
fluHQFjmOSu41RW3q8xjKIVVQNgUTPWHSi4zukim2vIrVWXD769SYkdgQUD+ccouYoqkLEbf68ft
xfsHVhtdelzPOlMmVioqLdVb5UDKnM0glGCAdHipeiqPHI94quGCRY81EFrgb8S+DjiK4tuYHYc9
hAZlQYK8YaHf0fOvc+N+aLKLPUqWo5+afusWAMUFEvcifLTIadmfZy9Yqxq6L3tEb3+d404MqJI4
WImKo/OP3Wzdin7kRd2snQrWY/cLIVvAEW395ZvGNwDlGNW6QdX1piD1Zp50vhvQrGS9zjfm/Lsn
cg6XCLvk0N4Bgge4mW64BJoJl2BDMwkhpQ9+EoAzqIcxiWsJsnt7AXCtAtg/b9CeOfYz9SfMRvv4
QB1EcuwHUqdvvqTmfZwRSiBrNknXrId+lllvJK1oSdeopsR5i5BWhTpVBLmBY2hKlhscXJ0naD/E
mO3JRGVunfQBvYVDWConOuWAkjpg40vA1gMsbhLj/vRMezOrNqAIeGCinCkk/DOL+ZmmRIpeRVTL
TfTZerxs4Pf22RUp5G02Q6EGNiPgSQi4ucUabMTOVbGwCT6h64aTYm9yiLLvTaLiur7qMbUqlIud
ZJZkpLkFEtoz22XATLf1qky/2XhHrl7Xeh2EHrLQPZB2XnBrv1suUaPZHX2Pcz0I/MyeOi/GxrvA
7r9XxbZcIk0j3r4XNd/tGK9fJ7ZZ3V8hI2CAEX+KpcaRmC/cPMkMx6yIZWyOOzs0p3UbBmxOigPj
Pa8f/DhmA51iw2zWyXr75dreYwa62dc6eRuUFxJCKv3ip7u9gFctRVcaviSz2dxU9P/UJ1qgYbUZ
rg6CKUUCrkaeTjfOD1GEcPAK+n7xClkWbvcfBPBc+PXzzCcpRHtN4+6gY+lY+Wc/ouxzOHtDKBT0
1/NupNI4E1xFy5xoGenKZVfkEyxxtP750u+qX7dUiHZTrN8uVHTP2rVzssHD4nhg4I1NOWU2taK+
yTVgkI9iiseg5ic6niAGS9hzdEELpjcpxB8hRcxvpDbecEEnInQmRScSIpKYHCfzAA0aFGeOw9e0
EjYrk/xPlBe6HuXeZUyvD794OU9wMxfDYaDUeBX6nwzmjZPjcNIL5a1JtNxfdk0Hhtp3rB6UlmPn
A1E1zpWWnR1qhBm+U+FNh+ZMsgtTmzINDQEMYktBaM6g1B6eH8Nimv1vXM4aEi5uSAiPyZ1T2Ukw
NyVAHkl3KliKtikDbBT2vzE18MXJD7tkz1KhlyWpz279STE99it72dQOJK2sAg4eCovke7lhaiw6
VHTGQ8jPBUP6IsaUQLitY3JmntXKkaXdHfTIw/nbmyCnDjAkokQmuQyvw8Pe09OpG99HIOr3KHcw
z4wdM6lmnA1RJIfqoJhXbgPvikZY7YxmcmU4Q5+h8+58rQMLXdgyAKavlHz2ob0tOM8maidP0GHS
eA/mddCD6mZ+lqVdQFzCA5FjVVxqJ4RZfU6GXGgORj21bb28aV9I1uPsrEIxKzWfYezZl88t0N/a
tikMuzXdvxHOqOchl4gvNorGObTi9v4T+N+VL9coJPOo8JrUWK8TwAOSQSarD7DWXInRSYl3YIpo
t0Necx3RycI1QFC5HZDqjvB9a4IMZoYr49aasHoU+vnJpNiisF92YzC20p12nlrzVv+jtqavS1ww
uVcMJfLXXXw9R2HelwBKpUTBE9WWLeIHOT9i0uxPZTB/zRy/YqqiaKQIJpAcJGd+hPUrwWC1f4hV
BdHvzo76jBVNnrJxPHbnxBhcAhkJ/3tOj/tqCTSFXuRDZUAclsCdl+TNY22H1SxhGLef9HcSUCK7
YBlpDdFfUtSplS9PM9O5FWn635C29Vd9iTFW6Am6qaH2A5k+lpPxXBQEdl+5ZUEqHiQIWcaQKl0I
7oQkmO/ls4TbZGnXL2EXZGQvh2qFWUVFHCUmgOpb4GVGbyz1ppqFUgdv0wndad5AIeqYbQWOulVM
xJE9FyQ/rQHG+hO9RgGiQXCufSeyAAQytwcC0aZWnSav+SOmyukFqGWI1D311gWtCfL8NJyomb6j
kR08LVsp3kbfew/elMmmUlP9wzZbwutGn+00QIZEwh+O8n1ZhjKEncDZeXoOqLfPRCkDomfpyoK1
Ludf4oWt9xUzTpRw6sO1ubl63n190Kj6qL5GD25YbXwPkBrG475QJalccObWoDj2t2d4uK3obAJA
D+Q9QmrJb/Bc3OfVZ0wTnjXJiR3OYjt2NmuZL3YvSEXi/ZKXJ+QAR3LXugp72SE+eu0oMKLXwwP9
hGCIIB7+o5D+7F/cID1hZGiidHo/cvotLweuQ9pCO5mHd8XKt8GWcA2ZmYyEcY4WRynKQPI5oxkx
gyjVplHW6Sd5Uwg9r/flPBXfLALgMN7JQqrUMFbsQG/te36FNPAG/r9hTKOd5d+CdcMh26zdoyeK
x1K73nfYLnCax1z/1jeQYjsG8uHcph75Axk8WB1SyUtPzgGvTGw7ABScCDpKHs4iXBnqbf1OuYt9
q336ecOEkyJHjfZ27fpsDIw7DoJ0hf2mzkq5Lf3OKY74jzsbbibtJO81dc4MqI4Jm5N01wmizUAZ
MNoANyjaTKaglqxzhZRzI71L60gsWR9j+zdS06exA5sIYU7PzXzCf5/yQvo3WDU5qho0+4f041Y7
sHBwf/32z7gqdZbjs01p0DuOamQEApYY9dbtPxkDoL9G7vM+7GQpfh8GS0W64XpQSxKKMJXYMDmm
vdCkRUnwHI6rePjGHU2Oi/zaoxM/bJJezZBokGj7rGHIhNKssOa52TP+ve2MIAiNMz87SgNZA7tL
B1nt7lYLJyobP0KHjVdcr62+e3hQ2cSOJDiL4XLaY4WWETjMY/JIRNJQUjv5Gwvdeb87rdz3II0t
OMx5jv5qyL/RH4dhJyLIm2Q3AoaHLBkpktkRKzQhF+uZshdHMDVCwZFgiQ2zUGW9aqzky/SzdpRq
412fIhbUNAfCzytP86wpXlNJ//beZNZzxbaX+HFYrNsQ8b4PlC76oPQysx68UZ97MLjPX2GPU9fP
VoFpjyjmZs9fYhcczoMhBS2noobE1mKlueJdbIByjhJ1LgKN0Ksc80P11OfJp7rKk8Cmli2Cqycn
IWSC27PK76lAUxNe9/9pTHkxjOfYG+qJQo4EazERlpZOAQBkcbjJwuvI0Si1z3dGbbycGAWE1dE2
ieBoiNmjwrISVFCGKUTD4h+kcpAYW2xW0T6g1gWzmGYKVGxgjAn2ezLTIc3b6rE1t0FBuoeiiP1I
QLurtIxYc53iFbAWatVtWquCtjy6qF2LIFTOyoiUMVgbY8IBuELTfPvsVArxeSgSb+vYVwJqjktV
VEqzaZC7MKqDrvEs+LP//IMY415btFA/RHeSvtsoMrz2Jx0IwmtHAe6fr8G9YmmAyqTEzU1dnyK/
rpEYOKDvDHzOCkYOQdcUq/mzWsaP0bDcyNnzYnUjgT3BX7CaLXlcJc3sJxw8qXhLELzqrgEpFn0t
dKemcv6lv1NhgjUaZ5jXkOwYnf1olSD9y8v/xueDKEfKOwhcY8g2/SpbALBCaULPAJr7ZLrIFyb0
qxaatQoOmsZ+DZ+ijZ76S9MjpvdzULWmdJY1vvuCpn2dQAkcTxXSDzRJ4e7oL2v26uwg442iRuB0
lsVwtgYSjxCAytP2n5iMUz12JPft5ORJdawiN5q7LQS5/GEo+DkpIbwmoK6vWXgbAw4heP44JTx7
QCjAq1D+c7FvsdhmgMmJQDM/fevEo6zGQH53PYO8oaZX0xporsU5fsST25PWuV1mMviwrHBT7zwp
lDIRFui1iJvVamgAyJr9PeDgiIXcCfDVjqomDvpErr5yiu3sNMPBIbPQSeXpeRCFnprenFeYDZpV
ykAodj5wE159FWl2YJDVnSkO/CMS770WizNGEocZ8r3Kvk5xLOSdk7EtBkggy0Nbf9aORDVK89Zg
bSDXN5EgXeAw+e4KEzn4mwASzqdF3wOgCkUh2O4JVjhnUNKs0wqmY/qr+4I3sxpDCNq5iEDrq/W2
xhimLYDXTDLJ/BkH1cECn7/FUa/FNjMR4dHlTi49HNZWZ8APEzlHbJfNW8deR0fp1mI942ObxIak
R9QY8J0BrXcISfrQIDTSAvMc6X6QNWvAa9Jb3iKonzm9KLCetg29mKb8IOfN8MinbyfhHhjZgm9X
YQ5iunqyrzzHu9JQPL2LlkXAToD9r0TbVXJ5tMYPHzhRSBefyVpqQgY98Udkf+7Qm2qJad8fjG3D
cp3UUr+iwxPwAAfIWv+Pd9D8TdhDp3d/beqoa0bOxqsZxCDrOGKWyNc5zn8t6L/RqfqK595BMEsk
1oOXBQ9XWbJ6pRzgQ5NP17+Ra75EdQkJXEG7EIG+DfpD/9udaThMRYKUiPwY7V5exs6zWMU8kVjg
zcxyBbnDbUW/7+SqTrwfxDONm2hNcYhyVgaxahIr/ttjr3vhtr4Nz+UNBW76J55ArRndfVriWaFg
6JPPT6khPpZ68qZo/K1GcC/hy5W9yn+Ovu2h+hOzPTbANX4vJefvNLIruC6ctqaJDkQ4dyvu56UN
E9jmaq4xZSyGjobwTrqk+MoE7mkSNHzmESUqhkscIpdhfnklS3suOW2DaOLs0p0iMFz6BroVXFTS
8Oe6u/XdvGqpJQdddH9Fn14VK5aRxC0Y2Y9wDLUknW9gHywkfyYiBgn57tTugRgG41VXLUBefC11
7+EAAA6zAZ5nbkR/+K1ToYFL/L3NIG5vGLxJ3FDqs67tqqNvMDWHyEZvpD3a8vL05DT7eeUKm5eh
BMBliXb5P0Wq+fHPXGGRTxDBh+JbbgcjxZAG93qYa7S/q+kz1jQ7GC5KJY1bFIZllG9Y1HRjHqrZ
bzO306wSPl0yxpVT+uKqePNkrx2P7zsJND/9xkz4+u/XiV+fKAlfQUWJSxwYIQtBLAhhseAFfueL
VezBsjIYDECvzp2O9S8dP+BEHf1bUjQxgBkSUBmWK4c4II9FlGARiWcH3N6melcF68hXNWC+5OXk
nAA2VgkDWGGs4FsIxS1s3AxEhgq7zNHNTyUsK0fr665MxPeaoedLhj5TgxLthR91R9X9CFnnvwXq
BD3SWOsTRDXYU/o1U3O90ogmv2V2+/XC5joYlySvL5vYMVhNyZ7DqOqs0t01o/pjWN1z6G2OUhIz
Zhepro8faIPmYt8dhwrphKgf1Nj8SNEnVN4JdG+RhIm3akc638F1NxpEvXfMgbwvBOnIj7rZZQgT
z4F0n/oKjXz4Q8y+u4E8ziUjaYoWIRur9nvS5+sqndl0xJ+mPorR5k8WiJeCAuyV6J/dDmpBTDZY
nJw+22HlXYVHp88y5o1jkjtxDCsdo6Jy/R2CxyChlxP3f9D6OZwTvhnerHpqt+qBDiUA8u89Op0I
JifpHI59XBLsBwj9Y0nK4I0jgu60SvV1Hb7x2jZPjBszrJuH0zwgYcmsFH8rniM0jaPYwbU0Y11+
wiQI5L5MApkZ/Uo9XuMjLasraLyhzPyStB6PznaqBlRBTBAoKE0YYZDroJQoXpF6ZkSivc188ji0
q/UFKx/ltRlos9pb/FegjhTggCpKBNqSeYDdJqgv2UNWvuzyZZSwkohYandLW0BRwb96U6b9DrlY
3NLQQI6t4KzqssED3OiORbPei9x9qoYG6jOccry3oDqOpc5sUjUeX3Ekkir9DDCNkUoS/dtDMoP5
ytl9fepOhLGMH+aGSmvrJenYb+Ey9XWLmXDcQX2oyHumwV0n7e5aTA/soF+DQfpW/5zDL6WH6Nj/
b+gz4lLzpJQ6AT/AbRnD21z7VswtE1eWDLSA9uJmZSM2NBuoXxU9DArbpqZ789ury0JfyUgtmUZp
QLj+6+L5cLKqJLimwyvC5ELryJWPTkxFnRQ+4Q6Re9v/B2U6JeiFdrvr/y3i7WPEV5yuiHobSCF+
r57qKQxzt5kesVPro/Ezs3QEIdi/FZcTsIq+S/3/Mta7GfZldwxsAS6AA0MqteGwTK1gTvR0d8eP
ilktCDZbOb3nEglWhRMlZWpzZJXjvGmbcX8Cokg4ejIYM2AqGguAvg9f2vvkX0IdL+682m0mXqaN
OR6jUGGfV+te0ZMaelgKNwBwb7nvzqKniEWxgWa9Sc9PXAtYCbvOezjQtr9/eObvZEmWwe0yFAPD
tBSC54fAGJY6Sf/bXoZ+FC8z1hZEDhXcUzelaJPPKSjyRFEeKMIP6qD7NmVtQQxzvxiCEVRmTin4
aYm3j+H8VnTeaERgChrSdfkzezHDUaGL4k13ZAFimyjBl3kdQ8kUdeyudUW4Y9T+kwf/4yPk1g7B
Cgv2FSmA4YdFnAxWZXAoZAvZ/fakI5MUHTdS853JM8cEJXbrwXn6/1X7Ochdz/6r/nxSqey2VPp5
zI4lpB7ck9EHL41qFSBtwOgOZ+RNdiCEEN8gTmvIdrlML+aN626hK94/NWPcR0thf/t+UHGfepW+
l4u1JZKSeHClKK74LBOPCXKxd3D8XQ+9ZdlzAr6mvJJobw/AAaFSVp5vn8QJ5Sl9KUx8v8Zr5fLw
81gQr5eS1chmnFJbPZsXVSxZgUtwyS4fSJwZLVN/VBE4CsPA3hH/Ay9Jo4yHmmIF8+3YYVB/NwFX
1vrdJAlW2omwmfRDNUzzASF0r/lLXpTETiy9Sp41aokiN2cpPQmKPL9NAP8zQucOaLN+2GdHkQtl
sPIOHtkVy+X1WP9Nm7+KKql2NI0XjJ/O6rBCcPNPKNUEBHbwCr8VbpYEg5KaZ+VLkJGEZRY0L6zx
h3uZuyYYzvdtIUvavx1IdyWzL9KsbEPWIshK01j7FY4dIYUvcrZx9Z9B7va+j5EM8OB04QCmQFBo
0rR22KpyVeB9lCEsHnfuCKJ2eonU6kkLcnVvWfLnle+35xu87c22lGQM/Bwe7qWW80TGOsk96eG1
DUQ3INvw2M3zx+q+su3uuFQjSAnryM0YK+LXXJf6UNI19FintYKNL6Btfxp9XPpoVIDIgvepauS7
EK++4mjc/mTbAVPRen3OjH6Av+XFAhuXTCpArmtSOpf3QMIQx3bSNbSU+llxh5RdAGi6Au32T7Rn
LCwe9nsAXZj95pFU9IRQD45gnRpeJlcXI0Sk7RQ1RdLnKmhkGUuPxcZQFgstjnR7OSSkoKBOKVDt
ECQppXpelK7ieplwgPBszo3FfHu032pH9lk/qliENlY+t5axqm1HYvOEQXL7qd9Z4ElwHvwy4UaE
SvgmUR3JeufPvH3BQC+zNYlYnpFM4Xg+J6qXXIuu38I9a9ZjEF33PJivS8FQEg2ciWWWVFKV5ojo
iOpJNCCFiZ6GIVsamGwL+76j8v/GeDwMcfL0blXPz+Ux0NsufitcS5kYODVjegnNDuWq3r9qOWTO
ZGJcB2SZchg3LjZH229QRYEdmdG/bKGHVWAJq+jA07q7ZeMz7Jn4N8ZMpimb1wKArc9p8jcF+7fT
rFrEUe77mCWMv2dd8klGbI43cwaNG2QyVhll+siG1eaLlUNEIQ2lALKvz1ReaEVMpIW7EP8N3qQO
fzEek+sPG9LJK6vtH+6OeDXKQvR69wh7VpbNwTaHr1axSYfX+BOGPwMI5fsmTCNRoUk+oLPr+24i
qDPtyomeWamdChhq0nvuVBlfRTOMczaD+dDk9a+dtkS8LedG6N3OLEWKgk3TgOcIgKD3IDOACOn1
JVLM6k7tNW+8tmT/J6YVt4TCEuLHRxk7eqvEqHoL/zAQVN4XdMBk3whWKPfTeZ2CNs4RWWUCbcgc
kRD1zN4t+X4erH/tMWt3jSjJywd6c8MkPJDmfD+VTy1IO38Zuw3AGgVvrCVpJ0qEmRQuf6fiaEjb
29lhmXMZUxcxLX0fmETxadZL7dq1avIwcrTCByjOK+i0ds+RUjLkUZS4Ghta+nS2ZnxsPu6Gt32H
mCG36pT0RmWItPbxlD4RDPuUuKJrpUiTICYC+4WeTREBCAtWgHSmE0nZoB4DcR+i2GwP1fe5yg4e
RWe0NDKhUGAZA9VNgmJMppAowFtONcUvNOxfQHWDCtyO1LMDAN8U/DT6iUVK5Me0HcYkhbziw8pd
EwpKGH2qsQrUldZ5l0KAzwkthctbJOjPEFbe/SXMr/c+t9ElooAbs1W3FoE13ZlJRrXxHH/0YY8F
9xdzgsr9UGE7tuv2Qe234eI3SLQ1l1LBJrBUShSxugllCpwGwLZnb1L817NRSfiIZ2MX49pS9HUF
x/q+itmoF2P8Xk2/vm2iu6KQrKiq47QNTkvHnzflJ/IBp7cbpXydtA7YCQEtC3NR95f1oBW2LpJl
NYdDyxfz6L5Zn65CXQ9Od/0d2ST080oWks0nYpmunaPYHy84v3jdNc/Ebk3cBUOtjWs5kGdS1H2a
scgvnDfotjygIjT1SYDfOf7x1fWFjSLF0A1aTJkwRSwgezEl9OWfbcRbg3xu+QZnibuD5DGyfC4i
9ywAkRYWgzhLdBwnvJX0cVUnbgY59M5RXwGJFrGezreKQyFRH61CZwrbBfQOJHkUAljXhNBYCIWe
bKOtPiDVu7E/962otc4GCFawbigS/c9h8Rj7SnhXRK9yGm9paPZx2CK/DxwRBuq/R8OlrWn4oG3S
tnilWWPYF+jlol227E8ziIG/NlPRRfEEhywLgeErkLPJFCCZ03uGNjY2FSeKstx9FDAlWwOjSBRX
5oCsuTxncGQ06j90sMFKdqCcZwhES7oL4cqtAybRVSdO/Jfk8vpRYu/M1UlOmSHaI8VesbR1Hk25
S8IxgdsyzxTobSzDAcsRgvNfpRZquaJ9uDyVTbw4aBMj0BqovzoJ67kK+klCCQAycS7UrfOj/eFS
gIdmxUpFCYOMZfzkPrND7DdqvdK+/tRNMQ+qxlnAeGT6h//CPzXKBR2xQFzKAYGdKdqlJ8TPXuYB
bHbE7qJ2+cm9Mupy+9RU0FghLpbOrW2DMSc7OJewgBYobIULFEzvLmqzzprX5owt4sNJzpuzke80
cpiW2XSlrYVEw9KU/AfW2Byfx3u2/pRJMt0iDnkWh5op3Q3PNS/wXpoDZLzoTZKpkoDzdFC8g4Et
A2/FUf8sK+//G5LXR1XHpvQZQT8k93boozoVWwQQxrwdGm3H77xt4BX3zGbVahcmvbBocGj0xLcv
eea3tJfdtVWg4PdQJDZvNTBvf0dg9M1eOe/zlHtoy0pWwVkEY+KoujXBSsPex9GgVrvfoT/5FjuN
IJNFa6qFDcr2HaTFJmDBBOHH7iV0tqIXljju8yIlsKaz7aWCejekWcB5tUnB7UvmpL/rFNV2uvLu
URluOVj7ArjDdNbTsFp/rV8NinDftbGhqXjcAPbRHVoLwsXhrhEkGpYvwg+0KAnXIYEFEZ2nIoPD
XRAo1u+8ddau3pYdAdVJVTjYv8DbTBVGA15FvNP9cxO9gexTSGp2wHvGI/IjN8huNlf9htzSQiS3
efk2w6hj3wmfg0JEKywJ0qRhLk7CNErOZu01qszWVQLKZ2MxNzW/diYLGDplQzmUPvpmUa9D6fl7
6WG5lYYlSsRh7J+CnZlnAhceygTnjJkn92S4kcQGeyypeKPQzFIPObD3GsmUdrQavNZu1QtfVe17
nd0DJKi9FqJI7sUlvVb6iL8xRiWw74jWvZbb52Z/AofA1tKG5UDWsYlY8obz/8n305kCUIENKZji
JrfkomQVNkwJnyUzvvTZJyHpjS5l34yxbViJFMcB863kOvBYTwEKQhMOHNvAEHz/CnjHRvv/fg9y
fe3wrhMoQAAAIZBBmmw8IUtEymAX/8mVEknzv/+VG6v4iiMmQv30Ns25/xW6Z7MQ5LHavsOMRyCE
yW/PJgUCqAz0eFFnMKY9Ok/zqqP5ZrJVCpBvSJquFWdRW2JxLzYWynSleAQEzH/54b9xvLWMuSdt
3YGJZ5J5ona3wO+pshdj8fxPW1JbN8+REaDIT/YVD9o+OqnV/9IA7lFbLB8YtKFMai8gvx8YICH1
j2QIMtKMEytp2l690U4xvZPKJWdtKf90CKs67KitZy8g1he/0RwAJa6zoX789Y8ZLW+dl4nF/0WD
zorqTdvTIFA8nZjAITSnG6E8PWdhWa0ib2HGCGA8nU7r4nzHAslnA4hSwyjx7K7b2+WqpPgWOE2E
QcRRSeTxI7SCLE12tLlZHyrjvqjtWc185iUuWQXOfgnw+8tEppx3C9pFTVCALj0Xtp8cAHJw3D/4
mLC9Ttx8A/DSl2mvMOe5YFNXZ5djeimWtruNTc8DfI2WiTochw9kyyFiKWiugFgEqU1ZnleSO9jE
efluSUFEh8jGvBjiKzE2PSax/5c0+ZurtNKGCqYDj2p8vIxEJdUeD68Hi2ucxtcltJWf/5j4/FBX
m0IlY27+YnAWGDC2VA6LIii+GJpfy6mqcwMa6EeKfK7OdKFEZUpOhaOs+0zKNOKCUqAXmi0aBPXV
43YogBDQdIeVmS+cayNTVdfoBBA4wwG6EVIqiTTBfK/EqhY/fpZHWFIuwJNaIVPAOJRB0E3jBt28
dywJ7ASruWIwYeC4/B4qoZU/bDO2C3ancWZXkpoPKJ7iRtgwn+Pg4EOjlEIXBpYUxpZHxuwo0hzu
RDK3eZ6tq2JLN1vvSfyNOFpa4hhDXdgE++PYMxQykA7kjUHeAjoL/s4Hmu1VDx67RPRaNEuj5Q3E
ChVqpYAmhd8VTN4SKVr0avHVJkdOzqANqtS/i0HFrktfD02z7vMltdaSQynZiFrxFRrRCZxk6ADb
8tf0beBP8WuLcWAWtKqWuLPcBrk5p510+e03dG476M10xaPT0a1a+JJcQdMQIvlFg3SxLscqpIAr
JUE6DHCMYM9yDsgY2JLUNcntob6ykorczAGFeZOYO2nOGOH57D2Lk2O8P7zklqehuJ62U4HG44kg
L7kUvcnQIM3g2yCGXV4JUKoVFIJey+xJtBQ1Qs73MHuwqrovSiVGX7EXxCG5dBYyPSa7uNQjLbhL
JXuIb67bYRfCNc96Bdeb8FZTN89ygm349ebuNZziNTdYfjh5qSqxqTHRIUBfloSkP6Trx1AMvDxD
wAJhqhM6LXbxCqvNS0+XAbmx/3Mr63RoLxc1HKtHEI35daNu/h3u5SDYCGomdorMYwyShvoYetxr
Weg3XRzTMduXD4ov8t+ImMcNF6Z9UthoviML+dXSRsCaf5FedTXJquLnvW7U29QZqvME2mKGxTC9
B6m8xuXZyo/RbgihtQQlzPX3FC4zBcFmjej2cuEcNsWRtqoUEba0L+3T4z03ZrlcVitkumBuQThK
jHOVQKDx17ZWwnDD3LjS2EcIQXhA8ddzkLIY2FUzfNRWZZqOMU86CLnXEjDzF1XtQ8u9Z1gLp0xK
b5/ArV/7dN/1fu23sJirMvkdj900xLlnBfFSNLmTj38b9Bha99YrzSmvUJmHRoriNueAhXlM7pup
T0SoyIfYaswGJXislYpLDw4fQ4vxpDvvnIWNOeRYt3nqofGVCy6dVSq7Oeg+VBQxyXrSbBcsl3ps
Tttl2DxBdLLWOzaOl9DT1BcPLxKXvL2rU2ypmsLV5xOoA6ZjiOquMy7znZXikc0HFVx1iW+/zDbw
0A419D9dTZtkveOtHY6dKgERITvvPf5nUJLSEqLuqJusnvLaoUMSNw7WhtA2oIXQvyzsaX3X6iLC
AaYIKp18fvILZSY3VXQyIeS3D0FS7hksjrhNPzZDMtnw+Ntj4wSkR6acRGy6EFEduInhDB4j77N0
FCqclyNw0P4faz8KeXCdMUVvLFwGSMhnQvG/rDDbuemfGPPJqIpOXrWYCe9B5dApHLgDkXnTDr2P
Ahk9o4eBCzajPeKfQ0/2+7y/h5SoZq2sH+bW7zsxbvYZI0qewrxLjCgRCIQ8IowsWLvlmcdSccY8
CdxNZtmcFX1W/4jDmA5LVw9bVkVD8FUD6Yy43oLMDHxEAlv5PzVTuK1oxz4EAprzie2LchmKEKT4
T0UTYalJ9KxIcD0I4K24w6hgjmXxvPYt+bOAtCzLLBkXo+d8WHR85dNAn7mOa4k+P6P3dLN9gujB
+ZoyzZppn0xujGE4nUPUrvbwsyXi7bf4iclT0ZVgBjvkkYyrCwRhI4yKzKNZ+t5LWFW2to6BPKsY
jei3fh+NJi+6u2hiMF6l1gK183Cm+8CJevqD/B9vDWxmoAJpx61pP01rDf428+6NDrSTG5RW0ri+
uy2igttd8Vnfde6zp7xf4J4W1zV6NyAZ3Oc1kcEstrsK2RJ8ZllzZ/JTFAtz4ip3twEHYNc0Tgbm
YpBD6e5xvli28/aXqvrtQ1XNkw+dIELI2q9Y7jnv7o6iTVDts1rnQ2O3PM3WLevtcLslxE1DqqHw
DqDGicCY6jsyL95Ut0IryMZzdqQjlVzFukCIEG5R7AZSz+x2cYHd61y+yDPQZZZA916JLk7l8z8J
HW1T7Ai6C7rlxC+wQpcwwi6UMyValU1g6pwAJgqieK5SFsxD0dAaxTQzQ12egJz88Iqr836yt0Nd
JUE6lLn/+Fxax/NmV+qnqpsaxXJNPaMvdWeG5fVaV5MmP1VFm9k/hLI1mSqoAjmvBGnb3gSiiqOZ
KqiP7Z1xlO9fOTla05hnqnjN3YaM6UMX/ibNxIi0Ay1pLZqLgr2F0Awcqloxr3yKrjt+lQlgtc3L
Som5yP3Iv4sRBbEd3wcGi9dZl3dzdnYkAZ6CJGPfE58rJ+kM43KIrY3guQ9P/c/I71XL0psfTTEG
emJ8qFnlbmTTtaraxi67i4uHVH7QfL0IG1/19tWWzo9HiC8OUt7JFNSO0av6EMUIY7SSA9afu1X8
9n/Qm0wisYwbA5iJ0nF5JLVsgHs1qC0qHeDdgqy61E7qCNNyLx/iMXcuBsl9xzXQC3EN5IkdLeBR
QJTN/uoV0sC9inQEm49NN0L6ZinSXfukjSmhl0CXpEHWVD2z6IZtA9D1dS+DPFG69oDougOXNsyw
lnSq27oIqgQzca6ne1rg6zxtbxzU8yXZYGEm2NaxA2rjWNIW19YTHSS6aiiIeAEklPeqsrtE72jN
yJE0eZCKFhKKcyr4Rfgc/ThYrSIT8sZrXTI4DkZL2fXmfNSqZJ45qIuKOdakefBOweYrsFWvdJq/
7isJuzZzd27SNnPry8y2A/kh8ZL2z3QLNLKjSoiNxHFo6t2JTnMp5mNRbBX79SIZKbkZkQjiZhPX
0zm2YLQ2YJw6gpI1SRmy1mYMUElk5DC0lULg5ydvfY36UfDxj67FkF7r2IDlhUvtEaeJbNoWCoMD
c7GIf5TappsIJ5sresPXQ14WyYaaDWj78OJF3PlaGXLRIk/vBtHAnMdgsdG5BPnStcMvb/Be/Xvf
YMFNPP9rIUSpBG/JC2N/V1ZyzUmhK7zx1zDbK5teNz8AfXD9j11WSA1tTEyU+tKDA01HcRt6UKmg
6+DPel8nt/6BCZ0PB9OGSEX5olC8f6crvc7obZ0aAUueN/ty2wLEMeITExeqyiXyf5Ei1/BJm4SA
VE5OZoCi8zw3ZYp8JbRkx06josWkJtvbP2knCQ5aMRAPx4INUqQ0A4B9VJ42vzSyMgDQIRxMRlPT
X44zRfHcuwNMQ7gXDqAB8NGhaVTA53YqRR9DSkvtO9uB8/qQx8G75SWOYCk50l3GEtVLFBCaKYKm
RUOO33TBxvE1bPNJ70RIucpfFO2ybaROajN94rwd+pojvdV6q4SirzELFYc0AnRcpM9ckW7xeBfD
IpXg7FI3Su4wnp7wf692y4n8bhvVgzVsWh4DUsypCu2dPexlY6aM3BsIaa7KxvRgqWkBrbHGX9jK
R4u/FO/yiGuAeiFoehcvQmQTEYT6BLYh+2M/9E6ztDSVnYez7PlJGpyGgbcbI4phR2pMbyEPdpzw
pDj6sfIFNDIgRIQsMufpneGRSmq3gMZiCg7xmBqmIfRz8ORQodH71WKO+Q2kf3LfIxJBp/dRKIO2
jVSBCIyocbgWQkc/v2jxhFm4NZ62g7BRFZRiIib8NTIwMG6bNlhja9FEfFMESvoF2dEVxUN8xj/F
oibelGLrmNy0HWOEMTCZwR6niH1D+fosX78VrR0SwJvuonp3tWNmgyQPavqfI+4yha46eI1GH6bs
UZK27pmSOiNdYsatrVJr5HiHDiLN8xE545QN00pFCa2nbMhgcL/8+K/mTvqN5ssvx3ZFZBPqK7qX
bryNM+ZlN6OAN+ljMPdFrMiEWQh+IkWx/vBG8S17+L7xuzU/L96gLRuFw9TYrv68CUxwcyMpyE1N
Io2bsX/HOb4qiGjWJramxFn3H1IovULcQABQ4LlJ7VnJ2pSf/vOgKpoC5Cao0LEgucSEX0Bv8MyT
55uOaYqpc3pVIPZKA6RQJnMVDTeK/dFohyft5hyZSY90bohDxJIfq8U8yWd2sBdxb+4O57BXk0v6
ZmuRXLERRBPsWcHvRonx+lQPRC3/t082iq9qnssY0UpoeHwqYOSQv6UaxXSTizxp8BDL18/et6Oj
gi+l8nLUK4j0jzkA0mrUEUJUvROfWSoKgJnMLF2o/LRZ3rGEQEA8URQASTagfKUFB2IohMIiTo2B
6ysTVUSDIV6FKiAzMUpF1+3Mge5ib9MrXEqop67So5so+jz24zDXepA2+8DfV20c2axKTDeDaxlI
bLDXXIMQWN5nadNnhoqNq2cPVG6LCFRQO1kpdlfUyT/qehqKQCtnCZbbr6zHKOOMHMQ7YRV6qGF1
ByWFZjPDrYgPqp/MoqggVipHMk19Kj0WI8KMxcDW2uImetPXCjRIQYy1adKVKqxQyqSFZKvgcBpi
p48UCNKahy7iULbgunEg4DzGCfJg+W3aqvFPuqSOzzcHpaaW8j5vqV9pAkz/rdodKxI6baTc953n
6DA7XTdX5yJKCMMZZqKYoSmu8FEVrBjj5qHNXsNwzGChaGCBa3c1QTBusuTOm3SBEufmRTgVy9fH
B4R+ZcWcwnPbQyFzBo5TtGT4UqEdaxtY+O1F8Y66arY4dSHPNoEd/Pb4+iAJSeYg00bZ4y3gvF0B
igx3b2tX3PXVkfLmSDhuO4x83VX92ITxGnfZs/mkhQCgsAclW27lyBZTsNgDTPzUqbMUvuUAJb4m
CjbqYKhCEuEoR824XKUxZWDdlcHC5cnO3aJFmaQ6L2xAOM57F6xjG/dKz+j6BUDzHqf5ToxWH6z1
flLDQdyiX3J2t2N4FgCZ02eSiBpnMqhLsvvpOcg2GGe80ZVNRRmPT0BqIjc6zuA4+jqG9PkKxVO4
3MqiUGsa21I+x0VxJ6po0Ccr2yndgbI1HPrjhjlCy5FVXqvbfqRdKx/wfa7F+o/2jJMKeVq2FbOE
e3jsdMvec1+iSsiZwBqwyxyeRPphLXboAKYUJOLEqVRdR1ubtiwBuukxT7Z3setEepQzYNKoWELT
3JLb2jQznFwKlP9kEKyjf6J1WBaxB1ZMlQ+2OCChPP5dolge3NZP0G/MgE+AKJHu8ab13IGCPSDa
ijBRDP+Bp04/jeTdUAFLAsmHt+CfrVQmNEsgtrTFHq4BlcihXxTMka2ZbGYXFECvbtGVODnJjCHO
cFGsduUiwM4e1FV15FkwJE9P3Lv7g26WnSLAa7aqcrCWokY3aBMJauuELlJ2NdijcJ/eXZFpCg2p
0w4HGTjQDjA7uPHTt/pEj2TEXeg6g+sd/7KBpWpncnAHyvCIS+i0uKpGOsz1yTjEH0RBUq31TXtR
Sod+IqdowtGXnRtjcEC9rG6Emy8fjbLT38XHBfTKomiDxAYqN2X01/huWsbL4Q4ptqbH2zmcb2Mn
lvLwZrNKFFN/Lt1elGiuq+36sS4CF1nZju+IN/EYa+a+/GJG/L8i+Q/o4xYiLRGC2+3wURQSSjt9
ozvEF3uDML77nNCs0xWR5zUy+z7/rcuMT4ivWgXlLktdUz4WcviDkxobFwlcDLMy33b9dVy4M8Kq
kgv7Q9st9dUk4SiNybnhVAvNlgw0p6IQikYld35eBcn45SKlLDjPBin7HqiGKnfaR9s5W246CQno
G+jiIPXkFk71lkAAIwU1XWKh9jLHCW17i61/1sU9/Kyv776w0pp9MqPzk0V9RP+A3MICvyEWb6qc
44cz2B1dKeCpxxXN7n4P4MLfSSR4FHOAKgRd+5RruqWbsS/gUEiy5yxvPAD11de4fOIt0dqCUEeV
AXn3F8K46C1Kt1xuIm7Qm6uXTppIzeUmQ3D3+1yLLYlWFirJbQSqaV4JHhVXbNkAEGkwT/EsAqHk
YCDkWylm5oKI/pctO0ow2V0iETNFynEw2wp4eNpQy4CijAiCZLTLGckph0D7nMl9lZagupUxp7SV
OweF6FIZSM52Cbpib8Ga5h7SYU1nWZkok9OdWkqm0CJsXaUulV1XU9SpCsr56jX45k3qGlHEFpdy
a+mZnwHD15R+fPxTliWO0zD0/710hzUb2ojl9rrxN2iMyxS03BJtT2ejkCoaXvgNC5Hxx/rep/P0
Fg/D/z+sC0U+L7bqLEayCn29qt4V4XRiRuymKxalokLqAjn5PhjKfzV4GPzmyq2KR5FYuK1mU0W+
1K34s6lNr8N2QGQRXAA7PXPWSoPeYX7HoIJiyrQIQQ/w/KjdWbSZS0XAx8/unrwkgozev1f/TALz
k59TMjviXtUJ69WhEH88GBRL5OMFUcvfIfLYZt/mI9gOBb2ItOfVeRFTu2o2J8h/fpQlLi0aYuhU
NPnmAm+NkHgRoHVrvxWGD8JbAMan9BWOyKWigKaNjCKwgq3WkJ2KQjVSg/j/ZhlSgq1CmrjpmS/i
ilhNIZYCGwapfdzTRoy5AwSkc8dN6msIvsTJBnfMnO6K2JZu4sN08/WG1Ich0z6qsW4k04NkXFYq
eLVEwL+ECjdGX/e3tJKPXJV95FB371AWq0tSMPvxhMw88exI2OUhn837peoTfPorARwxC+x5r84y
P2rUtGpPbaaxFlr8gT+U8aBojzqNqjX6bHjS4we1+R6HRgfBGWv1seIsEQ5y3dqgVBqkpMKMThaI
D4D6Q9pqVqeEb6Cwf8B+bhg3LVufjtOUCcjxR9TtAelhbw5EYSPApv+Y4LBanjjvEDpjMlcqG8BE
G0UEgGyLWZFh320qMr9wCm+Jj7ItlRDdEK/66ogOk3YhEbZ6Rv75WQiYf5OPFms3bts1Ksnmh3ZM
ZrX+Wq9TyLldTpoBtP6U+2Cu51HhZD4fCUq1S4VGzLHHomoUcHnHtPiq+t+zd/eIneIUQausU1z/
gG+WDxOoST+PpQzmckWEAWldhf7/2AFWcIz+ihIKJhMnsO/8AdvLv2vchfGD1K03fq9XXZGr0Ozb
kTSJzriSdJYSVTdghOUh6L8vER3XmQumXszf/rguAgkLePb3dElNSkZf0aQNUk3j0cAxevaLj2w8
uQkRaVEX/J4x5mbnYgHRfSTIe19zvvMZ8ZS/AGmEwxlUbprirySSVbbTTOg7E4PdfZC+dggiInlC
nMstD5wJ2aRrBnsY7KevWtNB3EHmcgrS6b/Ge3C21C7TgdetYcgfFaLGvd7tB+mMUCMmFxD/b287
HUO6GscIMK2wudlisN1UpAIc0ItNdG92YqI7Q3QP9YsHf5IbHENFGWFQ6At6t+yR0cRyw0Ye96SG
4Rsqe08fTkA/wme7waSbJe9kEB3Blem/J8DkSh3TGVIsygsc5rOqF7ZlEAC9H1uoD3gWatjWfzF6
IC4xK9cvji7eUSyQvbe/+Mqz/ofL/Rbrsx2XO1NitblnrYg7qFU/JZpwd2qjprJWzmtCZOgoqd2n
xu+ftvKUvi2liGRs7bBDD9BfoW5kQ1RVqgGg9vhqrA6snCu/uHL0sEOUfQ4uqrwtQyThgrq6UB7h
4QabPxEiUg/VA5YWBwxWsxvVsg1ppmOMv4+I07NQsAitwX3EmbffPsQCiKw8YVGSanaEnovzizlc
0A15SQDvcq4CCrfYViaweT8ZeurWm6F5PPHEmU1wPYSq44gzBv6vZh8ouM+PcOveOHCmna+g3a+j
HysDtolt4M0/8stZdIPdOqPHetuEyDVlRcScZ2rxRuRUjyH1xXdrm3Dh2QprkCXwQeJPaZkvPbzx
OnFDKvqJnG8Zvi1DJb2dPIAuEsg+clsCN1KO2zXB2aRrTfL9P1byLHoGQw+OLx4Fpq5sF+I17P6D
5BP75OWVc6CNu6ZqY015HWnWX1MEBQeGCQtg7fe0jyGpSV5/jksOvWwwclN11ymeJlbec+f15Xib
AE91VVbv2PE3k0/HTGcZ4d+Wop5QC4cPXVfKCa4TdimfXOxJe4FW2BfFTbxo/jRK2C4nCRE+PWdS
OOdXlrizRTqhlzPLsE5EJeepZgQ7XD+kBGvsyl3erzfpwSWggix1Wv3UJnKTYPO09a7QZhecxGlD
WzCBG3+CytRoNB+JBdTP7O+n6QsQ+qQrxVBiic/fKdAMV18zr+tUMO4cUvTYrPMIxBkyv6i8ltIN
AK+YuBsl3FelbkZwYs74qD6ANOmZ7rxqwRnZtVw5Zn+kMsJW1v18iabSXQAVvNjfdvnLT06+Seq8
9PdMRSPsO+tNEeAcT0krvacIlQx5I2uq7ZcTPIe5p51eE7GP48ZBawWJ9CxNEQHwxn3QHV3CC6Yq
pG7hz+jOCX+52ceOqqz4MpUNgtW9boYJQBZRYhBSUSRmn+aS5Xbc9GwhpEvN6K//bkhyyHNGzDqg
pOHrAk260BaOBG8GpgwmK6rRYlMogE8h9u1Zmzgn6vrrmHKfmYYi07OuuhRrGOwPG1CTOdzmEF0c
q/qgGLop/dNbDLzV6q73MuC6bJHMdUKp5JoicS+rUU+kSv9VGjhWl9fkewCOamDb8P1WHHUt00/4
dILRKID/OJPDWbH3hFprq2yTj2mxl2mAkIp3vvbOiQdqp5gBpFl0+OLp6vUGKpvfall79zUo9Mtc
AnV22kY5e0G5c8YNe3eRdttAeJw7hsfuUBjhosZ36tteM02pdJVUI8U0S+v21+DFzZPdKM1vzoiD
MME1CGjZZdnqoj52+A/AeBKh3YHEEZITVPYcx2HxtfLgksPUGQaT5CFOLo2FLf61xbExQAW/rtSv
OxMJxtWc8Tc2FLhMYS7JpdoDkZPpxfTf5fzY28FnX2V/SsISRgFKyZgtIEkv9yLV4UaIsNn3HLQL
VtiR82V32fX+EsApqbtXpDLM7UgHrMwEXLJPfXmmgxwfBkhywYtDtnwtkA7wwxe++iN14QQtkXF2
HQwFbDqLh6FaVhPTUgIUZwAbZLsaLZyevBGzb3Akq6KsKRxdZXOGv6E/UU0T6mwz67FYiYuUc3QY
3z2X1+NUCs/98wF/TfcyNlU46Hz0yCfkhqbYhhPRum4dzLafX/H88ERSkJSo9yTuEOCk03oqctCv
8qhH/8VC498xddVFne7rS+Z/Ib0i/QtJiEmKQUbbQTzSAt3hJyXJxW46oIAPscCcsKd8ciXM0BbM
ieTG1pNSae3p+Z2LGLCjNPyfFNEQHmwjbTccIzalkzLsib4KpyGUUOXzAgHbBw6s9HR0kVTVi7LP
J4bFQXtwQzSVUWE5g4z8QGhpTQd00BUo1k6tEN5LomJCl/cVP4V0FReNqzFQ+ATQ3BfLm2ldXxh5
xIf5DOkQ+lN7VT/CTq0WAkQaV3umspffp1qgKeOTnNNBEKHdwVhorEmp9XHuNNLAe+w/PNVMhEqo
2ym8RGQxLMlO8IUJDIm2BRbz6OktxhYgNbfkddg/yKp4tOXxEf/DsgC4Cu9OdSwmSf+jdLphFlWm
6dAj195A7GRe97GGVPLLZ/L9bPu3XfRZDS4esJU4KgWDFK3eMlntSRkQIl2GoyImqHpDK4MVs0t9
0LWs1ESdTHj2q1MWtSak1QL9ejna3Ha3EwHvxf5Wbz4SaAqoqKVzXtYuS2LOQuMyVrEX71s4AOwc
cxOC/oJ3LQu3E42bbR/+V/7bJrwyzx2HM+fCj7M7g2YCCd0FQ7TZ4Jy4QrT2QGaaJ1YOCEAFGJYX
9HEZceqH3RlJi7jWoIjZNwENd9sd462Apxp4q0qexYBWp1f4B+IOftEehIL9O4xQT6qQFzgVIAV4
tdE7I/dWl9VH1RzPgeyYPkuU1MOtuovtNwUmymtiVvkkUvawJwHFwDg12tBR772M9mHEG1jQ7iiM
YcpgCbohqF4bjnaA3xEz1jamRnB39Wand4c0vhgg9Zle1Y/0XqXYUGaHk34pzCd3yYVYLdtSR7TU
+Cl9GYzOWt20ggMGkeObyj4Tp92ocDYZlAs9WeZHtGZuFkWB4/oruDjV6cMAGAbZcLnBzbIf7cL6
Gi+qUkPjJH2kzvOHUGl3I8z5JvvnEVlsXb9Gpz+i+o3FWpEGfmf/2Y+JBOI1SJM1GlpPPGGq6C7u
KtqZGzVv4RdQ3TynZ8LpuEyQuQq/RNJfaBL86wMHOiaBVWAKsi01MgSx107v0wwocUoNbVn2eFVg
GG2JPexgn45TNrX/NTBpBZ7h+fWKm7pfVTD6yG2OlQDJNrQtZSV5n7Q2Dj4Jn8iZkKmDK7cVT9Qk
OqT2T9VRp/Yx7fwXO7ZVGIEa8c8zORA+nF+iHMAnqVdXfCe4tQcS4pJD2wBh4OBXzhVZAffd3YCE
Htd5fpGRE+kKP81ble+TTC41XvEDZFy+FumPXG+x3CX6K2Z4bFqM1KY6Ir7Qt0VDbsAP2ERpxB+6
8auEP/U0GykOc0YdfR+Z3d8bNTARaxr8+7GkWY3uhseEuN7GX3GeHzGO8AKv3GLoiMu/CwSGj/CH
o9fDsVA6AnskX4i5+QErjxsqt8J3IkN1taBTtYhde4UcThVdX1660FwXVsBUn/eKoVS80gTyNTth
NdzmfbxfZXXx0BnyMFRURw4WnIuQwAHFtL9sy0giAc2B81dER9dn0wS7L7dFXUtWEjHjwEcWm03U
9Iykp0lO89bYRG5x9ZlXk33Di3BIpKpvVRPQOWn0yAVVZPialta6pBouP6mYTBxugtDtaF+wcPvt
uoNyz7OjueIIWWqvHKxLyCsGXUVJPAXr4uT75P/LLf4BgqYyDak+7vgA20iY1VZItCl24Zt3zSNI
SXRsFX2zsSHtOED4jMGDIyCEIH8yXE2J4bbqxrG5kRO8WQXh1A05tm19Dpf4+ICYZopnmRvvYU27
a7C2b1vUFujGq77npoHX6yHV/m64bfz9+S/1DR9ddDCEsLhK9SsCckkAXEX0e4XFfnaFI0TlJqjw
+wvrgVb/eD1AUxr46HCO1yIytw0BD4YAYDAd00dV0zrDFvh2WofYga/uqr21MNgpUSS2kJAAABef
QZ6KZJRU8V/7aWRBx////QVZtg5dSnLhAjdi7vj+vsZtkYNmc3pHpatjrqIn/5NQXwkS/DhvZX0I
4+pBYq3/MoxAm1U+fVtJN77xwtKilmmE3tg31zyC2ozHb2xb369imq2EbQnizPWvmGk39iTuvC0M
KanL72UCYC9hEh8oNRHc3b7IssiOgu2AMHXQI+kCnhfyDuWbnK1cujgntSFO83UqBcd224kkUcVj
Kux0br0S4YFZEvG+AgeSl82IR3brTuKCi7fc03kIlfLyN4wIvXD4Ct+NjOwZae2bYiExhoJXksvE
2jIpZL2+qnYCnH9W1+Gf2k+rJs0VtXwvAgkczc1hBQBFdu3Xx1+WdaMqJdAzbaq2pUAfUuXSKZBN
GNVv2ef3+CAmpVbcMhWe70Z7nlPlaiqyo1F3YW9P5Hio+F+T3w+Z6fXp2X2YRg5ZeNJwbU7z3mID
Ykm3LW8RaApb4g5EQBPE2lykZFINZ0DCpKhonhp/9mIRt4cwvYcjL3Yq8UK+rtzxLBXU5KUYXhE5
SaTp021jp1TCvNq8GFmZOTvlF8tKekIPkt+IyKfNC85jeU4WNEFqMRpeGUQuDxrLary8WT+VjEro
J1RP6VGG6s9BL5SnEdbTuD8Sn+twnSEOTV8Rp3lZtCllOcflCmOyVDuYhCWWyIxNNGfZfNTaopfE
Jmk9CSWMunPrBInJl1N8ldl7oamFqB2+6rxENZKCBLWfug4vWUlmWIhzQn7m5DWGssG49ed5BvvT
O0wlldO/p5bRLSDRtrc1/o906iH1bc33PmDET8ENEgwG3bc9O4cge4T1nnM6bA69gNQr4oQHGI4h
Vg+Q0LDtJ/ia3SPtmF9wVm+l2jBL4Y4/6Wx1J8/Aebvep160ffjYiGHdtfpiWDMTgT/fFwjSmwmi
OR4pR8VJMJaZZATdFu/jzkcy+nj/llJuUo1T1Wc+voAwB9v1TbInxUTxSy9NITGsluwWxEIrfvPt
vnOOalb24zTaySaiiFngKV7KVT/Ozm13gY81ONLkAKyK4SZWkQ8BqbwgrQnOemwU5HdzH6JYk9Et
6ofMV5kbrD//EH0QPkzKql+fkUpXJpTSq87Snhf/vlYvrV8q0vLQeshdwGp8BObtVBARrqvbE39x
lmw/7fm9j/IAZG6ONr2KcgW1+sQhFFvDX3jcYi0vUKTICNJk6hN3o6GzVzOeWTzdJZwpHYlVmEMG
/6u0irBS77VRwa/4KJcULPO+yl6HcipQ/gspwWY/OpZp3FFYhzBgMzrPtk+ZwUaAt7nmQPpJpED4
VK9XQNMVRHNxWACNTE6DShD4BRjWLoGsRCxdyDCdf0uaIY/3KZvebUYRt5BDIMfRv2YAMm0TnlUC
u8CHPzwWgZxSgClM59pYMogFNfo8S5pP7FDBHMn+pDvYmqsViUyfPLPvf5ObXjCcHkDb37JgxNy5
s2Gw2nUapxx7cVtm+/Ikk1sJ6iKZCHUksEPYDiKL/Pj90cGXg6zze1fMuSb1J3pPJt4giDL7iur9
SGfENJfRMN+BYeREXGdfNfVKD9Ma+qdh8igHvUa3CSLGrBNuZUZwUhoMzavJtkmPwQ6hab1fCYxo
FpM5DA1h5dP4YArvXKEHiAFqSludtSS3VGBzOnhcTNDtZ3hTlK9H+NgzthP5mguf9EluznEfqu7o
mEev2tjf79lEPNS9lG+9SbadzR8wMf0wLSWk4AKQfyRd8ECKsUFXthtdA4VdYsi9l1orzX0Kl2wJ
ZYYAuuvpA8QcfOPEU1N8J4I5Kh//WqXogWy/Ugu29Hj80vpSjDxS+zeSVGnDuaJIYWQhbuXVTklG
SLsSbd/GxoRykr/6nzfc6gNANqhszc8JSSUPqsfYW3PPj8mFCesL2jea9b3uVKBV9ixd82g7LM1R
SsbGJZ59dXcagvXsEzbUw3pZ+J3PtSLCrlT7mNolQZUO760DLHQwf9cuzu8auVnQN63XtK23dhFy
s1bqOyHibKHDQd5BtFpamZ/nBjGWS7sMGvR5GOVnCgwlE6eWXs+XZ7WL9DxBIFOW/TIG1IajJ+tm
46lhYbXBUlGiU7vWfK+7wSLCf2ZTDg4JswMX0+7OVCShG/RisZZJoTve5arhK5dugkswl0i0xPr0
l91cLKjvMAMzmwqNOdTrwyRK337YAEqo8VvodxQP9cpN7tv/ixnhfsRyEgUuGqiC6MlKR/6N4ouO
JSE0gbCM6tPRULIJSklsXFPEdsN5DaLLfAEZudCm5quzhKjc3+W4ETyAlpHpMsbQuTO3lz4+yuv4
qjIOTyjm0LFUF3R0XZ0tbqcT8sqo5UVBJEXZx6Verk+hjiIvSOIUEf/aohPu0JjKrD64/EDRlXrD
pdyT0I0TxCbqXd4S1kSTCR4gFNXoAj3RQhlhGPwvTLoENgrAiBWcd2ypd2SniNAxXUm3opueG5La
fbWy+uXe2Z7eFtE1ZvD+pd3NrjMKzVgV3kwT0nlOBFiBjIRwIdlCmXb257lWWULeYwUlvp8rMwCX
WjgH8Z9VRDxH+NridpB7wMx4CFBTw0MHikqo75/oVcL+e3Lgz1zxY6EduYDO/mtfvyCiLe2QCUWN
Q0ivk3bemcnPum7Jx0IyRrsedSe3RjmdRi3NkYKq22vdcy1NY2B41QMsBoWzrV7J4cf3Ikr0dd3b
PdnsVOptDOqQ4V5uQawWOtmsatCNQ7EWxyk2hHWA42sF/gddi8ryS5rznR5wdFO4XLZYoPNfCHYP
o0sNLeRpzhctyi8yokAV3fGwfuzO3yMVvqJt1t2C9QbFAa/PzO41xNzOdFgMwN4N7KMU2da++a3t
Vp7hN119zhVMpjdnG56uxWiS/jj+c9BYr5cpMOaeS/nMRhkZ3h4ooZ6uAwy1Di2FeTSGOfZzkbp8
P4UG4C6yoX0io0lnYqdzInsCBWORjnChauME94+KY0NzGvryEuf2OF8GzKG3ugS2YgfbYhAiBsc1
HVz0jm6puQVM1mdoyPc2wivTfjKgv/xuo+of3drpb/WcgCUWTKXNsukTnJshUjwD1UUSAf1CtBEj
8ldOJHTmzaP6N9H50ZGBMzankkgRIrJSjPAlBohvIu9O6dCamT6iy9lr3sgz7SwpKlO4biSvSrDr
o/Bvic5AG0kijq0YnP3PBEQhGGRpohCdNBQu3XEbffRZkp2LoBDPziLd5rPPtJ/GcPtNO0R9U6Fi
JTcWVaE3v34ragmWFTHdhyckwDjabmYgG/RlpFDxbyW4u3ag7LpQ6sK6QukHtuGTxY8K/gX2ZF7d
eYb/qtA150knjLDXnN1EzkM5igpN3D7t6mGwcN418KJvGqTni6e1uAJbMTq3XA4LrKi6FyejnPYP
5HCp8LVvgjM1CCP7GqQK1nSQkCnX7oVEWefo5EJTZ94ELj2Wd5JXTV7IzfnLOlCwQWsSig397RJG
+vij9oxMGBefyFZ7qOhaVWDEV+GZLUOvilfzdzHVpkgH42BiMDhYZq+2xF+JNnl0alM+kfWgvrbd
mITxBsLQKk0zkeDNmhkPCWxZB8hYxBC8B8hbQ87TPemSaNvMJmFPXz2O/mhGG0yuKZ+Kxs/05o+f
+WHz14psSBjOmuiE8z2MiRPxd6cL0YNH7qb+9f27WdXhqFnNx0limhcCeBr5QXqcMxuHTNnArnPx
RXuDLqTl3e7TNPko8Ezp2P+JEeC15jBRffKw+i51f3Y0hbrLXzVegZXPW5H53cjio2aB/ZWpbiig
ZzixcHFIwqndoQ+fJCDvgyv9olpTEzp3vbGs6V9HlFe4ivHMkcfPyYLTpj+Snb88SE9vmuFE8wVn
kU35rEsq0Y+BLBpIg8oRTrU65L9kjKMReD4FvMaSFw4Gq2h49zDQ54L4A4/dnssSKZ5OJdSB+pDf
6EI5i1t0wCqTyGcKs1+nGxqjTeSLPlY69wj6WIujjw5heu/YsEed5n2IGWCI3oBJjbNgzc+vDzIu
HXYPtpVxEXFtwNLfHH0Djnxt6IUm4BMQ6VF14QzJR7YNCA+CuIaJxZMJytscx7eweMIEZ6cfa1jR
0f7vAoF9gTf3Ng8yP8SMWFKxU1rGivYShIaLy8Y/Tf8L1tUz6+lxTFClQ2Zafo9IHy+SjaKcEyET
D+tJv7xp1YJ1RHmB11jcl5oGNo9LYVoSO4b7gcFSSRgKnT1WrvWtZhnRzoQd7uCPEgqRNr0E/tzi
TAR+7+CJNc1B5qzi2Osh5O+B0wGhDz5KEj5GDPs+aOCXPHvLuLpMXmaayDlopL9f7CgHlMuch6LT
oeHNp4Y0Wq8HZ9HDDCUre9W9VhxuIrFQt74T+y3JN033g20cbUFTuvdhnJWwOKAs/yOWH6xmMp5T
wmCPLuQ1JOxNQ2v5xKE0KIJ8KrvqchoFyU+q5aQIs2rVOwUC7gvupFCO+LCDzRtLVrlGnyR/mAR6
LZ4ewOLFfgJJQLmaZ2J9VkmS2+h7kpf8eqOkx0ESrmc/r1Zm3MIvlTh8WZH3ds0zolnnut8D4QXL
UTGyVsW/DTI3eX47pHmBw23HPQSQtcMHG0EMnwRlGQ9SR0rPym89eZCvs+YUqUy4Is71RXQt2IqT
AdVIuGOrCJV8KQnUlye4yJjQdA+VbWwB2EbhdgVrn78L8d1Lsn2E9DhzTfmD/FqkHy2aZSCcQ6hK
LfMuxjETwXntGlaoPwEa6VerFb1VY1U0R/JDrwQ6fNXHnePLxbXqVyA8XejLZTS9b4+FuOYrGEMb
xvyl7Yu1k461VEmc8kx0MDHz7W1j0OxN5AKsJw+6JP0c+CmUPu+aO6N/ZT6LxHf2s+bqA+hoPUC4
FECaq3trY6iicqoXyl5Uh5M2wIle7Qh/QyiFc/Wv/Mnq84jCCss9TEnXB3Ta0rKaovIPQOsO0Dqx
m6jqNrwLoGhIjEgyUZBtaoqfE72n7dmLW1Ffv5YzRFJ2K+z0WdnmqkU3c+RscWsXxkTzbHf2pzFe
paPYezLK0Pk47yv2hRVXFRbD2rKSjk7MAukwRKhpp+AZelLreEFnP1I6n1k3YDKOuHxJUQTe8S1Y
xl+n5OulJfYPUpoQTjYh65CYxUoVMs/qtzO7TAVNpdLSIMUzOOFZySSFPzx4PjLMnYyKPTmmG1GF
ygGdPCw7juEYsTYTPdRXeSHSsUq2mkWTQGvMteJnNiQtPiFmwIZMVwoHTbqPhqL9FZv9oFjK+L3j
HJWU1tNqEsi7597BBMLaMBCM3o5GlGCkqZ3pF15rdCiqnvOabVQ4dqzn+6RFacJekscP4/DFM+bB
7CkDZtGC2HqrObiH4CKi4IukAFXB47LwK2Dg2FpJ5MfDVWiTDIg2nbTI4f6vb7XByt8ZmZUUzvBH
F++cDXiQ1rjxC+7iPyc07UtyUAICMjfi/sUzZmO8ZgmZn2IWSuvZVu0eD8lbkSbuY+DxPJkUu3OB
EvsZoT9b1RZwayIK97hO91rmNNfwciQwBVfHC8+3sLYJVW48l/8T3z4r+W1fBsB1SrnOOaVJD5iT
D3sr15P7RY3oK7596WDqqq0/FCUV7b8t84m45ITm/p4jN9jDt7eiAt0awotFJiVN8kxnu8dlZXu5
bp/GWpkoZLJ5jKYd16giJECv6NUVZlL30sir8hY8JvW+9Bg22vN//eZ6lwHHZvdGN57/pUO5KvGS
G7cc/tl7Ebmir8lmg60437+0nVPO4vb3hiSgZMSdY2B0f0y9Qt6wXwaIhZfdAanhcmMWb2RTIkUx
Zjr03FmMjD0NZ7HvRYdoszR17g/bFUvLqFkD0DfZc8mkt01vJSOTzqFtzD7pmQFDtv2wprp+6/RQ
QdqxKlf0PoUmgMJrCrDqsRMnuRCKZSOwJf0bMW2o1oiNgFQgbkKB0XQ3xYql482/4jjaNXBGGgr1
fru+sb0oOCUZTLb7KnWb2raOAfI4goV5FpZBbFAptFHOZac9C3i7oRMZhqjCKs/Gfur++JJVvcAJ
A2xLzA7kG34yqOLMS9g0UEeXW/rbfjNzFvuNBdTW2gB85BEKC+QTuIP2wLfHnApyMKt76pMdfvWo
T22mKjmvpexD29k7lfaZZd0yAJNTe8vW+4B5I7e+wsRl2UXcs99i6rOpT+INn4bjVgm3+0v9YVWw
OV92w+7wHOb5oRaZHJ3cM2MjipqtS1wB1+e9zId1w/es0ITqyYycaYaHdxCTzW/Y/vZ54yHjYM1j
PIrYR9lqfly9AK5j5Zn8QkbDLTT/6Dx7YIpKf99TeAXsb7lMi1gacEbLqSqzyMn8H2mca4QTmvo4
ovT05KJa3Af2QSS6vO93duMRFaIPdDhUmHHIImb8aZfqMIa6jPfr6MlbGA25cnKw+2qtlw3c3pte
dmLetgUS/rxuPQbBXaY038QOGmsGjS2HttBshIGpsDEE8P37ygBnpqMSXC6Wa9hg9EYng9czbOTg
/4ENOw3yFMFgH1vkdRZCITOxieMGCMZ9WxSQSXBLdigJh8yUAA24KpxouWvVC4I+IS9OwGtoSaqO
N3swr920kquhgqri9l29irZZb41LZwHb4YsTTZWXyvUiobgQQ48Lpt55p9kEegtX9KbZs81GoV5f
hh86XzLL2EZNoMMzSetBBdb4BY/LAAFsnNQRMY3d51InNvZATQkhLqrglkXUtoUO9mHAQj8edwTo
KGi2ckp+KFLMd4h3nFxkAQAzEMBXyTzHAXUEY4mQ5TpqQnu0DC2rWxL2vdlrL42SAMlp2Ub7lnou
2tiUU+EraADkJhqjIc5PPklEQe8uRYdUYv8h9mK46wIvZWwY/40uImRrsZ3IO8AIIqQa6YyKHAkB
+iT/6/dnrZhLQ7mS17Ot89Os2VmazbipOVCm27nprD+ToVJmPGcLpmDvJJJ6KbT+dskxLNRIfI78
/q6QZ3kIJyvdC4tOAuGFy4zrUmS/SIZIQhTWslnKEm/uHzJuZ/ylEdC/LLT0VTHHpwGr5Ldm9W/g
L+zsYwP6WuYeuT+K9jzzpARWcJmePk/3o1OMnmqxAvSrXzRLHlGKB8ZrdL26AyTzHiheCyzzWRQo
5TfJHV+2fKFmgi9a6PsQ5FTVeTK1HzMBPwyR1c9UoYqExqUPYCr8LtycJrZY/RERq+slDGFXvHk/
vvNqPx54x0gx5ZTUEt+AmjddfRplMnuq73zcxp8H97XQaYw+KOwU7U6y3vNgVS+DM4jJ9pzij1NM
GONV9XOv9m1lTvQtX7tsbYUg4RgUsMWregc8NKFF/v/ZXjn0NYaOuALbRzLTlvUcNSYNR3nbJmQV
988K5sSkKEACK1WHChtqdyAQ8AKYT2nzqjLpJdOtR2xHQKDwR5LvisTl3sH8XfXNF5K/7Qaxv7ur
pw1TrK/EIAVf9mN0QbtTzGjTiVh2EJ2Sc1l9kXew0CRCsm/nPg+zbCp+Rbs7+rVy2AyhevROsYuz
a3We/jtoNo6rrVzUVj+GAqxlU3QPp71kPbMvkJDNSVTHe2NW9hds6MWvhQYM6oKf9esrR7+dPe0n
7k14+O0qkMhC4teB6+jUy2GUJvmx6W08Z7VVPZGFtPVAywTqFJmItSbOjxUr/380yPEtBexm942M
jvaUZqu9LKUv33zQ90O8iQVTSY/MnHDir8MMfkz529cp+4ddiKaxDHCX9B5h8Gh/XDHMFbmbzYUJ
u+1+MzY72hvNcDGHgbxc4UNOValDXWu71RmxYlC0cuSpLL1RiPQN2qtfGmhK+Pr3LTpA3t0Csi3N
MnC6OE82sMg+urWQxBDkEKg+8jg0hEv6qV/nCI9/KSZcYRdOUKd6BbCGcR+v6H3UV26vGcqVfnYA
hoadzuGNn3FwjLLBwrUTyL98HPDN0u9p1PJXT+RNw2HowaylB1fArv4WFeJVxQQXHr/jNIyexf7D
gUkKfGLTT4w14hudwqKc4z9/QJwYhp35sxfaUv7C20C4OM9knlIgxis78pwW/csS1WS4dO1/UxN5
fXFRLnw/EjrNKXxOuZUX6QhDDWxGOjCBi8+4P8KhiVttyM9Ypu9v8qtf5qSaAt9A7hAPBckUejs4
i085biQdAIy3xzBMdxSi8vg3PuR2GPnV6mzhjxcwWhKHOsIEWm8EAS2nKEbxEmLUGv0RyHcX4opb
2VVBhk0AAADcAZ6paRFf9I+ov1QdXY3Wa6CBpc9gsv+dWlRkjzgk8c+RU/AfXs1ZI1M44kR/rfsK
+PX9ruDX5EgQ83RGel2id1BEmO3hNsvvxT1o7YQAPACe+67gtfF7e+U9qYHa5AeOpLXdV6rwGwfR
qOLGGDgeeZb+lTy7P5fhdcaEyPfximA4NpdDNdaL3II1ked62yN+NzhGU0dHqFclSCB6j6rfkONO
3U+axQR9yLGvmjBuoxcLgNZ+hLo1WT6zTVXJkviolTRyd3SrOzdRaej1s7FDQnP3fStar7Lbj0uc
AiEqj++u1/HhK28A2QA2IBOOwuECOQCAAJNbCBfwAgBHHQdeI0MhRACaAEJFAj2D0gS3Fi0QE5CC
XCLFoI6/JxydKrRNjYmDoIXY3CyAtOASBA2N1/r/X9BDT/99B0HQQzBmD/JyDbPEMwZgzByDkH+A
ByH3TkPoGAl23bOQhmPMYZjAOQ7b/1/ycgAMBLmDbA2wAD/9P/1/d/eD+8A/sP/0/u/t/u20Mx7Z
toe67YAchDbOQH9v94AAAN+0H8L2ntAHth64AA9c9c9cE3bnFYnKAnKBHIBCtl0101RrKCxL+ARJ
7AH/PbDPqwCe58XMkVwRCTwTAzpz+3KoJ5v/E79jeH/zdeDwk15Dtu2Af3P7xoGg2xbAeE6917Y2
xH9o/s//P7j+5//AD+z+3+3/8P739x/cAD7j+4f/39v93939oH9wB/cf2j+8B5nkecAAAN2xsHrh
/B64es9p7XrAAA9b2vb/gPW9d7ftuCFMbMAGAG62Ykdft6dclWgKoDcfAlCujXF/tVSD8Hn+Ht3H
8+j3KEcNLZaUqAIRUk9xFJ18KSiuIYPC5Nrk8HNIQq9EVycJ+Vh3SDef1oiFnOdCBkIiBH0XF6QV
PC3w4IusxhS8Oc0W/39O/4wJ5aGzGbanjXOYADBKdTcGIVNQSybyBc7U+o7z13xwofmfjToAlDD7
wPee85Sk+GH/cP9iAJmVwf+gALtcSCBRWQAAAAD5J/8X/n/2IA/87+w/JdEA8++zeF+M9V5oAD4f
pfTvR/kf7sAB/d/RfmuNq9L9MAD5D9O91/E+57QAACE3sRI+EJG48Rm4QlN5qQ2OEDhCEyEAiQgA
AcJGAA46TjhAAgQj/Y/zx//4/2Q//+f7AcdsAAAAcdogABwpAAOOkAAAAHmAAOAcQAE6EAj4YgEq
EiiwWiANt46I/uAf/gAFkhfLsDamWgLkSBtTgIkFZlWpoIHThxv5Ide2vn3WNcVgGlqlKgM853da
KOv7EogHXg69sSgyhmHbeQZg2zkGnWwAAD7n3fufeg74JTZof///rH06WkETH/Of7f7/7f/+/zwH
+c//8B////PP+R73rQH/r/1/6BeAAH/wA46TjhCBCAAAAccIAHrev/H64+Rr5D2z7gFoIIABaQCc
BAEgI68Gxw2MB9N8h9M+Q/u/058g+nPkQfIAHyAHsx/sB/sj/YFS0xaACOIoD6Tr/83XuOAAfSPy
wAGBwCF6j//H/ftpLXNzgGRgNxAFxCIBAIxcsAER5/GuQB/347eJVN4QQAkBBPQbgjmKFowCIEEq
lTjpSKEUSDMX+HoFas7snwfUXa3UHUXf3XWgaBmEAANO/Y7R7Q0HrXrXQQD/sHhevdf2L4TwvXwD
hAdf44CiABaIP/7/8H9n939x//P7T+0/s/t//Q/uP7wAAf2A/uf3H939gPkB9M+nB9K+k+k/sQPp
HzQAAABYDwgHg+EAPJ5/vvv/N995vz33nQc/Q6ejndIAAoCVuIBsjhAMjALhAoicQECgHFlAE8v3
C2tB93wJgBaCCECR/j/mJMLmPkO2AGg21p//bQLYtjQQtoNB0G2wAPC6dmvNXXs+Z868ATjMe2AH
ugbZ6BmHMW25i2zMW25g2wNs23MPIdszByHkIZgAH9//8AA+QD/Y+RfIv9j5D6Z8gAAD+8AIUxYA
AAPt/afdPX9b2/Weu9oAcCEaj/83//nhK3Zw2NyARSAQAHx40vagQHt9wbZ7oQsWCPPZXupEpSOG
5uS32GJyi7bxyHQcPMPu/IfQ60LmP3f/PtmYsw8he8xch/w8IF8gAbZtnIQzGGnAHads2zpwWxoO
naBoGneh/5cxZgzBWpfdtsIFL6H7pttbl20OQhtobEDYuxA6/4T+8P/9/f7oAbbtm2AG2BmEAAA5
B/kzBmDMO2cg9AzEHun/Xbdt93D/8f/n/8H9oD+7+w///7v7T/9/tf3f3P//+7//H9x/eAAAAWK5
B8jiHieIB4g8zzB5gJazOOyuSxygDCMCAA+EKcgB9wAHheEQAEgAtJHCA6/xLGD2vXX736VMynHH
TWzp3+/hAz+AZi23kIf3n/V9z7v2gNt2wNtzBtlFg8LxwGxeFBx0AcdBsTwnhLTB/Y/7AfNg+bAP
7B9K/sYAPm39jfNf2D6R82f2M+bHzQD+xgAAPmwDSNsQASXTcCEqlSXAA2SR2JwgFwgVyAQP8Aag
NoB9fqgd7z5dLzOsHRxZK7iZS8h91Jwy/5/8/u/+XMXoe27YFt6CGnf76CGY+QgGY8x5i20OQZg2
3MG2AHIQDMO2BmDMNAl5DmLMYbZmDMYZhtAHX+vWmAOvPyL8h+QfkAfkfyH+/fkQH5FtoByEOQ7b
tu2e78hzFtv/UMxch2zkAcgzD/b/Z////4f2gH97+wf3AAFAefy+R5PKPIOnn8I8pz9PN0jp5gdB
zfL6QlbbKgC4bG4QM4wIA4CCtgIfX8hfsZ/jk9n+ee7fQRRG/wnnHM0AOQehAGY/+ltWxbds5g5D
/05DmPbeQA+m/uh8g/u4+Q9l7P2YHzYf2L5v+w/SfNvpP7C+l+b/sAHzfzZ9J83/YPpAAf2f3//g
baHoeY8x7aHIeQAHIf+n+GY9s2wOQ8g5DyDbNt/xAAAAAAzGGYP7gAC8IAXmh/7A+4f+h9o+7/7v
uvth9r7gOCFM0v+VeMHUPU5Rd2pQS5MCXwDFXwDEgT/BS+0D2/IH+X9g0/kaj3ar+P8Z4eSF2H9g
/u/uf/225jzFtmYA8L1/YlogAA6+AB4R82fNvpPmv7F9IHxA+IfEeyLSkEkAtKhsTY4BRQADr3Xv
C7E2P4U/sQ+b+aU/sD6T6V6d839I/zhdFaQ8ALgBcwkxJJveTQC0gEAAsQ22Zj5DtobZtgYLAycX
AC8dLQJSQhEhC94HoXuu2gRKUiUuYeQkUA8L4UMxbaGYQDbeQ5hDMe28g5DtgdDoSlIFLBiQNyVZ
AuwN8SRlqcCEgXs2/f5Bv/k/owB937AT9xQt/UaCn2/wr66upy/fTfI/3Z9MA+lHzYPpPm30vzfz
X0i7FwSu65s5PHE6Dp/+/XFtbHDrwBsUPCgP//P8+/z/wnhPCBsfY2xevAeb42v1utpgcmpxwyAv
8z1vNjkQXIILrZg2zY+xtiB4XwnheveFDwgbG6++lAOWMBIBp+NPP1HY2xQD5r+xH0o/sT+wfSPp
X0nzQfNf2B818382D5EQi9xwIXqUpbJLaqE4gIIgKAsFQAUNVrUFpIIAAQRAISMhRKCAAEJEghyj
iBDEWOERsaiweF697tyHMeYMwbbtnIcwZg23kGYtt+mPpv7GP7ufIn0393DMeYswAHINs5BmDMeY
9ttEGx/CAGx9jeF8J18AAA0G27Y0HQQC2ra0+2e/QtgAtsLa0/QA0Gep5xk9foT1jOJ8Q+p/UZ8B
PE9YziM934OHX7G8MnuxwccBf+EBxGfwfocKCVAfUvfOnbli/7Dv4cp3/hLlPzvt+KYv/AaBq0fL
s1yqd7ZYMDzgPvD7f/uAAFwYUJVokbCArCAqK47GAbDIbPQnCBTGBAEA5WbL1Xs4HIK0LthCHD9B
6Dq3j/suT2uLFYrFaN9x9z7v/oPuPt6DbNthp9t2xp3IeQch5ByDkO28h939D+bBsYA8Jsbwm28g
AMxBmDMAcgzFmLkHIeQ5hzDyHMABmLMeYOQbbfsZjZ4v89T1jZ5nmCzjDti7FgvhZoEGg01w303n
3nyXg+Emv/b2OcTXDeYbV3i48l/n7vwdwkPnOK8wkcbsGkk89A2PxrBJeMV0PGH94AABZC0VlP5J
/K91//pwIRqL/d/9+CEzbJNYnLZHEBhCBCEaapLoKAC+BvSfhchJYaGQwxcwkkCJ9M3ZDgMXhEfU
5XAAf7B/20CSdFgGxdj7byDbeQj/L8z2T3L6cH0304fIPkRgRSDGZOZWpcmFwCHkwvoZBhf+vIcw
AB/b///2AP73/+f3D+7+3+/+wf2f3v//+7+wPCeD9e8J17jqwAOFAHIMCLwhcx8KX/NmDkOYK1LW
xcxeh8IUOEL/j7v/htvoIbbtvuwcdAFog68HhOvAAdeAAAB/cf3/3/2H/7/aACZGqifsojsQBswB
sIBsUksLhALhBgB/oA5ShFB8ltY4APmr0A4+7rsMfk5lC2tBqAVs6d/vbf+2nh13p9s6cFt6DbOn
W1bWggGxgDr5AAA0ENAtq2dAtoNP0/QNO08Hsg/Lg9mey9n7N7M+JfEvZez+J9l8QH+eDkOY/QfQ
dsDkHIeQbaH93/8/uf2f2AD7oADgIRqP/8vv+GEnbwFY3EAnFYwC4QKIgIAAulBEa4DjqKJBadgh
AoEeEIIUEEbACPCPVBD1x1ghwDAcJAIIRwoAtEBMEDhUeF8JwgOvhaQOOg96Hv/faAAacAZhZaeH
8wAHINs23/r4S04Fog2LsWipGY8x/9f8wB/aAD//AD7YP/3/9P7/7GnB+d0HrrTv+4f7ad1yGn/7
BbPXOgWzbNtB/3/2DQNszF7rtgZiAADkAAHl8p98AAEgJwJSzyuxuEBOKwgJwgwABcAUaAB4S0QA
HXrTgEOASCEgHhPC9eA/zz4kD4j/ugfl3+R8g3AAH5HkHoIchrYtalDMGYfd9tDbcwch2wAH94fa
fbPuPtPtj7h9sAafbNs2zoAadoOgW0B9z/1B9oDgIRqP/e//8AExbXDaQC4rGDXuH4JqlagEgC2v
JXnK7JZIV+rJ4DTEcXB++uTXnXoJhpBKevBjdlBp+gd/aCGnW1oIafbQ8vvv+waAAf59s8LsbrwB
yDkG2+hkyw60ZgUP/OTh2MxYEWti5Ph+gYGXbNszBtoBmHbQ23kOYA23kOYPd/8QAAzGD+wD+3+8
f2v7z+0f9Ns5Dtof5Q9D/z7b/h/j/1zHyAK3KAAAB/iAZjDMO27bmPkG2AAAAUDjtkksMmAVhcQL
A/XHlSxgTiiWB0+3Lf+bqVFUvXftZjxu88GMAcdESiiAA6+Ad/WzoGgB/2/67bx0u25DF+m/220H
yPyH0z6cfI/kPwg2Nx0HhLSAAf7PxHxAPy/4l8Q9l8h9N9MD5v6QfNh9OB8j9OfI/I/THyH0wf9c
whyDMXIQAAAAAA8vm8wB/EABwCEaj/ft5/ABMWxy2Nw2Jx2Fw2EGlQJpQC3AEFmxbYtnIOvseNPg
CFiwR8Yc4J7gFFoJrik8QvMPIP+lAyuudB9573bMweg5iC27aB/7g/uf/w/sf2P7AOQbZmAMw+6E
CsIsLgRcxe6egf4/9a0YAf3A5BtnIfQv8hBjMAh5MZ4vmL/AADbAf/z+w/sf/gf2gH/8AA5CGYcw
5gzFmLbQzDmD+//+/u/tAf2GxA8J1/YnhQosAbHDr/hevygCszjtLhsMjoIBcQNAEBm06tYFFICi
AEZGYIlZmMnBpEtPG9CDISOEQfaD7UHg8Hgun6CGgbZyHkAZMYQLKyeXkGY/dw2wA5AH5y2w78tn
/vBIJBIPB4LBINB5yAeXzPMZjzHyD0HMP+PINs9l+Xf54+IPy18Q9kHqoD1ZPT8/P39/FOzt1FED
y/ePP5PvPvPvPL9996++++++84DgIRqP/wf/4AEzdpODSodEIBiGigzD9FnRRDG4IlKaQgWiGU4Q
S8J0JOi9JEW40k1tBlzETKXAWZh5BxwFoI5Dkwvoe2+7/4+7/563ITIOgxkxj/P/nw/38LsXYloA
ogBAACCAEAA4QVYC9577Y2x+OA4UHhbRQSgQCUAFFAooHHUWiDMO28g91zAG2BmAACcbG8JB8cTj
07YgAO+DvA+IAPZgB9J9L83/Y/mvm/pR82+mAA+QfT/I/I/IfIh8iS13AThALhBwFhOuwBdgA46A
kBcqAxn89j0ZWNjSMDAz4Dbcx5i/wzBtnoGYPqF+/QANA0/Tsgkx8T+p/+AAW3/jQBdt5D/1AMx/
9P+gbZyHkPIcw7b/n/xzBmD0P3X3UAD/AA5D6B6BmAA5DtmYKALmHkHu+2chzF6GAAAeBzvA8DoP
A5gD+z+z+0/tf/nAIRqP9FH/7aEzdADYXKAbCBVEBho0G4ANCfX3BIAOOAIMxpEsMjABdFwgzUkc
pK/z5ireH/k9AzESIm0iZizCuuH9bRIyI03aP6j9R6p6p2wAD89+e/PfpuQe7eheheJbaHiP+3iP
7WzRZh/O/nfzvivIeQhmIA23kAbbmD0LMAeh8gD3WtCkYZfQf7QAP7gH95/eD+4AD7X3X2g+0AeF
8L17wtFA2MHXgDr4ACxUhA8weZKXaSAgSARAFcXvYA4udAAGxCIEUTA2JaNAkjAbG68BFAOvWkDn
X02igdf/R6qavvnWnAJ6nqfiT8T/b/b/b/sABx0Gxuv9fDr/Xw68HX+EB+jsYADwnhQ8IFEgAOvh
4Tr4B1/YgbH8J4XwuxiCAdf2N14gAGxXyP90AD+6/Tg+m+Q/u/yIPm/mv7D9J/YT5v6QBMQAAC4O
IRqUvd5LYQK5BI2pXwiIChJA+/70rATx3cSaolgAcAJAVgUIgFLTIHqOydszHmLMPX/C+E8JmDkG
YNtDkAbYGxg694TY/XtieE6/1/wmYMx5j5BmHMHoYZi23MQZgDMQB6BtvIeQch5BtocgDbNszDmL
kHhQDYmxyQEdf4UFs6Bp4af/tbNsh8j8j9MHzX9g+b+k+afS/NfSfS/2L+xfNfSh81/YnzT+w/S/
2H+wD5t9J80D+xh/Yv7C8LsXrwBx1HCA694QADr/XwKCGUzMMXed3cXSPOwsQeSa8g9sLeTyST55
8y5Ls4jMQEewEKwCcMdjRFpcYIUYjAQAB+tBZR+PwA8uWHQZOdTosW2PreA4tcDZgY4FIg3rwB1/
MW27byDkPIeQgG25j5BmHbSIAeEC0gbH4UAeF2L4Tr3hdjcIDYxIAA8Lx0Gxtj0SDr/HAEgA4QHX
9j8dAAAAA/tAf3P7P7wf+3/oAESoskpX8fIq7iZq2DMFznyJvPnyAA2BcDgAABEnAZ6rbkV/+ps7
/XmerM3vl8NLiUU9SrL/nlHLsNA27k3fH42e65QkVJtJCO1HSwSFJSz7+vks5ixNdvhzu38lBZK7
DMv7T16Kh42auj9K+ZBEYmvQ/nq+IkJ8hea3WZlQiO5zBDovyKLsEs6N1qwDOCwVc7BQrGNFTWOd
T63cSxucQCVwOviSw6kQtqSq0ocaQDbZbXcYWwhK2HSs2vdUi9orBmJ92N0Iz5qdQ519mflpfZ/q
X3Saty0iAhGG51HoTOWUm9aainzmyvSfDGuDde+j5n3cUtXoAEalNHJb8x1afMXC5Hp+/sGvjUup
uP+oUQHguzSV/ikjzux+GZ5sPsBmt1+Taop6V98NvRPk5FldFMUgqNiMdZuzwRCOkhAudVAWPEIz
+aiIeNo3pvFE2o+c1l8MtR3QZbJppQ7mEKqkqPrKGr9TMl6wicJD87R/nxGy5ENzocvV4TouXS3W
s4siNZzc8BcHXIqnihcrWbSHqeAYe0Hm6Q1U1NULRRlqUqXmMRVeSbndRySWYy9S65qisxo5n6qd
vpOCtSvDAYoZinn2PcxccloBDxx7MPPHRux3mvG3FhlC29cLcVpsGW88mIHIaZz3R/EAceZ7XUaj
8QyBGRNgn/dozw+mtBW/b0275tPVIK9k7yurzu+yDZ/1rbSUy11Z1nj2Y5JsyyJ/WoE/E3unsluS
N4khjUNBo2+SAfbH1MQFW5xb9q9RooD7bdDgTaUh3WARusuErCay64Cl+7MsZ+IV/hZLWXx0XNs6
FjWWoMNyHtTVmtHVgSFxLMmvA0kFsQwbou7hMj9r/vLWlewXCK0hseFFf4Rbmi+h5UrFhk/VAFyS
QhWWgfKTJ0r9aNGC5qqW6KC192L6cPGcJy7znECYFBJc/iSK57/U8W1WIUUYCrp9iPalmQmbpCof
OZC0xcHtLrZHMco36DxhjfVw1Y8mIxBFNLAU2RKFu4D/LHofChqBVXvvSu3H/zvIp0IkbBQA7dPC
FXDZeVVCchP4a0lBhxbmOYqgJq805ur92EFeJLJuT0UBF+EKTYu/0gCL/b9rWTvco5/iIUYt49Eb
qg7C4mBnRnRl9+JhQeqIvHRJOfR1+WhCFks9M2wkpv9ubX+Z6CLJ684FJKSlEFsr7LkYQSQG2Mgt
jPZiUFngnmWbqA5knRrxqHwUTGsYriElAT0cdCvWdWQ5Oq0ZcqvDC6KX0twy3nbzSoXOZi5FaR3V
1RaYBTH+aGmrLUubkxXA8CEqACNU3iokqK+AmgJ2S1wt5QQEkrydnGLBbJmxhfVxX9E72Kqcs/vn
J7N7H98tl6DG208v8jxotMj0JEddpIWuD17bvX8V9OJec7Q1aV1ZokZJ01B+g069dQtlbIil8Y8b
vcodypBfVPYfVt+gnAgwPr9x54fOcOf8lvLXoQOFu/SZzBxrRqkaiFWf+Txljr7DjKSdbCB15k4y
5e9RuguAigeyQz2KtsZRCy44a8mRIH/B2DPtFvleU/GfrYIyK0V7kcHovutWEkqZKgddgWAnTo19
GZYfeF42R6dY+C/e+IC1MmfXGfEbBygqnuK74MaqIQOESWZgZwFl6eRlS8W5KkZgGmtTifwYAPp+
ZrLgyZ+51/QUQ51HMXxyPcdgGvZmqgBl+p3IlCR2Jq4wKSox/OOlDfamyfG1Vhcp330Ab/Qi4Apc
xHjBqw+ia90akHr07hVm83SFidLKmIhxGVqTsO9NB0iPZWpdi7L2dhh9pbfj0YvjHuqu0HvJqNFh
obsMXD7eFEZ0KrsWBpxkK6RFIIKVDwNfFEoe1WfF7OdAwGumPQu+DIgiCqPMnvmqOlI08itpA97w
BSEZbH0Y9Hhe+xja/Vm/MFbmusjeDNDKzqmQ6otJtcmax2z7we1mlwCI2pUh7P9kYOctEtSrnE1l
ifvBSw8RGF3aj9A/uIXTsf9xIBR787dnibWskwTOmUogyrA7dWUtBGsu3QbgmxfgTLEuOyergvEz
+Z3yRR4uqj1ZmspPv3liryZx+cnWX+tt8joT96MA+NL1+vE5W3xHDbzweatDwNKCAF338VEKUpBc
ERtFPF2QPnCUDMgCpxsFg6NVXj8XrkjNG87kfG0eKLCbz53c9cWmkpO8li13oyAZu+2EPiS9h0sV
OorymzQhNSkW3O/2vCFzz8FDb7AFp1gBxQd3txwPYB3ZW6hEIMHooCU5YhC7uazF0H/RkKyFE2Gy
flDiz0FQMwgx/3pBxTV8+P65wo7jWPUEW9lT3J//UJ6Ni7yupsFwwPigVyqtUlTQ1IqsiLx4q3Ma
hJkRFiLvLT92ObxEOMVmGV8YrCXNkV4vh+q+kqnXfujwnz1HlulVGITBOStEJBDNXjQJdCwr1t6O
is2oC8tVWlcbHQUip60bP8fy7rM/fL3SfzXEg3EIlmi2lof/efkAnz0/5Qti4//L28C/8o1Z8Rxd
XlofxyrdxXzd5ZXQYwQSsc/rousFDKakuwh8LJOaTh2UYB/adDC3aQPdBcXgZjl4Ez4dcPClPdcJ
wWtXqdqiUDQ42r3VizDk/xLtJSKf3rSxMx+FRNPsCwksSHKzf41Hf8zL9QB+vt5cSfompMWPGDUn
k9Ep8b218a+CfcZuaDJUzY/GavdtZazaOk5yNURecAz9bJVH9aTuXM3ZUOmtxT8MQQkm5tDlHwRM
E81BJMiXassYVH6klE3N+OIhTp2QHlIcqw6A5vymueJ9LJcbyE1JCJBJLcAcsGxrXRYHwIpgFBPm
dyWDLtsxJHDm0qCxeg6hpC9maG97zkA9qcsoo64o9PBbFFT/Shh8DSeWhKfyMJQIIZWj8Qz+aCKl
jp203L+DmQTvilEFekTMCKBUIsho5xgtDoek2qD6uuPZbpi7pf7T9apNDyW9UKoH8Gi6TDg5jFnO
VO+2X7Bd6dS55BXLc7ciVn5/LZ8jgEk3eyQWtNhan0PJr63CPdQB5qsdzw/qt2pMed7OsrmV/nCe
eUH6hg+TQxIjZHZcCH/21VcPb55XVV6+kifFeKLf6HltuQQmlna8gtvLyXXypkNIK6ZzPEca+lPw
RdhkmA5TRnYzgSAF3v0xpqsLT0jqbGEC/+c1boJSeDNviMG/1Ko7bY2fJztQpwuj7x0u5AQZUKRm
6hoyl0aOB3X7bcQJeHCcP2uqJDfDGJ1+LwOPm2NQkrb3CUnk6vSfPwDkKbnSt5wQgnavOy8igfgP
ygDCSzulsF8kS5I7GfL9j5wNYCV9ap52H97bwdV4wu2OYKhJL7Bqxs5TYqoh/lbehuzrx4lezg3X
uV99LbascldndK+eTxBx8tG/r+7coFe+kVaKEZ5HPvd7SPiCFjxZIG3Y6fMIuIYfQOGukwtzEWR0
THThZw1gd2TqoR23iBYcTiKUExjj8Tv8ImbGoX8EG5fa0HobzvOJl22YFyznKsq78hfL31D3zBpQ
J6Pk6+v/q9ljLlmQ5t0Cka26XNqesv7NybAdEdvcvzuzuYijHvcm7AJ7xbbL74r8mRV5eVXA+3E2
hK9DGAiEls6I8kDllhyh/b30cIjTJyw3sd+O4q0apcjllYxJpSSeSjW5mGNgaoKZzWNJOLsA0+dd
i7Bj2qTEYuAMsG54SsH2LZGoQyu7tIAtceGFvBUsDFmWh4JeVTPseENfUV6mCiovtRXOOCycIK57
dwEUF1pOLqAgX7BbiHRkD0SLLFJv3yIdP/JhFjqHWrtZGVLMckZWNXR0YEfShWVdjZZEUJi1Xzkm
iMo7LflUFFYL6KYWQkixKqWXosH9WPmEFKFyarpFP1H5XMciUVPKlSbSBAWNeL/572WFOe1WRr3x
fczesIX3Kvy3lwz+jdtT2LPuX5hPrzn7kyYCM3iUZXdIxPYoZUIOJDkH/9af3XnmIgnr9N0LF5xH
/GowaEm82f6zMhTC3WrvLa4+57rbtM9soZepwktXtjVyuJsnT5ZxmGIunhmnKpgVZsyNLggJ0yXI
IlpPxAdCPfs/U0kx4Zzi0Y/BLmQZujpkswQ0wyDVzhIhJjl0AleGd0MOYjphQLk0ZcUzhN5xgHJ1
yuhNBPRiMVsHJ/XwO4chY0wqulsgbYfEJjaEjDuJXpH6EIymLqONrW9yIt+7WjAkOund8bxhqrHP
0w+DVBaBJuJZh/GpCw6+2sIHctaCozq8enU0EfPUsG348WwdEIN2tkDJ2raW8HvU+CFE8CbuqgkI
1jD3wYFOOY7tlDimg8psMcbnFKh0UaGlabl5FPl/i9+Hn52q7xTGr/dJNpH4uI2IIuxalqO8cV4G
eTk+NWMXmrEvvkAnysEde9in8fvurrFqLvVaQFxuLPE7CgE8hSOZfvdZokDBKTo9+P1SM8hSSSZX
tLmwE9yBwwU5+jti/r0mVOYhDk2fpxiK4JSBZnuv928QDT1rwd8vo+kEW1RBxPI2LYoRMxCED+vV
sfqfo3xSufHksiEh6iXCr0+Kgu1UowGlqLjosNged+eZlqJ2aG+araCnQuDfn2L7x9Yy0I0k/b+o
aUUedlIBSnPtE/hQcJS3/SuWQMaXL2eQQlSXv6IIfoe7U5zH0FZIBr5+768vI+uA3SLWlUINwfpE
sypoP1Ps75i8dzMPzkY4ve7/1ixXEuwLXznKdWquSx4c0o+tZlUEboaKeBkLJwWNv6qrREb8FWHd
+itBTmKVX5ggerI02jcpkrbd2J6HmoTa6SJdpCjuJWLp9rs9TWMu5NYX/ODqh0wJtDNZTjFhFRdI
s/psTILMBsYNK/o1v1eu05qMcUMJw6C3us+U1GUB9BuZa/j0viAkTSHHSx2OMGDeq4fhKv6NnGvO
edTcwGsQy6VKdQtKRqi/lmr7A5mmZkljAtXTKvvRsDIWqZCJp50YGTQM/wJtaH1911a/j+1lXTnu
2eBofEhrmU2mMi4rG1ITwMeJYOCthXPCTQnUbasEXXE5pLEP0RyxJw6UYoDKdXgNCPBqc152fuFZ
qfXb9wkkbw8RCHx3IDUwiD5iZLZsU4k0rpDR06N1yweBZ0m7BjbZ3ut/j3Yh/qRDgFNxKjYmHT6S
O5zJ5QRKg3HTL9m7yye4z9R5tW4tNBwptJwIhCnr98p/5sXchEHMs6sqr5FAXdC0U02Diq3dnAIU
rB02s4SWRDoOrrAQbXl4xuOfZc3MLh5vtHut/UyHa7zXNzD3P0lo1/2zQpdiMJZ3qIaKIXZ9+N8g
Ui9HlNUBpwN+qFaKaA2OC/fRLXNFgdSHZ4BPAyfZlzcMVkd7hYeMUeOLQCgLY880KH5fejdi9ex4
H00HCk7PqB7rmKUaVd1/ZbLPFJYUvsxdSLrBiG4Ab/kHKkhp1Jpy3iEKtu+r3C17BrRzJ+NzC2M/
3sAD5VvpoSabIU7elnzI4gHFJS4awyqfWgc3FIq8u+MFev7NXZvJrw1r2fc33D4ecfDc9qUkao+5
7ZpVDlLgZ+DGkMYhtH46nrAntHqXGQeO1qTdP8NWafPpfDF/dPMEDTcd88mVzwGQO75THl73uesO
XMJYRKNiaqzDLy4Fkzr/ArR2Ru/zCwuQX/3PSJ1Gb0aLtRdHrSea7q4rHg5plz8ojNK2l2oqrYid
ELXnUBRrHd0Y83Et7BKQzV6uQRUmdMa4n5pQ7pQeALAsikGIlnOvYuWm8RelskRpwt/vPY+CMim0
+JnHc8TNwImfom1O5MWmNG6FFDgnxoGK1x3DEKJi0O7NRPas16oK2qjITawVsm78Rfu1uyIIDQCr
brvIvPM4kl2G3/bqaUeoMl+w+cL6cVYQfBkVZD51Tkex9TqyA6iKHA7+wHU3wfseZHhWOqAowcdo
OjlD73d+hGORns+T0TBUd7lj0Me7oo7DHM1Nx/q4SmcNqO0aBLQOD+TSHNw2lTqF7soAABrUQZqw
NQgtUTKYBFf+m2UD///7GgXAn+/Ap6NuUe8Pg/xWHov+U9+3ySgnVBnWeqhlzYqqEfQctv6Jr+i9
WtXanVJlYPrktDZKILiayt5gztuIol4vFLr+f8nyooJokIizt8FWWSY5FCZoNQJB/18a6K4T37pC
EQ7Ul5o1YhdriKclGYNYYwbolV5hTZKvvVTM42Qm0DNd62lD47PNj+VOWnRWuxVQXWityG64OTaY
lZtrbfIzldpA2WdrB8RgjOOkrjVQnVafAP1LAxnXlszG+52e++ZHk/Mwgcelmgo4slEeTltnBHS0
a3IzF4PgBViQbj/as8RqlD5sHaM9fHEwmMNeDC8pE7rCw4B3q86sd8XOX6sYm7jkem/t/JxB10rb
I7+VQB9KUi66B0/VyzPlprPHP55onGTbTSlq3jn5UA6exErxgiNNLNHzTGfwRtu+AblG4PzOwKw1
l1qT1/gnmDMOlkylHg+UNI1u1l292gIJFuvZysQesNEuLlOF5RzlaDMruUyNVYq/Mo9UfjSyR53E
KAXr/GE6hrgX80QxrTlhBTl8aHLmu2mRdwTuYHKMQR/p+f/Yc3jIVMfuMnS52LO11NKb6+WaEkBU
K1jzRyd10bbNJIlFlEDINblyqtvjQPlOKejtV6KBICKsGmGUap7LIwUDPjOdcwhxauESqQIgwwV5
MkGwUBBPUwi5Xt3GwfF3Ai3899bIztg48TZuITQiOfwrP4jhDeqg9GGdSNrQSv3cc4BfhgxO3UMQ
N6XgiOEXt7cekgmqbJCoy8ZCP+zN6s+KJsjsoJ5p3OQvA65Kpq3KjOxQFwoV10/AbtgMBLbBqtb+
9oqeDYDtQARrZgp5pAjVg8jO2r7gLR7DAOp4z7ESfr+RdCtd6cC0CNLO/T4pYA0QL9jfclZ46qnk
1fceR4h9qw5c4QTU1Z2Ux1m8YR7HUs7CooE4PEJQxPs08x/p0/c4oK1y3cw3DtqEKxLoBBTZcm8g
2hT1mBq5QRvclWn8qH8D8guoKmi6oS9WY9YG/RwKQDUdCpvHsUgvd56K1mPwoOUfk1kI3ayjirfi
vi2vr7QKGEWdNiGLmOTzvSnmeE+GlWzFLSsUZpyM7t25UfanMAqzLlg2rSauiMqNdiz4xkBdxGx0
AXxRrSLnndo7ZG6MpmI7HJhXWBhH1R7fhH9h0mEQIBzx4pS2FgGDLrgGSAr11+h5OzrKJrY1C5V/
ZKqXNpcFwRln6JaQ+5XfqBVnp8WxrTjckSrMoqZkd+93V7KmGj3mmsf6lb1hGmPFptZu+DAd4Gkn
GoHBpJNQdDXRf8b2WcJFw7gkN+G7XHyCW3T0zzxgYWyHP4uUZsIb44nzjjN4Cx4LPzsi1I0vzh4i
joPxAaxWsnA3uk7U25Vw7lB4cTLaJfbhNlN5ngL7FfPWq3FIbQF1P5WLaxBdwbNYINHeJ/CNwqLs
dO2lFspZ3jT01+pMC7lnBxl2gQHoAG2WfbPooLz51KpM9EBtADwWBXKU4qrf+gTz+aHyxJOP972Y
YdhNeQC2PcilSzdy7XmX+rzgVH18MOhrhjR6JLdqfiXwUe4gOLBPgPg4grcVzPbZlka2bSAWrFrO
so9BTGA42zUwbQ75Cw0whQ2QGBUAo3rXIs70X4sdiRjFWjyPQNvrxmljFlmyFVekI52oXqypyk5Y
WyAiBgWAdyl4K/gSoMXwbQR35hkSQNN8KRiGKxN1sM62l/YfE7mGdzV7e+PeQz51H8MyMz7thuAT
NcyMB80vXOFJ94Z0Oq/xfK0e3SNZDJuduHq1QESAC2b4H6gi9Hz7rwkbjrXuaiwXul6C4Bd2e+Ri
nnKJK4fc9gEFWa5JFtDEzRw9py7/HwNdFRxGEIay+5TgtZqQEUvGOpXTs0hRDOSH7RrQI3jHFpgD
kfGlquAQNtGBO8zaz3wMMTMlNOBuZmSI0Pg6KKeVPXcHOxfN3/iTGu2/wNWPB7yGLfy+7k/5o9jZ
zfSZc5tu32VOu76nXzvgrxvjv5BFJMFnLsfR2llpcb1DkqCCkasKqy8oK+BxoIPywQy4GZLiIr9n
Y6V7B9F+Q8bi5cwqRt+e2gRsFqxQYoIpmGctJtzfLDgpiZ8Coi0wOhN/K1twreseYgAyXnWrESOK
CVIuhra1quUCMV+ygerAyQbVaydYp94J5JZqfbfpWrrZnn3sm/+s+A93amZmUo1noqdusI68+BWU
8lrSOTPwH2YidRZv9o7wP0M5gkfPhNY9senfPkA7qb6wPG5fmB5qMKFpjKR6wkCDQw7UtUtMPxQm
5ti8OdZtTDFmeW/0LYet0M54J6a4X/dQWNxs99X1baVfwU8iR4SDP/IMWSqsMMasb+bLC5w1/7dn
g0fTnBz8iwoW6F3RAEY2cNjdLZJsiTNr5KvwWU3RGFgfpnxonqVMIVG4DH3sn1KNd378o+PXeVbJ
f7V9JDaBgTd8E1Z1i6Qo30h3QPGY2eOUgAc9Bh/vmhICIxhD8l3eEmRFBYDB+3wgSsWWFj+oVjR4
bKIbhcx6LEl8hpoz4xm1j6rMLlGDF8fgIbXPy0/LoQUGh/u0nveHX/mA2ec1aiKh63b2+H1m7G7A
2bLhKlMCriSYme3OjErvvwF5hy5nY//4l1dgUlkxU6St1e/irv9piOuDBt6Ad2/faIlaPYWxlETk
LgdNEEHRoPyJ+sbyR5Tn5pYSGNK2Yg+zZXeuf1y5dloLkLBjorbcnOA0FFihflF0b5ZD7tiJpabK
iSoakkD6ioe3GJXDwXbcLlpqVizPAG7ntZbK3uL0i1wQeFjsJbEVIP9XtC+orThpF7H8bzmlxF4X
skRuKznwCHBJNs6bfl6NqtLqrb2FfEqjSeo6BpTXiMEfbBU7ld6n0YyZOTw6SAnyDx2FTmSGlmtg
oaRvppeg/kuQ/EoQVxOTZ3RUR4AaxTL+E7cMgV5sLR5oy0MCVLiBtwP57+n0aFB5yR+NGIrs4zxp
V/QdRzgpoFIp7Ma80l6nTp/8poeHz1ti7nXK4Ht/39wiNmcpDEu19Sb8Hg4QqrEBYHMIAfT/w32h
fHESfRm+4GnyNiwAbJJrdvrAZrhTP5BY7QZaGxkB2Oh6oOH9pmjhA9qYSnTvYmOcMLWxstWjB7pw
qm1ggDP0Wmxga3dszLSpTBK404oOa7iPmrcROH6QflhkFp1oyjLsOxbJGz8xR3Q7nsOdXzPGhYPh
wxGWbpqQSoJghFn7NyFJoSex7YLw1gH5nQq+dPOHM7iXv8iZ7mtqT2S4T0yc+WpOe39LboHC8fgA
f8rMB+D8YUEyip3Rn8ZEZE8/8hXYTcaEtkDy+gjemXvYvAal86AXFr6pXjxiH741Qg3mYcd20zpz
xAj3m7UazYXOHdLODrcfZr3PgUHGtMPAgpce4Ylg2ZYh8uyAUkB/ULp7507GBV90Uu1VHSDAT0w2
Za4P3MksxrValy+FpxBeu0KdkyZf/cXy+LS/YGavXWzYeRZ3mgInKtM67jDC5TcDweT2L5CjqzmH
krWTWoG8Q/3mBEXus31D174ISSwcGJn6oRV2pOWJP0nI+G0kcBX1mjjAVbWX5WJNbRFIe1xR7pdN
QgMwXlZ/S9UlBveAV3pvHhpTWXBzSj64BxEy22dt55a9RF03OfoH0lGUrwhOdyVmUMP+JRBKx2lF
1HcD09DIVL8f/aRXf6kuGS+3iBZ8+q23cfuJ9d5E8cTni9gfEyzIo2xcXoRm1NC5X5GBNuFu10mL
zMnXbw11mYRY+ukgULm8smZFMfoFaJTeUz6jAdwzyJUajvqKGk9ubQt40Wb3O+FRBxF7haCEAzOi
aftJDG5eRjdhbme5VNyp/b/3uL+wJ+Jc92TPZvh3IBLKgSWqc94B31TOV5/0DTP/9fmk6NURPYc0
TO+h4YhIpYCLRqTgQxSwrltVrGEpIu0y2A+/SCVmvPyNHA8eBC1FUpQIiIUwSrtfgjADLhgGJbg8
YhCpmrTgBOW4AxErOEKwif/LAnV03AboVcfusbq9OWARsJxZKy4P80TtMrjiYx0zjtZqW26zibqg
5Q4FuP2AQgGMeOt3ZC6DPeRYdomTDcYI8APv88KrIaLAFj/OHqJ72QVK/IBfeXMiNAoclZYl82aN
NsPERP1d+EJPOsAStrYUkI/nYncDVq0RMLRdovX5aOS6axCZRoJmxSn9LX0Vzl8ahcFspLOpwiWR
g7aQ1YeyH6/2/hngw1zIC9EB0MW+GRT+pslrwferPPlQXy6W5+YFfW73QgG2qj7o9tw5AFuKOSBz
SYo+dMzb9aYjS6QLqGsUQT1c2Hcu/nQ6yKFB4dFp9Ot6QMuvhArbw1pwS1D4Rq6O947EAr7YibHl
X8oLMwlMTOpoH8b1FF0Nv/WNgdHQaftMEuopntw9HDbr3mGBsRtI1Kwhc4YiAyhhLJyeSAuBGZ+0
506JBB+nmM7FOT4WootNFVWDltanOnnCeceIF441k4qB9p8pccAwP6KWIDy4fsJUDqU/EjFBYkvf
Q3UJTT6183bGGTIxWVEx+7EogvopBys4a8OFntC/xb4yE7AoeyppJLtuXJSHujcB0tnF/Q0dzogW
PXZVi5cWfKqx1DEXmPkosR1pvYxdkFiWGuCPSaxF3q7B4N5Ioo6igGA5hZnJ99HXHwBZENdMz8Di
tZDkRl9t9HXXoFBxbKwk1BYtBizuNUtNM4Qf+IqKCZLGBsldT/aEL/eP3i/6RTJYpeS6cG58tI98
NiUmiSaaeX08cDAUjXpgftysadt2e6z8TyHlnBVzc9FN+DMMnBX55iwnFlY24dchCmBg8tLg5B0T
ws9KWAkR04k/0iS5/lUlBno5Tc3pRHBMBoJZXZjMNG7iFd+fJWHIsq1LHzV/z5rpUC/OYSl2+gRK
BRpIsxIe45o7LImR+OGN7t3N8kMkWxW7z02IDFoCiQDzmSVbHUhgmS2jN3UAhIxk3DjOkh7IGBG7
9yLU7u4CWZ6ivpArPf2KSl784Hhuwcr7i35IYkqMcBb008xtrvnT2UX22aIBTCxBPbaCXNBpQTeB
HkOfmCFyP1/x9N00RkizJneRKTZ9T6i60DZcKvKXKBiCZzg1ASLdZb+fpKrNqGrIut6u2JSLCE1n
v6AahFvlX5LfjB5/xOv1POQF+fIdKl7+hm9HSiuRxenmaqksJK6Xq5VhTNApBLes5rEwhtztOdC0
OVeVlQ7BJW19IB1Cou0EBTPg6PeGgOcePBSh49ZAdPCJmhFq1detuR4G0gn5sxs7pX+ZFhJsgv5j
hTef9aBEro6iRecc1syEIwKThrsEg+60+DNK3dqNLE3pmiRaFbUnNXXE39tDvX6XKsKlPqnEcso9
e/g1nk7h0gl93xeCl7UNE8F6ztUhdUX106p3/jX4Xlu0i/5RFj2Kji8a7UIXcLqivfB6R3rn1T8O
Q1EKljUFgFjWdVroXuejl4GdGOfjpKISEGDBjr3Nso+QRtgjjyqbYa4t/GoUg/lf2sVp+6hQ4YsE
wgBWADPwlRjbMKpifT3GrJHpN+16fbMmqyoyb9gU1iJTUxjUulSveVj3Pu8ocsJomhs9veoKhNix
DUGUDg+UpCJ+mPMUiH+quUKJ9fi73lTZP5lV23wBRP4PbYPHvbhY2FRg4hBBaqX/348mtVURvkl7
CQpsNELB21DjOc5RFOIQvnrXtQWFoHtem+5wE4oOhjPnJRNO8fJAzaX8HzvjN6a2GvJrz/OmW6DD
BN7KMCCBvbAaA1rgbgkKNE7a/Mp3fNXZUPh9koeeICDqNkum87moqYFWUKLBahDorpb32O4iTNxc
a5Cl85+STpMXXcuPUqsc4iYrz8vXYStBKWsfw4aAXDJG/NUoOD1YIOyvufj15V7IF9Ju2P8nZGjl
rZzZWZQYRGlXHBxLN4O2caAo5ohC8wzzTrq2RDtP/Dylz94SIBN5FDrY8grbKtUvZTXMK0n7OMng
8w2tL+OM+wDr2QDpX227K/4hGonzMvDGQggrg66DF1I6UALMkJBZ4s3CvoDDWGtvkA6BtG72n+VN
ajEfakMSaCa0EKz2Ndiak9AVim4GTHHKlzlvtQft/l8lv3dlVWFJfSCE90GDpCVfWTB7vWth3Y4D
3syKy8kQv8+i/p4JpRb9dr2joswyic3zwEdZkazUuyFC484McyOTkTt0WjG5xjLRXvN7fKYJIXbp
CLMN5l0tqjDNmFL5AWqmxYsUiY9REhbgv9zJN4AvrF6mG1QwJw2yPeZhMZvqfnLKU40GCYlYDnOM
c3tHwBNo94D7UUcv9mfdLmp9UJ8qrKMEjYhWuNmOF1VRFXywfIFAWtIv51NfL6Y5+ayhJNNd8ciA
my9kFpqeCtDH8YSUJXgyXJMQI25yveI0lezcUtlZ4mup9rSn0JJkvVYbTx/hZ/VBjF4EIvUSxH0Y
gIdNZlNhHZPc3m+P9i4IHekPhLp8Pe88zp9Fo133FI4TKEJj1O+oIkhA+DXCNM/oLjckSYSlpBdp
qBaTJXUFh0IKQAyMXKUf2F9KO8uh5Nnan8SU9Fdhrnw/J9q3TN/R+0vvo+hBOc1dtIDPevU5j/9x
RW9OfpGK0woP8FuCVr5JjxyBW7/9/ObhLZO5HJJCqeCXyQpXC+gqdOqCqv9ZSN1Mx5GnMHd+ankk
qaMhy3clUNUVj9SY+5t5V8HZ6W2qML3jXAXxdPYkNkekuHBMBItdmnjaVs5qpy8Papqmr/5HTnUV
AYr2Y+iANfGOQgidStu4Ys/4oiItkZtW1GJ3/uce7lDL6m4IU9WVZVhlKpE9nw+hULy1hcCErWSM
ekTHYxxkGlD/xb/WVQhz3uEcFeMFC9A9idjWekHLrs6taeWT+VyHM9ShGJ7jXaO3FRGzCVvmZR2r
G+zFRctnktkULxiofs/b2evi46LZNGSz8nQjw4YOl0W+uBVZTqk7v3elA+/1e//DPbVy1X1f4WhM
XHaRvei8qWAM0i22DTfxqmIIpzvZPObJZq5BA48ZPc7lKB0aQofzREi0ex7yW8E/zFdQeavahCOD
OfFLjz6CS5nNrrNAaWfnAJ8o5DuicUD/EJrTLAsWOrk0tDBgDfMSwEb0DDuDZv4HJuupaEZsMwj7
miMAihZ/KkOQ+p7R8VKOyLjOjZY5DHiac9YWbwPZOIzuGWpc8qucSYBAf8Ks7LTj8/AtWEzl5UN8
S6MLWQbgnlkxC/cJ6FvtFi8RHw0Q875YaG6fS8gT6FBr0L7chFmzGbnVmfUeRe+0FyE8sJn4CX2Q
KukYhJpOrkysx3mrbnedMDmyHp1FATKdqmgfVjYIKPbzPsXj23QRlKuTeWJ9S/2ndUGc4z+Sair7
1KJ0hK/4ATwTcsvQS/34niUD5EOZG2a+nt6b8EXI/kkXIQBRUeeFZgn3megd2a6gnMTyN2nTjF5C
NGGr4RveYdF1mwq0TYfXzMKFf+ps/E5rCqIrvDSwb2YpKlwZMiu2gKIBRkA2NCZpm5stwoqf/zc9
i2D2gkUgV/kB56VPDpHQ118WQfnsPfLiSg2FAFwp99GpeIf+gsbZhlqaahYqHYL8o8eXFtJRs3BF
N4jKz1Tia4sdBo31oyM1tHzrQfW7dSg24u52BCuvNjIUQCpvWxqA0j4WfkELErKXnmFvojRPtdaP
62SeOIolxqUBei1WJdWk+U/YpUrYIKRna6O59AiFYh9jntAhxC5kABWvTQV5BJzWnAR12VRDOLqh
XR8izsTnxnJFEGVAlVWrJf2TQ6B/NaUr2o/DgFmfNa0/mp6ZzHSAkwpZ4EN1XWg5FIszEH8V1fty
4P0IUpW2D2Z394Tb/AC1u+lp3uoeTcoPSKp0OVY3BWh+rBdP0c53cetWgrJYqiuEMZ9jx+BngxGr
OKDymABmV1ny/+wxhFHHz6vHmirb56/jKIhjBUcpR1ogrIBellwJ1v+p1Ng79mVllmlv+LJCIpVk
8Hz9h7hOJab6VBR6KjU5bgIoJgQIbHy3nnkYw7WGQLnhI9v3ReupWblbooy09uktanuB0LqcdoLS
L0mS9LLtJzrmxu/5a67F0cuZ5IA4h5SzlB3BM9m2uf7UhSe2dXw3EcRmu4RImK73oj3cjmfHNlNx
gFJR1Zuc4wHaqXTCx1u+U2YaIf6K8HK3UVMVLwZAOimDAMdiJTBNYpLCqN05zYGE5hjRs911VO9X
7h9shH0bGXYcVe0xL08ZH88p1ipKMOh9JB56BFHY+6bxuwuzAND907YsYvEgt+RA/5TOshB417mx
QfL8D7noITt7dq2x9atVTW9gKfLbScH7D/2sOu4p3lPMDJbT1WWlf+dmpRuIR0JRZDiCsk8Z4wD+
6vakqnNXOUuKOhjgAjl4S9ftHnuK5iT3WpKZiDOT4/QXupCXRJbJEYeP6fajZb7jUcfQM8MeLN6t
+I9/rJaYacdWiOAULcqGEnP33YvM1ju90YF1ulLqeB5gZ5VzZO4KwWXkTzE5rZnx4j2+ysZvd8/V
GN1PCrqdJRJpHvttklTHRFGJHTtxNVUFz5ZAOP50EMv4gMLP2p5FrR+GAENT8RdhzU1Oophy12FW
H2lMH9gJRfgT3Qc8t7pvZWPd97Cmro8yLB+yXeYZuk4MA7wzYBE5Q8X1cUdHgXOeM2+ADVRckGA8
CNCI5psgOBmZs6FTvtZInbV6EVCXR12lmezAa///W4h/peG/isiZ5euanGetafiIjgzC67SsOE5G
dF8dzkd6NUmaa+HIe3Wv5kz/dYzqMRgYNQuGTVcZps0+87Rh08l60jQjFhN9F1e1sn0zoWdYajAK
NXgee8X+WfB9oepxKNv882KTxdh8b5VlvXEaj5svU2uCDt2F7o/67nLc1zyO7adpJ3ACzgTG9kaY
FKP+PA4IUU530M6supMyT6Ee21tZHrOpFeo+udLPckGbDXS6AANQ83yQl9O7mDlABwQu5ulJLpPY
T7L2esXLk6c7FAYUBpSMuTo+yC5kuyWhnZK2M+K9di6tAU70bKjorT7sACophB3QgQKSu31dby66
Y6hhW76TMIl7RJQrOZioilH+/DndXFHPy2iblb5NzShyAro/7DaRQtsaLMfGfu6nteufR6/w1fu/
8bKVxfQhXe2/61F9T1y/r0YOnZGDKNmlu08KkAF6kw6GliyqeFh542p5yEBfgRwtx9fZxazrAEdN
TPu+VCSlJJBT+RZ8WpLhkOQK1UimcOaWcQAAFnFBns5klGRMR/2detod/L/sN/P+vfhQXMsiOG/x
zcW128QhaXOPKEtaEM4diIe4TkO43EMNSjflttLXxIqJr5g90nKwj/5U02/hm240FhC2qEPpbj/N
824F/8UN+tQ5GuB5S+LkRn5pyp9KRyGzR236jpAZejJlEsiayTq7HwrwL0S4wclso6psPXc5u2lA
Pv1thxDfnC2+K1+unoMt7vCqgquGaIppZdFCzruxNoCbx4/AsokMdDh/rRc8dY+upmEnMbPF2nmP
dGFmZTaIxaTJWcq0fZm9yMVg30Z/mfVyN8tnYSfrqOPSTfIGFep6SY+N2/dgSvXosPGxqi0Cj1Un
x3vQP0j6iMSB+nxVD6d3ywoboBFCZ30ryGz21EhS0dtxh0BAipvq/AE9gGlbs5+II1MlBovzMoec
So+YwwxzJjpNHAaU3Fmhrh5Kh3VNi0ZMnhPRwKnLD8M8xQK+GpwTj5dIuGb9ZI1NJfD9j269hdyX
fG1yvGBtXP0BKaeGuac52TqJ76ezksOpPsQPXKAudKRuKIAMY9H4Jm9eBPwVsipWmnWctTTezC1V
pvjbZ7btnC9VKgCYnMezTBIzJbVYU6avnWb0dY32caZW3UIy7MsqgpaG9pGyvlL/w4XoV/ONWgCY
ejA+T8otx8YyN9ijKk9LKI6boQr2JgGj+c8JdwWXdmd4xAxYL4Sml+QT5kMEuYUFZrEA9o8vP5DI
//366Zo5OhB+HWPOb+jalzGbcgbOib92YQYSJ34gWMIFGYh8WK2WiXzm05d3SQeDy149QwxNt0Fo
4rVKcaX+ALWLDJ3dfrIrRLIrZWvtoxjFJySrSl8NHE/ebiIQpYJWZhUDTlKScTWH1wSgACLyS+Ay
yjsI2DPrTu8lTv4JrxAA88JyzOUbBSqBr9o4EsvmHQMKo7lThEPVyv0HX8EDkkFoqa8Tc6bupP6V
bycuFRGcmUzRMuEdhUeJlXKhWVmi6C7jpNoFrkVj0pGINzFf3vM1mZbjzAbF9yu6No1pAUqnow4g
ZRGaSjW5DE8BG2WVX53ykeXn5RWaaYqzsdOzkMt8UuYh9UnjVIjqMoDDPUXP6YR+yZBaBvSLbnhn
JONY7A7/UNPKRfzn0RB/zcusWXnKynpDpEWm0U9bJZ0QibQz9gvZHv3ZT0+LG3wYePNxG+4LGhEk
qAukxSP+7Q4RZxXZwCPtbWQR3m9OkaIaFTgBdTPsvu8DRiRKgTJdkI1dTZ1vH2kXS59CljmjyYdm
DD3DUrTIw0qC6qD5foHkll664C3tdtqUZ02xPQBwiJ59WNKPv75vKUkAMoKggbBa4F1ZO6u/bkDC
hXB7jH/E8YukKv9CQHcZJ50SM1Nl/VuNx2hDGOOCOzWMZJULkTQSDtggBFSsL+g9UD0guwu+q/o1
pb8NzMhqu3ouEbwqqUlFtwxnJKXTzd5mzKZs9mbg2+Fw6QD44CPlVgZkNejUgR8n02WY3b1HinXM
noyqLXLkOdk7UGNqVrhUFc16qk0sBt0gd3eZq8/5XSTknlEs2zY5clUB3zSUXvx74TMWthkkz61n
GDaqsKSTFPTq3VLS588ad1wYJYDSYBzaEB2PLJ9onKQV4XDpFeqrknOckLRo32epAXpW3VpiQ8qA
kYbFbwlYVCV7/R64r5NxhCvARMxsaB9T7+b4DoL2Oz0Y0byPUYrMLsnVbcIRSo1hGtetVYdQioNs
GWmEjIBRUOz9mbRrQjI69OjbpG5KP3AdiuNN77NcGfcBy1/wCNTrD/m4JM9+u/BcODAjjAE8Q6fe
wWZxStMEq7m6zCbmQCOqJ9F6hjBuTlZhWWnbg7aF5RV3kEDiXZHC+Gy0Xr3nI3BMx1MiAIduMl04
3Z4RFILAqDt/WJGHHZQIkQIg/xTuZ1PqB0p/v0Vl0GET/lXtuteXW8ixLtKSPQgRYzlsXUK6C325
9XpJpXQMTueGK0oHLO+P0iu4qkZpsx0L9fbVHE+FK4bNoYBOVQYhHUbTU2yGzWHfyD/qccSZygjT
eF4LoYw0qy42k6mLIy65qFFXi4mzGX0UO6joMuJ9nN0Fv2SN1SFtvFZtyBwE0h0WecV93BA6oH5o
lqqxfh6miA0PXLoIgMV0PTO9uDy7kPxkwe3f/UxmW2pQgnxysYStYcvDKSMakjbb/w2vPwhsXwrP
vb4lj67SSZMF6tZ1VbMmRl4KkBsjALmG0L0eyQk9gN5V7DYPterN5wPgzYCqeLg/lRvM3lk4M4P3
WzmvVYqnP8p03ixSJFN/6mF9yQrtwHVDrTyasx0ydo80s8LamY3edNYZNbxKyXwXPyNwtC+PO5YI
1aEAHe2x6sH0tFrp/LOcgUWzR+Tjn37YJBT21sMqgwh4lne8grAGBwyU38YLyS5XNE7lzJwxvtpA
ZApKBnxLLc96tI5nkyWd+WBhzv+vh+wYg9u8DqWiBDYOOEvDHCHY21iEn3gukY670/XwwXvuThun
7/+sMzxwtQj1ZL0ollAt5i42pciDsMwJSd37/7q5oOn6hlxMRtqHlKOel7b7lc1fkDkqf5NRlQCA
CcSjIJn3Bo3flMHmkgCACd3HJD/u8/lQmpeco04IzVORLtKYaUfOXVKDCVGgkdpc7B3FhIz+7yAf
8fmDH7QP7Wk0Fbutu5SkC9rJPmSpKNkKTTKMpqAf+Ztp3kjYGBK4ii7bM/BDZ89h5wf9S6vmnC06
YwEq/Dx8Iu0bD+dvu4SdK5rmg386sdXjld/+nbP7wYHbwV0M2pRECRbwff/JrbG7WCG07LiEVshY
Kngs3vXrYGuIOySIMjjHLsl8eMW62QvkRLwMQQRZHQhNF/fUr+25B4VrGZXIgVLjtmN8YVHDdD0G
goJgo5yayZdVHqqOh5JUQDaKA7XuSVYScInD3G63Cpjr/p9TqVwRSwRxzr57CczT89Hy28HM39R3
f7eUj8D0TtfrFx5a01fG+z5LcQxTJZUCTJ8gYM9JDU1oeOczmpeEv45wzlK2JvImAFvyrl1t9C4W
ov1lvCOkqp5W7iEqE+1ASvsA3rrwwpL/mzEbLcRrZ9xeYx1o6ZM/qYqiF/uOYbfAZFTdIZmgnlY+
HsEwaiR6blZHRBd596jUghhz2Tp7mkh+Jamzcc7o1EqRKESjHvJb0LpewDEnxAJUgEGvcOs24QSv
gpY57Te12C3sa/GeEm3VrBHG7SVyfJF2P+xMW0ARPbDm6lxVAKVnfKmpP+YGr0XHnrP0gL9Pmxs9
v0ZcpwODhsQ9hN3agvjbnMhEsG0CcURmthUjW0MNmjIPhkoyvLzbmukSH5uHA/BidAQlFAiLhxDV
zLBJgywa5CTJSl7s7wtPFjq9A/dci/27cw7eAQjfrv6JBubiywOlmkrQyjvgFDikzLJdKpr6ckBO
l+XC8AneojPLVI9zeGlkLGZQLkK+MiEl9zjbAc7ybaz8tEjM6nrXder72OvEYLqB5o8W/8Q1dGvH
EeAXxXW33tT0NxZH9S1a52jhEpKejFzB3wNU+cUY6CbMm7mtFYv5nomnDIMStwQJzJdFmA37l36a
g0sjI9uCMPEyRcXvyCFiOC9sTA8ro3KyQvk8LaZ/OpRJGQ9ZyVbxSvowup6OObhcmfMvFUQsarYv
U7u/l8eLLBuCamCINgLtIcK6tdZvObwOeQ/P8BqfEkC8gxRUfhbrjVpJW9rKWU6+EoCbs0CVOIxK
m8LIOlGdon7eQp1PXbq6xIQ27No87S8B4+XCbXMcGWbF55TyB3EN828jxbfqLQ0MpjTa3l+z27J4
93SGSL8j7ki0/+WJgWgJq0fvhiFXJccZnG4dbKoGTWRt+FLut4+zkyvg3PnJHBOC3wIQFTCsBeVf
Mu/y18UX9v7L+LGfGHKbaWCGvXagIRdNjYd/JB6J8/gI6v5u85hhdcTcImGBCuQX9/P39xOdRrFi
V92AubrTdAWzwKS8ohIthursQn67MA9Q0x1vr0jyCRemN74frLI3ENJKlESo8VkZqVlbuZblVaI5
YERNnqAY1OWRYnLDw3cRHpeVL1L0FUNdkYow08SnIC6lcL5UTdMylf+Q6FL+q4JqqKyGt9QrXu61
iuGww+hT1mhBaZWBQy/dGDT6ZkWk9K3RWG/FlLHneLG8SFFA6AF4c5MOAqGEb0P3vR/C4U6wBhgf
2A99HU3wigRmm2x3UiUC4irENca7lr7aObS+MuR1YVhXmSQuiBYAb9fo+BHuZS4K8ynDYi8JZ/nS
att+k2jObrEjFBLEhNWSsm+yM5UDbZJ5DKOyYK+fDEoEakvDenrQKWrVE/3p4vCqM16MqitmPWlg
G6+DG7P9Ptu418hrXvvJ1GS3eztRFQ1PAGl4y6yyJZYb52xNokPDILCLKXiiVt6aVl2A1Y4OLzQo
QIbKdLt35OsBcee3Qh7Uyg4w8YD7BXG0m0IW5AN7i0NoDEPGrsyqmG1aO8qkBzY+/4vEKYpJkOSj
8qm7te80WF3O2lCvZIIMqMUxXrHFitPf+v9Cy6TpZoeLNITsqcEdltw8y8XnGp0iRi9+9qUQIYUn
itXX+/D9bX6wbkQ1mKpG4uQEHHwbV/cbduP2j2rLKFlxFHVYBiIL1lQCCbxRAHpSvEho4NcxWPmV
dXNvHfg0+xtB3afrmfbmdEqYLGo0sjCZY4CW0QNX4LVG8aW9/MNlwNORVN42tmLTwL0u4LLc9IZv
K1Ddosh+SAiy4P2y+E63iatotsJpD62lt/CDHZ2zHx/QARxCQU3zYrenYXqhWE2e9uJpxPNaArNP
0cL9d1RLh20OvE4rPcZW2AqhGXsowiBjlb18Hb3y4YTyNHcr/CW3fOV05qr3yfd8BAmBrSdIWdMl
45qhsi39nOPYd2w19NNyTU655qlTtkbTnWa9OKq99PnTzRGwm/tf9RntuShEWfiTqjV+ZHUkhGdZ
imrVtQBp9OHuXFO7/rNGJhuvL9q6PLKM1870XpMKoJ2hTWmQYZ4FnBk+I3/Pn8bhtCLqy5q+Cbb0
nXJwBlPF6hrQmwVNiYrUtjkvNJfZil626ZSUC5LhBvbiNRPsYj9yWIAZPOamyEQL+n/3cyJ4k3RL
W7RIm6+EnGf6d6lLbmHR3nrg20l83kiavcQXbvXfbAD613rotJiXVsh7gZ4k9fOMzJ/bekVUTF5u
bnrMnbZMWRoDO+lViW6zZXe9idfrmkP7oF5cVtV6Ne/ai/UqqoGZ8GgjEgEo/MC/RpzLITnBVHa8
C0mGARmly/qwq6sglJibjY0huAWT0vfp2Eqq6ncdZWYfn2JrZs9gPogCoPnvFsU4qrUJNE+x5hkv
rtHk7oSFI/1Czkk+ezqFzpgAYBoNVyWF63EAawzWla9pNTjs2qW6b5+URkQYa2BQ7PtPE3c8E6Fx
dxmLGpO2B/SQNPqOSYVVg7rceFUHWM+3tSuFMwYKOxKJlmjYzaf+O8y/bLWtWW+a1Tn4t5dSkOlq
2D49Uh1aS2SDgaT+4TizIZCwPcfeeu1CCaE1OYpbpmWw1nhqms+jElx1xoku0kXPDYW+ZqCE8vVx
QRp3nodF334dt3schfxWAWu+/4JjDvGjlgElaeRUQmGURpDFLRSTgcG9ke5Mq6Z3Y1kzDbjcF1tT
XCegtlNBba4ak6wKpQMkf/K2tryVd72JWANbdftuHn6qzRSJ8NIi9/fdtfjAE2AiybSyufyhq2Cf
bU3NP7xZgyjPqDn4Ld1HhboOcuBr64l+M5pg9XlW53v4lo4Kdr+tZ7w03fnBJA/FC7phVFMo9avZ
ZQH6LP/udiD15N5dfgAXW4JnbnnUDfqvVzc+muO2MwzPOF+pJoMEibN2a05xQsIxCxLIamjh8gn6
2t4gksH0MJgZJLlF8lk5ZzIrbD5+AKuyJuC1th4a2AevG3wV3P/lA6Cqw9S9HFZmZrsUFJWK7lfn
heifz0ZmUcT1W78NlR6ZwHSuqwzLnCIwfXS379Yy4RMg4fyalPAYpj3h3V8iTI+OxMhfVxbNGFQ7
an0IaUVIKPXfuFltGkw6leYMzdL3T7AU0izBANCqixRvU5UaObvBUwSPC4c50Zoze5u4sadOmD+A
hrfHx7Rtcn/uTMo951TO6UrFvqvwsCF91zPs7vWpizj32HvFdLUnwX8SfgYoiwX20JXG4v1UgV8I
+iDgJMdg4yCYVFUpsPvxnOevW24hZiJrroVT68o/cdtUOrMq2LohKqJzD1554cxCpRfvOGmWlKjN
Zteg27eHh9czTXEusf/RnHo0mder8c9Q7XkYO2fB91p7WyLOqfU3g3znG4SvSLY9TKgapo85TbsD
vZ2YcoxycF8EAs5LdYn///abDO491QPlwQ0gxvWIdfJsuyWKPq0NhKNx80s3YFP+23yU62WHs7wt
zD+qJup80hPJn9C7cUm5RAZmEy1gt9n+viSM+jpPzd3fSYY/1RfHBh7tgohZn5wiQ4G7Lm0+wPQR
F54ahe2o8ZWQLMXpZDVBx5iIxu2fHbKjwtxvgkfW5nxGOYjP6cd2gTjhfODTWtv6COhMDITStLgd
lJYdGwfML5Fhpz8nWUWV2PeZKtbt/TUsQ17XQNkUh2Z8GqDu5dxPS02VwnWPbzMyzmSSxP3p6jUr
z1a3xWkQasBlhnmwlaB8OWZ7PO/PUIxlA1SnxBUe9gL6GHT3/DP6tJ422V1N9ZCoci20mx4fTdCg
0N9Q5uXQBuGqTFV6GZAV7eaCx3rW1d2sjphsBL4TQhLoFZvoyvHAXZnTTRQbPIdVvo0Se4Zqb7EN
aXno4POnIJZRTms2kqr6fHcgowZB4nQwkLEKbczUn1pNTVUIlye3oRxpqxc2CbkmoJ8wKpGYATS/
0KPYvKIp/5U42YxfCwWmCkfCxg5CIY8X7elaVk7/rH3l2Ue/W+e0y8x4bwINzaTD9FwkOlo1XTAu
ukDRluFgmZKsdVdXxexFBr3A32C0A+aCJ/ImGwuR2bFXP+aCx6ae76rV6zHwLOVxyP1nBjBY50fb
LkOoyy/KoBw7P/0u57Vj6A/5wNtYkPslMApz/huu3NYdt2hDgTqcO3T8qAxu8TdM/FTSYomQmb1y
5Wy+YHR4Wn3oDFdawWDMpkzA32I7eYmyw8vThVhn2T8BK5S8c19YfaNFT80YgLR84j6yg18Q8XVL
BBNrm4BZvpE8tXWRIjzUFBq8MzlZEP21MDionrSWnyw8DNtqnilPR1GSahlQ/loJ0c4rKhqR8+Oi
fNMbu+SAtffjUcNPrSaJn7OHpz2svq93AH+54xTdadRQ5vj1rPrd+BIAB4+rL19nBLtzaScKsiZ4
oVIycx+PpeZNjRlheKxGZgSNFWKi1a/8pRAkqVurvKDkCTKDxTo0g6yr5Mmyz/pVZtzADjCGpO0A
Cc1UI4IMl6u8QPHPYF4eBxQvafvS8jeC2aaxdDPGrnsd618Bw2pSIaRpKqCejS0clwvgxyLqtY0m
HmEXD3NpiRA62Gn5DmGdnzu1Z9YIvYbmY4hdkJUvG8+HzUoeYEtT7X/v4iklEaW208I4VbZ6ujWf
Wh3wHmm8LzycdE2YSR6Er4D0fCcGDbzuBYdln4JShD6svZIovj4pJVw0derozLsdB9balJj2EIHd
Cz/sn21vDzSuVSQV0FM2tR5IpTMwFxyp1Ri5fJJeEGfUKKAKFn2Ix+hjP3yrGveHhb2AerzcxEgJ
tMyvxuHxESl9lDgJuR3CG4kAAACHAZ7taRN/9cK7tvktaZLIvmc83jZ9mKgCziIMAPBrZ25Qc/py
xHk+lhE3BOz2PcpPfU40rWmv0FF6aPZYx6ekDZl+zvv39F/WjN5RD614KYmvwsLM6swaSKyKcRoF
oEosuKaxkUpv+0u+eTNYNv+BwPNr/jngO+MYqgSxmSeZV6QHY1KXzp+BAAABgAGe725Ff/2/Q2Tw
dVR1LGdTRJA8CyU7PXpuVIMYANwX1O008/vb1fyruE8+s17WlwJB60rfkxF5/wU4SRjzaF4SD17g
66KDAOZwhP40rXJjdb9EWX5K6+xzVAkKQPvqqeZ2H+IZWzqQwngc2cczT4KeZL0U+hxSW2sqssCk
nxlFmvsCa7xSx1vW6M30t46chi+ji73/ziAx1rpiEMhVZtSzENlrF2WOF0YAovIYfHGCroQDgEFk
nCEYR9pcdZ9fEcxsJP6MK5rMF3qUAnGUDNIqv0WCg8KsvubVuttSwYVeqnW0akSV+8nv7FZpdU0t
TthTEJCRVOS7GeYORjXXgL0fYy8H2cKxW/Ze3PnexAEvQjt0CKDHdin4gJ74Px2nW5yCjMjLLe7l
29S3mFqvGAby7z/iIRi2Oe90cvSLn9Vy4H+8/7wJw8iYGnatREWtHuTfkmL1DPebxx9PdbfYb8S/
OnaCh+b9cZkHMMI51Vga/tGY3qmmqdRXrKg/M7jWwwAAHSVBmvE1CC2pMpgEn+ufgDzuUZLo+7ua
qdDIJd7bSEfeHtJTHeyormPmaLSIQgbGej60jhNzPrKfCKhEuzsIxJi+faHvoZ8vB65RUMaKyig5
Va2PpPKl6ruW0p8XT04RTuAe+R/GoZBjnAMwnhC4sC1yoVgOP+9+Lfs5zvqKKlTjDbLeDj7NdmWz
2WONwW+Xf7SvrrWDpiyw0HoX5blpUnMwrtUGa+ZqQoX66En9+v2Z4RQgLnPpPaLHhISy/5nZU6ZM
F32NCV1pbSyYQqS8nYQdX5MDdEmhf2Ly8E5IhMBhBVLHqEcHR8EXSdQGOmuYVXctxX8V7izYM7TM
WGBhTsXG+ONaJ3KgsivQFvOHqi8RMC53TMMe6+9SALsmQIS99oWTP3f5QnVPXuSmdsJQoTrB/FJr
Ui8F1zwKbrnoXhY+2117LeiclhTSSmWMwSQpQ4hE/ins95RfVesWPPzhSaWM4juW+Xa5pp4/vucy
ZzOha/bzJM62V8YMb8mf7dVsfcyqnZPC3+JsZoRjuBmaJEW8yR5fA87qVgp/qjqAZpsMlzCeW3tW
tSSXX05Nv1XAjiHU1B8DxIFz0rxznqPqUoujgk5gL0LztPrkEEVhT4xrt78qhJtRgvLnX6r9QgSH
PxHjcEGv0cVHYXUMsD+ZgQZgYMCukB2T/sIBcK37mOe1p5WGBRvt06sDgW6p7VysN1cok42spV74
+oKH16xaMWuSOjOAR3E7qh6mP7REx/Cnb22XM9eHneXrLeMifxLFHUReuYdNaxxX1b5XECpgLLoc
WVoFvqUCOx1WzRQ9P6eWv5ymqf08EbKGQnzUlrm+xwRdOlSIYHHu8Nc4hvf8ySRF0jhkOpH+nbyv
FgRml3uWEP2dT0EAnk+LCvCX6GtMc3yqxUz2PJTrQL549Xq/lST3oaqdXMM5LsxHzsxwAOXpmZyH
SZA7n6viOH/Rmxtb81v0rBfARDmt1mi/C6g09vBOIZSLMHOGSF+229CYnnSc5tcnTxoL8TfbSWOP
cL0tXR5gq6FGZ1FPf4dUFSTokQGqFf6L7c9AFsVWZaHPeDjBTepUgNcUexPdFEejcr2+UETMFr22
akOg/2MxOrkBKh9qfK6OWQhbpTI7m5QkWEIeMnct3CDJc/LL1ZdSdiTen8+cvHLSjEr7pPENT6xp
38Rq4pv1HynvvuukeUsUYru+j/uCZXOgrZnx3nnGUKpDdPevFXLpxTl1R/QU/BYfLueXhUM1gTPr
inR1qHqLRDHtkIo6DhkT2tKzoHJe5qEVpsotcHeGDupVI19My2lkhnibePQ4bQ/abP/QpADuenWa
hvwi5A7fJXtxp8cik1Yn3lXUaQrsJzm6RQhEbBnXfaaUsQ/+vr/LqKhcULUp1SFF74Eyk8XvO/Av
u92zFZuExf5tDip5O8z/dvJ1xSlMTKdHyySR6FvhPtBI6jpzQGqUjWsQqHMjVVXlQqgo9Skw9qVW
u3JoAlvefu6BzJsjKpgnqRaJ0alq587yH1ophFniabN4a4I3tlpkTP8vciAchBsTpClrUNQ0e38H
vraD80UPx9PFAC59eI6OrZY2matsw/aqlEVJIliwoDABsNIzQcy1qutKoqRoIv6qBBxX6K7z7laL
tnMq2nTGM1VWusteXJdRKKWsMwGQ9w5/pQjX4O5C2Fu1Jw0WxyHPQbPKJYR6kRVMzwzLsWvgDqWx
y2oKVPuaB3p4bV+GbNsCoFGIr0BuUBTeMPnpnsz4jwq8yHnfavan9gsUWDjHrAC8Tpsqkzz/bl4t
LTazxwzcBwjsjbLtGwe7o1B5Cqido6CzG46JDu0TF+uOYmIjfsw00WsdEx8NtvtG0XpFFlqfP8H8
UwYQzx0pC48fQnJ/njAKw36O2MRVS2KzMA32Ig+7r9Ep100z8kDrj9gCKdNHY0dvBaxPLo4jAxun
Q1wWnWLWOcDJmzx/KOyVIcg14K1ukKJeXEGxFYIQ3vuk7cSSigDnJpMYnDRTfJRXx2117u7pMRpW
Pt11qBbnJvkdz2CWwr9utpNuCUAUwjhy5BNSsTvffeOwUnGNksjZ0x9+JlTco3OuGKDk6s6hluaM
H/eS3PaX5Lw1XLhqTTkBzbm+Dizw5fg5vssBxREraJXqXsYTkWPv4DEmVGY3ILADfgMSMKZmCz+I
xA94x4DIeBKLG4MEWUO+QKWnhXXBdkuxVqIkFS4ssGJQamP5Pbp4+aMylzYeIKoxqyw9i1vwECMf
DuvPK3QWf/tEpiNcZLMWPYrw1n328iwehULfl6jAthHCnVoPOyv/EHkDeppwYvMZWWtBy5fKYJ3b
RcIz1zHnJyrBINj1SS6C0se1MtXeTY6/FiZDHKKl+VXeRrVZO07aN0dUKyhXGHndkZh0U6SYfp7f
ybEdUzkWWDUNGcWFatJQba/d22BV0KrUdp7OQG3cTY97jMZiPie/atPcBYYyNUiNq/d9yr7TbiHC
VLPtaOe0gbj52uMKjZLWiyQotBWeIZPJ79/8dWEDKxAnPL0L30qt3dG6X81IXea2TG0lUwQScmoM
gC1MHHqnKIqmOu5Jgrm6RFu6/Jsh1EnM6hVAikRCF7lJhHDDK6PjfDxJ4SsrKlRVcWHKccBHxeRj
autKxy4t3jPTf/sCC3icfVDnEBrq6PL/iHOfaOHuoEsmGqk/MiilZFZ4EUPy3WW8TlmN0H/YTsP9
KOrGyPy5Owz2XlzEJ6RcaYWeg/QXPgSUle3+YS037GkjsyrNtddTBeYfoK2ypOLH61WT12SO+c12
Kz435lHDeyWiqlkZhx9HTwBHLsmq3vFSs8eSvqT2ZwZF/w9gFFn0LHNL6NA/Tc3wXouXyDUad5DH
7CTtbvOv3x+jOSybf+18NtwPIsuXXZQ0eLkcRWSK9U7ULzruygnRgseRIoxghujPrwFG0vxZXR/J
5Z1qMFth9tAD3N3wuiFCBa6pbtDMSBcRIMTb6SxWdj9qa8IeB6jwTbFUV9E7KWPgtR/QfjV98ZqN
FOzMNdv4jvAP+h5yAbg8yus6C8b2Kl4SenaE5Zcg7yV95bdjobhPxYV6h076FfnpDanQkKFgIwWW
nD6ySS9mVjX4Cy4b5oSi7C0/g3/uugYoB9orAclLR7dJlXBq/xS7QD3XdhsMwvLewI6nAeZjcvoY
u62YLbrHMHdW+PoNsuyuqFwrU3osF2WavnXaVuQ4qwuiTO/9lJ24PBCDNuSfR93m4r0+YEDhIEIJ
j0cX/iwZR7Eb/Mm3SBs8BxsWTd7BpTmv73HMfctYaxatZA9wSfnTs7FziV6nEh4571xjRdRQVPCw
sYZrsEkHGT89RfPNYJrzMQQTQAiOXr9PuCF2a7SbmYWIXLKbXzZH6XYFoO6bS5jKoTuuA1e0RNPm
YKk7dpPuHs3q9qSmOL1WAbheeLt3Df6PhHeXXHcb2CodTW3PKw/4b+CVle30msb4eTe8aSF0cgyA
RReC8v3ay3nWxLagVwPUyP0tPbSALSqkWOUESN/GC1OhBj9yrSz93jURyoyyCKH5fs0yMfPb2Hj+
lMkxEdocFUcZmh+kUYfj1B6RnwWxSTsgHarT+Q9ZgYAyxPgsoKn7F9k4cl+wgXF37+jdUhh1zPcf
j9ft9L86TJlga5C1QNKCvszku5fPoeCV79NXzV/rgDyrBe+W0ebxHDN1DrTAgXsFPWBckmq5V78A
+YqYyLzwzvBAKREaDE6lGCRqIH67uOBwx/rMVFIQFUWxx0L3siddBov4fHXHdlhkYKz6PuTDkJ5C
JKDiCVeQglF28dvH3w2GshGc25Bv4uCnPCbSX7ICLkaOOWre49HybXLecHIVQggRTa8tVeDLLnSw
xn+7wN+GOO75F1fCH7EKyX7Muen7zo+Q6is4ssm8EeR9rgvYdPmlOvCWG4Cxm1TpgeAwGQzMFOa7
q7P2A6l+BzmwxIUr4DQu/1oAqBeKiuXPxMpE7GlNA1Jf4db0GnoLdUiV9c8kNGL01nmx+o2feq1Y
wIJ0c+f0ScULuerBZRCca2nBTVi2QK/Y6Bw4G4w0m9Gq9DfBIZZlKhjhceoRfj52S8gHL8Zz1e33
5e9llL6akV1Xyyvr+dJOCy8fhIWLxdK+k7SK21tFBkqyMFYqoUXab6y71gyM4djJqa0CUlkPfyra
597Njc7JTV3j0qcWQ3sXI7PT2NrE+MKUL6vrMXUDSUxGKJEAFGb36wIYDpVttEAzm9Z2vS1tFMS5
Fz87QebZ89q4WPaMmCxpeXy8Zv747UCMPsxoJRAeoq0pTmmylYuST5VPAWz5ZRViWZhJ6OZL4p4D
tWjRyhJnlWcuEebxypCWBuT1KB2JKc/lMDVDqSHJQrw5udttMxCa16BXZM2v4rVNzdAUZMvrFI9f
SAHjfjErLheRDXh+zDt+GxYMSo6oqlICrT+VQoeNuhNjLWJZNYoGQKzgI1XYW2LC6GfLX8/6ieNA
baX0h5wiR4Uq5BWvAUhcw39UE2VQtOQwq8Xo4SfI3uiKTEhy7qYXl3fXPo35kwwfMrF6HbrDrKUk
2Xoj2mm7Ofb+N8FH31Esz5Y98bUKntOx+FUmEQ+CsHnwVD5g+1AGbVDemnl0PQtWJ4oEIFPn2Fms
JbWY6fgP249dtZ79GvMx6EFD+1Db1n/khulajp9s7ctGiombNAkNQlffmwnzKDz1/2CO8ZewiynF
Vi8JuTIdAzOSD/GfXdrS7feIsWKgiMEXlM4XN6PcAtggjWCtes10hnJb7kxu9Cpcf2PWeY8EHO8V
clRlop9DPA/+kfCuWG4MmlRLVnTIwKke1jCo28zw9T+4LaWyDx/xjB7njz7lsTCxgXgq5fZ6gfeG
CRaBDjaKfGAnVC5n2K5SuCTYfuTzIp7kOQkPoY3MqfNDVc3CFh6eZ4EUgzeS0RQvGYe3LT1n8nMa
APa2Os6HTaEoPoncwUbz9ok6+x4qTSt6vyTJXazkJ6YpdrVpH1ZghjQFDhWzs3JJmDm6+Imq56H6
SDRNijUicUjceCHrF5B4+3Pyq58soHGS3q+58QbfSVQy/sX8Gpq6kXqFEiEvZFsWsWDvw71DcF2t
IYXnpTY88oH3FXpZBnuRbA+/7sxwZ+SVs4ixOt6BQWsPadj424Hzzuj023kJMKV8fGFFy/RhahXD
HzJsy2pMLUaPjG/xlyfzAS4VrZcmKAfcJm9q68Z39YrdN5Azf5cUGaVslDQHXGhxjF6/RQksvWqs
nF0TIr8YhWs4aMAqHSb6HDGXZ1n+eva73MHypnPAIBg5KPRphKntnxo/xL23TJID0FR0oZ9mf6gx
ql90ouxGBsCAFVrXtVestmqEB7CM5VPaKjMIuxbcAT3Fp45RPQA7DKOUx3tJkOxyfXSphEJK9zqz
7Ip4boP8NQRomNDG3Ijep9aUTxQS3zowFlU2EMCXkDfIbxyn4BJ/rwDqAZt2UaQECtYd9XnhcsRy
3D1//DSciWggz86daulV9vHIB5aATuS5i9kXbh2o0aenYoNLVf9g36MGXL9JGvaQfXoVo3XM3PSE
KvyC5prW3bFMzFzARJmL+gEmpk5VxPHQOSsDSZubsoVIyVzeI9NlvlDiRZYm/hprOma3M8q996e9
SBC7puRVXifqqy97+AsL+oH4h2U5DLFdmB/zYrXdPt8A1396TlMDxWfgXnaTJWsSJt/FLSxGDVVi
AT2nTi+Gh4ywu+ND7MQ+2L+fCLWkKPXryrGtH7/qEst54lv71B5tSQVUu6oZZSNtDcsBhHR/Uy1f
tfgYMqgndiOJOE/+dQHANrotyi+6ODLeyp/yJ0gA3fO3rllpZfJYkOyXq9tdPvTVQvkxQFKIszUz
ZUa5eJSKCbZ/X5DWDncod3YQYEJB5gyYuwy+w9bsHef2VLTZ8OJTfvQ2ngGSlSwBSGSyUOJ7IvIk
ugvkwNy30y1e0tmaaa5Sq2XrZiYHqQMiOFKSzAtGTmMCRVeHU4U1lQTeWxHK2n+hYlctZ1Nx71kD
CalP/lzhjHWr2I3mCtl6LbNrwtRsADpNoKF0Q4c5t7msdW39/A8yIZEjMyM2KA0Mc9Cz96KgW8OR
aeqWMd5DvYuuWInwrp/vDwh2jJfkABoo31YFlsd+7JPJ9h0nmtA+QbDtJtPQDmYYNb8kaKywXtUx
s9fjZ6vdu1kC2At91Ap3SbH1lxg6hqcVRne808DkDbQ0O8fdaLvhXjgmurz6I3l5JUNU9WHgXwXA
tblMhFGgwDExiBNUfPJdDGNWcKG/mhlf9EYE5flryd7jNvBfjKSmWrgGF7Z5xTxEmGocyGv1DTv9
3Cga79cSHhIaoEWP8BI4I95dWGYYdocowrlCVvPvVx0vzCEMM3yVlitLHPEotpMbwOZZR09cUSvp
0hVPyGqgtBF9QP/XWg1a6uo7CypP/3rtre89wQi+8l3iuiP9YM8BIDtE+TKAh+BksUneC91OwwW3
4m74g8Co/e/LxTDAVKHsQbn++fYhggy0TJO8DjOiR7GxBkhXRCK4NPLpeFdNvl3mHw7hbew8vdMW
MMdjcMd49cUU9gpy3T1Itd/iFcxX6Ky1HU6g0hg/dt6h2dk4E/7Ot+yDnPAe/S7MQTunaPIzSEji
RjJuijW+dt5sQmp8+opFiXsddzdc/YblDb+MFcHPG8d6H35IMVL/MU9BnDySTauMtylaULoswkBe
QYMou+plmRyJXcbvCmtgmBDPjTXDiIN5HaC/9FgQ5eJXwfMiafXmG1S+hM/XiHZDAJDD5+F9KKof
YhBHDQ3oYn3qsrxHEcVE9r8EqXJqizN466pLtO21EPsW8ObChO8xvvlmsnjYivTCq0Of6vuH4102
u2hGpXBJkizOSv50CaILSCYCAtLYQbG37eL5ZwCqU/lCm2fJb3LUhTeVwH4AkAQbzkJ2qcY/RUrK
St4gqkzi7Wct7LetNNSRcGdJnDptqPyKg0+o0uvqmfJzO2BA6AF6oYL8P1faHO63pWqhQY5OJK5k
VS7gsIpKanwj9cYBuRW+/OBjCDJIbBNOLiYgBwJlNa34udjFOBC7g+Iwkf09qkZipAPviQctSnjr
tNuoMu6zieDUikB4tNU3ZMweZJjka3iEKSzRP6Y9rG/kEmQ+n+xoSO19twqpzYoC9jf9t48WNbPi
yQZwa99N6p+IW255pG2cWRxgKtuekn+/K6GEwZ+33PKrjsL9hdJowNegcAGYtf1A9iHEq19F7k4t
gdE5vWjifkEI8wfqTQ5xfIRBBBVgzipi/a0U5vx+a6jvwLGcUyFlI92QCjx/VmpP5mz/tRoIThov
RRqkHbEsEia0G5M8ehHD/3ZQtf8cnc0qfCyU6lmz4kjEus+qklfaR+Ip6MkIrHpCmP6b141nEu5t
RgauMtenew7HdYANEz8E0UH8AmWdJNqlMkb6549Sm2yx0QGUv0QF03UjaeEG3lXgclKAmGK2MNMz
5TbEaqPEUpdpbZ8DkePwzcNDi++FajmR0GfO5wTNYD7IpcMGmSLYT83nmmluAuyyiXfr1qCfm+B6
8Eu6Wocad735StDmhMVJoRW9tkCboYA3IsIFFY0XE+p5rhggQ+vGLAIqNv212zm/fCCLOzXBDGQ7
6nCQGbcNNvUV00HPVv/0HecDyKP28YGBKRYQ/ALw7chbRZNYvyt/0xfw+ye/z2E+JsYo6JNU0g3m
HdFpY3qE1z2LVA4dkUtbOeU4E8G5eVLIWr6rwaBQDtTpGSRliqyoYOWZ1hhurvKFs4HLIwgKgevW
ZUZwSugCG+ziQPZADppaVXiJSxgJbeyO0gLk2iq2lcyR1tAh8zP3KIcTr3JoD6zjymEWdZDFcmC9
G5b9v3rI1rU1PajIC4zXNl9es3+ZFzK5sdscmQcHdKPGrTU9n43TguSpQ38UwXXz+wvGbZYF2rGv
wU6vUvIMIBzES5VMPLFUy2TnX2EIOG18Y1KFcnfd5Dkrag2iRAZGC698ysdAkoxwC3/sEP4v6eW6
yFdUi/37KHIH2fD/KpB2+RiOkNwxNn+n30RENfIvGbDTPQRfU3r5f+eVPnCh7vcrEGfkijzwHD7j
xM0Vr6o/7NlSIbeAFkJDT5qUIwPkJgh+b4BhP4nkA6sTS3vWFfTEAtMxgBEMNxc2gQQdr53NAZwE
yZV8ZLHjv2kw2EGpTHtcAZFfozHDdYJa2XKF++W8bTK6BPnzTO9GkiqbpSwXf4pDH/U2VrkX4eEq
vLlsnw3yJU/M7uUmt1dLl1bAYB3UaxeAAF1nC2kPX3OFcVpwEsMA3yxt8N034oqup3V3O93W0+5G
gKr4489rIpzmBGlJzsM/K/D+E9rJO0Gby7sqkMO0+MnCqbboC3wwsZHygJlS2ZWi/PBpfbFjoLCl
S0hWMkP2jmGQxuoTWYMY6Ab3jcV5wscKsrG9qJ0kzQXAuJqkIFMGzr8tZ3ZOxCRl/1EylDiDSXPs
OfgWZQS+RR5aSK9bAVKs0NYf+AmvVAhZlfxio9vN7k2XtiJUF8HqctKxUOBxT9lZRX1vCSN8vek6
2JX7HVmnjyGxaZiXsTcrc6l7sOGA5JB0gV4dBv5Vka2oK8lPA1ghqo5HFjn9Usz/T0wTPYUqrwP8
bJmEqhTvOi+fpGN0hHu2+zb0TR0w5Q9AgGgIyyeX8VeefiTxlmsnvGeuUvzFt/9GvPhHeLYLxMLe
TqD/gNWd012O7d9hbGjhCQ4HF19HoTWlpZDmvJYsGfGe6YVHMamFuVC+L8u5f6mSZ54JnoDmQidJ
MUZvE+RpF47u6dWeMhd9rxctFAMzkbanX89lQplfKNqylIhmBgi5Epvd3EL7Vl+Us7BM+Z86ilal
8QxCMa59szRRG6OoFMeU+hpZZYWr3ir08ZYoMz4hSSN0cMb0I3SVJQ3x7qUfm5eebRq02j6gngAJ
irSVWr5Ymrh1xSRPh7tyTPATwIAxiBhCAf42n7Vsl6jX1U8HcscNztqc96KN3xMIC9zHUZFTMCMe
VUeCK2vSEQygpyVkM4MszMASLhj/Fg7G5KaQycqmG0635bqzTqINooCAK9FRbsETnh+EoQ8sLCgJ
oVNJ9p9N/OFLKXMH9/y+5gJMxAhWjVMQZGRAO2WztlatVc0LMsgKXEuvEHLjQ4iJ7pfapQySCpdy
/TRdc1HaWeulwmwcUomPfmzDAN+NE3FT7705XQKcQo9XQnPH8GU4K9qgU8bQI9JNSc7q+iAliZlg
T3UNJMpoZSTtxyxqR0lYNiFaB1uDQ6YIZT2rqoZ2tU8tOcvDu1NI8hj1QJSkHvPHwAIViliJozPV
cTAimtsFqcrhx/4rK9EiqlfCZZ5Z73ErxqQSSwgzhenNy4TryDnmF78ZMupX2TPTnunxDg7nhtzU
DY8CMCHthldpm6P4Xqzq7rYoLT7MLo/J1hYvwzqlGkmTD1myBM8Z9uN+bC22MFjekmNxrIAotr0B
ks/bsgjcr6TRVaV/9qC8pxpMK/0ZowPlVvs8TRfMSkWjkF8DrAxbndvicqIMBNPhYfXR/WknTc0a
4UqUTcX0/47bocofTPFf/cErd8yrSgwU1FsoJ+ne16PQOa1ED/EMZoDKt+K71xuct0Tejt0DaLQR
yA7g5zc9ZPD9cZFLYSPAwZGQA2dvvbezyFlE/TF6XF+B8B+U/POPRpswJ1l19m2o6dmgiukQCQUF
RmTepi4G6POCA/BM3ZGK4brItwla0BdDk2nj6S4Y49gAjv4vC4cIwbR8bDah4jEAZ2l2Dwrd27Bz
/ke3rSTZuLqTpKvb4uEg36HlNnMnhUK0KeP4/96WbAFQ5vGCVUtfkP9yt3qeemSybA3qiVEL8xKn
JAYuBeD7b/C4EB0VcO8tP3nqId5gBS+K3vPt+eWpklMpqZXCZ+AG+yC7GrpdmRMFn9mZABOVVlOx
bgqHIOpuTEacVad4f1JYKjwo/Lt2izTC0SgwbA3icW3WpF4ZiGsKTuk8Q8D/04L2q2r9mj1dqK95
y7tNS23+l3sjuGjxOB6B6xNcBoZ4ZJm2lRocrvAAAC9LQZsUTeEKW1JlMAIj//ndsJjt71NY4A8S
oOvzEfoxj2qdPvsHNDUnbdghqzfrsTZ8zilJ5VjktQUv3NW4RBxXNysImNYNadxA7dqWXX6f2nw9
/IG742wHzXzzj4gOtGF3Y3Zb8MEVDDgFl6VftaNlZF8EJ9NVpE7VnmYvbgTrmyq0FpE2TFHW99/k
pwaAWAhtOZysdIBiehZh+qgSAfdw6il4SAdH+RyMmLIw4Qoseo6LCmaCV/6FkWNYXp+zXlN4FLxj
d+5Qjc0fKH+VyBGmFf/jVrQB+bWH89WmlBKDZH5uB6qgNsLffu8QcT0U6AFZlaY0766ccI6TE1CL
BpOtRqRsx4NoKQOtYoq7TWAc8gBO0/oP9xWNQYrnh/w5lSzbsvMT38eI1+WuOgICa6rCIhupiyQr
wzflWpfKi1UF4cytz5FIcoeTgUXHrnXv+XToLOP8rgnvK8tVsxGu5OcfUFCQK8fytmsFPn1/muGB
IHFEuyTsbjHTI0A7p+7gQ+tc+7MAE0tj5dW2lzaDgGLgQHwQMJCCy+rt65CvfeIuwquvuzljvy5M
l//sjMKwDLH9coXRKmTkF4Bp1LT00IBDXdFVNe3cJqBmL9yyydHMyJN69DWLrb5Vk7FFcyoKWcAT
7RwDNooo4hEeM0h2Lx7lVHcjWV8+K8Wz2VDc5/vZD5umwcd6lDqRLr2nq9wKk5Hy26d2mYpXnPPL
oGiZGRudUe7CFGIIPKnKMufydzBu7z0NdlXgZLC9v5y/Hn3IdYv2YiJiqxIR0j/KwFaW0+PJCLmS
710ZoE5mgqDkxjtSPC5xflG2Fc/VpwXfhIHC04nUZuzf1iDZBKAuZ8lOOySKWecEUQmsvaofyPl3
7c0TyvavAGEu8O6Lh2EbLJBVyjPKuwbkeXUdD0/enwRlVJnk2Kqiy8vxBRVBaIIJbmWknA0jrZgK
j3UraG6YmmCtQ600SoQ2hgWvkvnsiN+XJzkrdhDSonzlTaqVP5gzZg644zP3Z+6mFIMrJnl5DgMY
I4iY8U1Oa6BMT4d3a6z20pCqrJitUIMmb8L5vKFKZ6stir2j2uFq/6wC1eyHnTuTpQp0zHGNTaLk
MUoC3PvTFhZ7tfhfP2R+4OS7ljgjUggLfOdoD5XdxFkbZ5OhWmjLR/io4OK23ILirxIHB5NiHrtY
OmTQlDox90rSDaGRg3qn+s8Yc8aOAorZoj7tquXHrGXmWPWl1b71ZDvTLwaHaV6k5vOeHgE20cPw
d7W0nBicGviZa687r7xJAxN79rHxVzJfPvjWdJb2qDfn5DQC9Hr2PaYzh4iyX9hjV2cVD1MbDhY2
D5OASbxQAnKFXISaT70N1Yp9IaNBljPY+VkXStNSvwrq/933sB+U6kxb2yEItmI0Xj4KReMCBDlM
ebZoKvEuvq753ta4i5NmRX0+baJYMsvb59OMHqAS95Bqkfr/dMjwnN/qwDo1OOH/7O+kxcXgc2yI
vEStYX7/aUn3ZUshJw5jh399qce5K0M60sgFqjK7x+wupeLPpjc7pbUT4NPuawg5tlpXlwBHwHpn
goHN0bcXawxT9GgheLB0ZZSC3C8BCROELyRFc499DmjYkCoa8AW3wXOHH/qFommc0+rZbL+9l8vY
ZV769FTyOdZopQ2ySl/RBXexrZSc4cbzkqBJjwpFfvhHh8A+1urzqvYVsi3ajbCqUnmT8ibqbrfZ
md0Mc1Wr6wP83CAwDTBvxR/JSyhT9tSO2yTsoE34Zf5g003jKMS8JZdpiSPgTUT1L22HdkDWMMO7
h/3ju8SnBpvHVD0cDU7AoaOZJJeWVJUlBQRfcipLJYPIuxMWmpoVQESVTGlloiVcZRwslvI6TPWg
KWDJmvJzsmPQa5Cx+le1A1uVPiiHJ0l17YgS0JC+AjUbJFvRWUC+/0M25GeqjlhN3M2cq+1FIZN7
/XFeMqKwtbnDMZDG9q/teM+4NQLGH1XrVu/bB8vIeGVenhosZDDew/jnUknnfPfYdsCNjhqqQvx2
yzclpfjtNQG+8sifj74Pg3dPpXzoS21YL3tWBj1LU1a28g6TR7EY3REgAqEWH2i4UkCYyN7881Ly
hCfqIOL8YeU3sr0DbRefrYdPLS76SlyGY0AkYYQYRvKbAH7QngyH6+vF1t0eSbQfEZpa67yKRp32
HxIAkXThy7okTqRPDMDRqw/U/I1/r1s+20zg/EeNcVnbm7Nq5ZovD7ucNuEHpIKgCm8TTe1JIFUN
RmjZcS2BHFVrheQhXc8Cn7Z5SkVISXERTWM1Sj7fogz9LRZla2KiH7J2KPpp0K3sQ6UepsxtPN9n
SBwndLf6wBs0mNUiDSWIiQAKyNwZ6K+UwIk87kHeXv37Ab9cxtYISmYfN1yJUdcNPOjqL/7CtpS6
9kGG+VJom7UdzlAAYwoKIuR+5PhINnJIvY+s7hTgaEL8z245NcqD9R+4nwmfl+UY18qGbrpFkTG4
KzrJfxqWU/H1qZsQYjVxgsFjmPUu9uqJXGqizMsYppbLt6tFhCnUK+UlPYI3bGGhqfkQvtf4X0qb
1ByO4xPxB74oKACrcNtJclEZPvApi46Zkc/Otb1eB4pYd0NQglLwq7Tva1F4DdaHtWb/Bsjha5oh
MmYgLfvjz1cgUEdboeFGKWp/Ue3TzF8i4F/vh4PQ/ttn9FEiXgFnQhFGch4jiL29quiO0k9g714B
SlW2ur4+r97SJtWTonaTvzOtX+NeZjvvyrRrYQh3W3lb6CJ+fCaYs4brT5BOo1hkGyxcBOJ3qhu9
PH+LwHr+wtfxZilEsneAdz++WBA6FhmL6KXPiCY80IuuCU1hYL8q7Ngif87MD4fTSbXfFrBe4Hau
GDILGGxye8CexhaAIUMcHIb7qLlwxRzHWMbgZlsTC0ZoxWiHDQABCvHkJYTSeilgual9lu7DGq0I
kjXfj76J9YFVXJzhRvhVo03PjQ9IALNpkQm4eQLgvy6PqOICpwtRKBo3e/OfbU7LZAuvoRjAF0P/
o1jOYsLaVJhErcxNge9zMAMX62jkWqR4sDx/q+9AV5z0vejxinGz4//NP/6alSW9D+ZYGWujEKic
aHvHV7DuDFDpWz07ZaiH+n0X69S1rduDEOkA/A++x8mJDXmZRe9WCwyKEP+lK0ToKUZk2IcdnabE
HUYYBG/HNlzhzU6QD/DjUg9KFCuvWdfi4TLHkHctFfEmqN9bFeqJiD4AzwmVjKK60t3CRDTNRrL3
57CnjLjkFpcEeaXR29LcuyYjwkn+cKJ/ro8xIXSke/cc2c68vekVKHWwI23lElhD0ab4QhPO4DA0
4bVLHcNM6AH1N0GO90xYSlLutIEU/EicUEw3HexoIEMt1Tf0kGXyb3XE/pArYMZaCmZ9hgQt2Xrs
kkD2faP/oZSvQlc+3PJ50wwixt0i3hLC0VhrDYyOp8asXqrqFAcqLU3a3XSOVH/hA5uhoQi6O5BN
7XVq7e0IJqvYj4trVn2QbwxLXY++zk31p+GIfHZSynVwbpzR8MzZGzLu3SBsZDimFAn9T2GvfCdH
CLFso/hzf5SypcRB8n0tMMHIoIHM8//psPOUssG39RguBxHKssX7wG30LnMRagBbTCjgBqbaoVUI
fExseScRKTdXs0iY4tMtmuq9q2OA1Gd84iSDV9U0GMNuOLp87FJ4q7BBWI7H1GcCKuxkLfIdH2PA
ed3PoWSAPOhc5S7cuOBBxuZ0Hn+gMcmUh3AEEOz33SE4m6b5RHrAmxWTFgdYWEB5d1k5cSDYvQUk
eSJxt36Z0tBusZudAfrTMeksRH+CK2bmO9v/zgVyJhb6fcIUhrvCBrT6n3kx2FqHqYgfDJDYiBR3
AqXqNqdrxUuf2J4r0a7+kAUR6+5Skz9ZUTDJO1txXcnEQcHreKjT2T1n/sAtfawlhqssb1AgS2MU
r03NDSJAgko1371WUCQn29qoRKeZiLoAzOjtUIKPhV8U+/bACtciF63+tsfM+XiGQtx8T+huvUrm
8v6QFYsjNJdeP+KdJD3zjPTZXZZgro9rEBmpkY/2yqx+xbgMtz91USx5s6oqVNLG6ddOm7U36WZq
PEGQYiFzcHw7RSYFi/ahaSZgyfyvO7sDCm1ahcgPmCyaTzScIWRX/4Wd9Z10t0qQuWaTxivAtxBq
lmzmq5ST1uQnaRmIvBb5zInMjQBWZup7EGEQAyxLMjEKKYk0KuFCumt3wxdc4cjbpr4bTrh1ejYz
vY6eAutBwq58rEk69aEsct1vlPfiXWg02P4btzAum0RrnUZpMZGrU6gSowVrLPvxfJqkPfZCTxr9
x73PSSKTU+WmGJS3RUvAMDFkUT++oCtHlsvLMN3SbTtCNlDzYzC25mo60U9ZNLVqSSuzlTMEa5T+
2S4nlo5GrQubJkYYexyUPqcBS7YAyTeqs5Nbdyx4gZS3mmghwXH8D8W2hyannKA0G7YNnJ1eiIzc
2qYZXmwlRbDR4Z7gXT00QM93N9tTE/nnD/hx6gv9Vtr44MyTloNSAP+vjmmltrg/Lpkvcz0c34e0
g+nVXPrCl+RvHIkJnwyrKVYtBM9sd/icl/kyG5M0KqIOFq1ydSdtEa+gU5cCNj2siIsIqDunKon+
4B3cNe8kRro/uJ1Xy9+CGfacaZD51l2Dlx4v17bFZ74Hu+LwifxKSNxKh4KJPeo3Bt8SRTItUiHo
X6CHfzDjLpDHIaz7OmxscIBDrZvNDU0pph196VEaxMgEXEebRhl+9I3LSlH6+dHhU9JbmnV8/ESO
G500udYMuxJnXLx3Tj99PjdKiN3vfycyVHUCtRTtPILNaqvzZgV6syp0ajE1JBWuRGmb10sBGPby
3qikQvAZtaYwokIDtx6t/Kgy/dlFFMxrS4M5LqMHRw6XvvAUNbA+BTlyc3BKRY95jHbxeuB5e5FV
dioOw/PKD4TIGtHEE0fBtAx+zqMYgdng6beyD71vXPbwN+1bwWWNkbYCZYJLXdNYqcEyBo3Pdrxo
gOqHsP8JEJ8qmzW45nuZUL9s0QCuBrfAyZJ8Cknc9VeERoDf8XGmUryEetvyTY/yS6LQ/u8nMnwy
0OICM2+N920NgJxca9L+b1l+ckQh6M1Ltzucd9Fw6xmZUd6EzQFG/BslvYthnfh8PLATi3teI/hd
YARFWicK1I65TLDdiwUNvdg5yh5Ge54jFo3s1kHeICmlGEkKgYqSwQ3eFLblKEZQd4D8Q1oAis/0
z+XSoks9cuTvAxmSZGXTnIM9+8rGIe/38Sq0oypcWERLr4ljH6WvfGxFSdHdVQ928jm0OZkHE2Hp
s2wwNuCvYTQliDsQKloF1Zp3NMorbBncaeq/yXwmnLLIx8x4yzXuSKgG4smuM7JURkGFYHA5Psz0
JCgCLFAZ6AmHcAHx4S8PJT9oNG6HidDPrruahzsEK9tNYWfne59GgCsyKCdYsZ91lYrkHwSI5y6I
iXVjswdXhKy+46TV5ZxUlNvQ3Jmj8vusIyPhSa7KMmyzDgnfG8HpWV4scCROlXwv2zcDoUbzDl/q
IOgcFeHDcKOKg5rSPTt9TKjSAh+FRUVhr0Ly9eZoXgzflEgK+8H6ENemsP1zg7MZ40tAl/B7bFMj
1CLyl11nefVMvC5MKa+gnnr9LvpRnFaozyz8Uj5eBNw+14BANPL3TUXBt5Ls5diAxKmt08wWlyAU
8D3kwyK5coAA5t1yyYA68H7qo1xHXnoUq4osJtQ2muiJFtK7G/1LI4z8GiVMk+rFhlLPdDtATzGd
ypRajwIn0higTP/HnGnNwuRHGrKM+feFQN3tx37GjjDzaQP6257C1ZlFsiST5gA+Vg+WoCsBQRPd
A/hX4qpI+3VqXCCbsDJAml3984AIOe4lvZPa0RDPjIIaO3DJt00ipoPgqYOCF3EUqERm48pxxV0u
z9l5BvEVqPTS7SsbAgd+4k7cYnCvF4kBu7sTR2blujTGUUp6Bqv3hBdFmts3VVpMnKIFGJ5CLi89
BaTRAl2P3PbAZIbaHqN1mb/a4/ZeImwT9Ne/xusrgFlCOasrG8unvO41K/uLlY+17lImTkJKF/I7
ACN+Anrc9zY3+IqIiJ4SXcM+wdWeR06WJWgCdwBoXfD+bi4Jq+zi2VklmItrtkz9tTQuoXwJ4uLL
1q7Xaa9KNY6S6wyVYsLaRklFI6v04qJFJUHj4oJmHn8UeuPsTFKq+81DwHJrLdqaDrGG7Bjs9nsN
x4R+8IWX/SkPHzIMsDVeO/Kq6ssLaUj5eFiDwb/jvb8jSo5PGjubXxwM70LQM7FuXCv7Rvy9WPoS
nTz/sKY9ZQiHrLSl7c4b6bi8oOCE9JnUtdB4/ohIOGVzNlmryM0ppGRnxqnVr/Nu/P/2Igyny7iA
vrCeMymB3Za9jwf9ejGMPaRsVxB6VxeIL7pf6vdvYao8FNQau1/GQ95UAEX+EFixWHOmXsjdrNxF
cx63IFOHIM7yJCCCTFIu4Fj41oKqVugM2UPD75sIHvr1qAgj+xUDDNKVgr9nkC0DpOuYjMpZZlvj
wTIoauPgzqClDfkgqAHb7ixeJAVg1o9zovGRCY2rw+7aWfzlDFOONbUXUlIkdJLZyU5EtLkLqVRD
iASfSyYHxrgUNq3t9laAzVhNf8VFqcIWaffSqVo/HDetbcpVNM3CkiKahX0uDvb/D/AxOxamSRKf
r7eQuzvAkCpJqMgm5Z6HU6xsZ9fRrnadcALaim93mj6G3kJcyzp6hG1OefgLkXhPjpvwrLky0TKh
Dlhp1s3C85nxV5K4O70wbJLQA7bX17hOOz+zgPAXqYjHMrBR6ueNQXvSBgaJ8kIzjgC4tBWvt1DF
jJkw+YrQIH5RGTlFE8QEHf1YgWCtpDcMgK40GSbjRcGF0/9ZDmuu7c4MT47Cxs3Sv4J8ulQa/Wko
8nbK5/nC4CJIvNp7JphnzOKs4MNQ2tdnLcibe4scs2OiKmaNyE4b4E6U4pn1ZeHw/yOMxEbn3VN7
pVGY950E+DoXr3v66cvd5Q0vcso5VlDFwJxHAUwL1gBTO2wX1HYe5cOL4SfNuPIJ64hFmkWSeHAo
ZxeH2T81WOrO3aP51uo/JJMv7hDE8tzoZOaKbp/n2mX8Qkugt9zQ4UwmcjZZ2Ijp8f5GxtkEhEmf
iMOm19dJRBOXcZZtYGySpOWP2TtGe1QaN3QiIaAqnxJeLSBov/9ZavlkfmQcI6t8aAehX19av8zg
4WkRL5EYWT5hg6hh0m5AcY3QkVGAa3eovOBljlqZq8af15orxVqAAuSYZXZGrpuQ+B4KuEc3ONQt
+tFUNhRL/bk85oN1IWZEiXAxElqd9wKWWjHdYFZ4xGpNO1AYOK2iuT4XuPfr4/cR2QCO+MuDrwqL
FyQcET1/fLaWWKIwFZDP153ynD5rg8u8DQL1JkfSdjR0SMit/BzhJ7VQbz7F8FRnLSm2ZfK+OblG
BJfPSkw8GFXoMxt66PIA+C2uIKeNg43p3zxAAygWeW/K+YiSLlmftdEHLW2LCx4SFWFkITkbfZZ3
Jv8YKm98W6jCgUp1/9XBE+WsniVM6NqvJ0R+lZSaK781GPCQgbXdKs6CYEVx3ey4um8ysX0nsd9F
cZ2K4D418YipUwvEC+tI1j+Imb2EfeOKJaoS+PlunbXt0TFb+iK7Rga6qWjD8yw4AYBRUyKyhubD
YY/l5kUWFfCQi3v5+xz9ICNKLaI2Px8qoMiD0h82Vt8Q3Zv0b/Yahz56N+Di26ViuBanvkFrkrKN
qPJh0bTBhSIuLDtnpWxSkcfLURm/mpTfYKXUrW5F4+3fv3I+oGEEqOJtXt+vqJcHstsP02ZAvCx0
dFo6v6xn6PUr5zy7tSDmoOlIKwWGh5d43k8fsqRoBOWQ5wbWZ8zpgIOL5aX5nP5QNT8ArVtAgt1y
qy12RhKYz2N9Ti/qCHAlBTKvi9Cd/AZsPs9JnKy18yekUvzYzpU+8V/h5qZ9yqnNKIQ20Ugqs6ak
MbEvphBnCWABK5CH/V3AUDZm4VcQuS2qT8GkPxKc5CuBh00RCZ6Q0ht0tGpDyvc5ZkMPeAmDMkqo
i/39t9sfhITluljSDxZ90CPLDOw4qIvHojcrz2b+Kg5Fn8cWsHQbfy14SS7pAzDkG5c7EtIKanBy
T9YrsBWgsVPby0y3y+bAOaejQECtgWDyX578euEOmrhBiNp1xnyooPIvPYfJMJwqcOaEXG1Mu1yu
OiptueCk7o+jLQwgSgO6f4ZLr8asqTAvc9S/oM6PCfQrytljFioYbEqIe2qXQs1zKXJa88m/wb1I
xU1KX+/ZykX+M8o6k2hZ6jhPNV2OkFen2+EIf3TP4V9ez/vILi908UmbHU0nrIuNHYV33Ib18Ntk
Yp3To+J0jmYkd3n4EkEFkCP8CbfjqatUbi/VPjW0R4JUYUQ6roHjLOa3O/Pyg5IU30uRZyN1wrLh
1vTC73ejUa1AHmCKVC1EWFCZiFz5l/Vwo+fP33volHIpYJUlHfSeDq9t5SemuZogGdB7LlFmiV6v
DhcKzLoZCSHEkKzU5FrFnh81QPqayYRqSq6ASiBYykjts2p9Ucgcf4w826BcXAe2CHFS8kiLxR/0
oxP66oIdO5F2kC/q2McWIIFwxjTXl7m2uxSq11SrV9reQ3kmC4mf3Qo5KssX7+7hMekSRhfRt3NP
GWSRJ0YOnJX5gjTdD5p5XZCVierREvMl+fvNHiC7uYMbl1gkE+mjIXarq665Pec82mw0NragSjyj
Qr8AsVAxK4BNlc7AH6IdqIo1MHYZBZb73FGU0D9BhbikMtK2l63+jp42lOAsTDb8chTpa/YzIuhY
DYgxO0qw/ioAJHEmLseESQOHTZrgl7i0uVNDXqwV76oy1CKayNREWnCOwUC07L1n/njnFwXM/q4S
J6DxkVhqEhC+j6rmLbozXyzusO8oW7ps0t69s2f5qG9geSwlr8yRRzLnrX5GmU763v03nv2gAE9T
FcWVizz2a/hx15/Vk821H3NzLAU+NWMdmLrhB65nKJjUkyC9F2qwY2tVGXUgInBTOHOmrQsOEA4Q
V8QQDNQo4rQPISo5HCQg0lnX8cfIQ/x6QeUkA3fPf3ZQ0sCa1neHwwPjeTxGgrRLSNHKl8oZTBtB
rJWZ2SIN/vPdHYB2Kda8AvacAjpk5GIXN/hOqXlOFWKi/QnDKFJ5YHlqnM3wOblAtuSzfJc5g3WE
1Gb+2Ie3QIjtx4o5AjV2SE4AeGuApdoCiOD2oKF87ZAELArCJGd1q+vn+s9jYavMjYkBgL4DMt21
ubEXa4yyj6LbIeekHLX421YOGepjDUmV67A16mLEUOdXXQdVGDVGdLcBIfDVuX2lLhgYDxlmpZ2N
tqi0R/Z16doGwYzey7UGmA0GcBFLViaToB0ZxRN1L0Da/GGC4M/eJbR6V+HVaqTDhwwP8lMUnxNZ
iNmGu3jSaKHecv4CBOY+JWXXrJhyyeS+i9cH8RYs7Yvln1VuLciwXS1vHfe1ZDGpEQ5TkvKFxsxa
gluG6vZbMUxyYi4arlX5IKMfER8sGQOwqCrWkimKm7jwSSlWqAWjHz+V9PS/srJ8kDBcabz1ddf2
1M8lkQFwM/RWeqBughuEx/tV6qbcDkTqgit0NzsIFH1cacOQ9KUlibiPLkQzcI6JyCmASctoxqla
nmrw4l1T2YXFDZCLWSHDt0feJn4GWuBwt5YBupMThoUK9YmKsOr9HQ+fP59BfTvbKp23NiaVkfca
X4atOPfxlPpbwh0a57ivecpBG2qO/WmwipC3opcPQMW3ZnhspavbZ9IySYXcNfAfy4KAGe1SFZPT
U45AAySCJAX4+Z0AkelUeENfb6G8FXiUEaUXF7NghqRSfzZNwO+NR9ybquPeAWlezuVeML+bvljZ
sqTOoroZKySArk/YAaJpHU3S/3Pd4a48UQieruyT6j3KWlbkDSdbyKNlJTQTQC0Kxa1nHIbBGvHU
FWqER7xdIABza3QVVelxx0XIJoSMWUNkMKvcGUi7mqmiHWIBcHvZMd9QV4jtYZIu5fQ1bRkSjm/B
Z2K6G64hw3Gsb+CT6rmxqGVba/IM/+VIP2MTxdF96zjWZmiMEkbOHUBxr+n/z2BAulaphMMiq1V2
hA+l9wNGjUbDcsUNcIm/LIsPcfCoBcQOEOuqUKn04mJewR0gLqUB65C+lnffnY9ScNykCvaQYCzK
5Fy1iDtrN5+oAJfH9wSzYnaE40fQtkJswVpQyjWHIMdfmk+MA13RGGnU9lev0HHZAIk7MD+p+PQS
W2NOmWj90lvF5cARQJWOdwHgu4ExDV+/JHYHiSH0Ts442l5OotZLXyagOtU0+P6Gkp0i+j+bqo7j
TEzYGJXlmJ0BhhVVLwvjRdJKF54DAx+qRiSDYyGG3gmhtx4ZSsTgej8UDBORusrezvhnfBRZBbjF
V7PnuhmI8d1CIVJdmdcHEh8r5pvfOkj+Yqs4JBiSWLURbmEnctPUtjKQJblnAwEEW8kzSdAECTuB
g8dB5J9+ZpgklbAt3zVH2yAPEpoL7cN2eyG3KT/IWjb+8dC375EM0gBxoBIAenYIDa6WSTWh1BDb
zp2PMFBeRPEbW7Q4UqVKTm0fzut8pKtUQK/Z0sNBKOLvIasaCYTe8AygRDF/i/KBN3uEmufi44AU
q3DWpnMVRq2kzQQYAEfWDQ3wusU6c1mo/pUfgdNzTkquALNu4jzQ4iCj0ISgVYEPd0IfTz1Fivcz
PrN4RzTUd9aD4DYldOyKt85/M3RMU1G4Lo+JO8DN8wqNcA70CrXNYAqiPVszoeOuI0JBpTpuiCiB
aNp8C/FRc+TnR9wgjyjGKSQRU3hSXjJeIjHbHNeKhSlUesi3pMaQU8S7Ebw0xWqdOCwYF8D2ZnpX
oAtdov3ZEAXl/M/aZbO0ZRRxVrHt/kHmMQAMLdpfNH9e6XZHNTdyPd/N5N8xVeTHaSIEGBvZDR2/
HXoU+JddkjV5K7FRuxlnQMcS8hra6u77Z+Y2nj1K3XEo2NqWUEtVuFiQvwNc0SnSY/NEqDkEoHft
br5xPEqnQcmH+qDw2NvgRR61+BxJT7/hax116Mrpl694FvCtk7dNL+jmv1p+mVua6SZPWZyH/+Ni
hVmBemYhyH96s0ZdtGTESs3Hqs50g6dwCRHPRy2hTDK4idG8iYyDVF5kd/yjIbER1fpn/P2uzIfM
/tRA30wUGjnYF93Et4dtJHwIwdyvMYAZBhZwTIhdcL2UjAOa2A2Uns5itDGGwAtXwTtOatLrXPOZ
faKdCD7AWUWlTVlZwYBgVj8SM0RpKGgSlpus2H55LtWIhxvDWJPvTF4n69+XKh69yEyyb57SbYZY
tyatZ599mwpWPt0nE/r7Km/wpK3xe4GKm/NlJtvyJ48z+xIHiEM23AkOdtIfXhA/+QQO80XSTk1h
/OMdk1UdadDHMtFUufgg0eB3e6fonkmhbtkwksiLTb9ahUv/YjCrarl29LnQfPgQiT8823XBCaGJ
wP0RvgEOsR8d1JInUDUS6rNUlckqvf8HhjM6Le3ruUgV6qC5V30MzEpzrOQsXJiZc1l9SBmIOCsW
bb/0975DRSRu+jkbjj+eADt3ZYw8QQt5ZTYVy2iD26olsX0ryM4rY6kUBBO632/7mEUHQKNiUUGn
3zlMdCg3kYa6pAk9AEUxjWm7UzpcAZ/WproWJc9Rad3RUSAxsK1Sa58BiJZSBiXwMDK8SBhfyeCY
v68mowUfCdBd6B7ratPajgKhmyAPcGx/bd5PoMjTf0uzyktOehEn8GSs9nZKiIb1X4bQicQCxUns
c0MwHeHlc0gT6f/kfQ+vBLgUVmB3LhCCunUXiOnIByP4bcx3n/aPJBchrhjlDHSX1eIqeRbj3Z9W
0t5K9HcFJoKHC2sV7UGKYOaFyNyn/bLSezaWr11frNxJ5MTlEAYvBYFaSnzlbixhGOvtUWGItO1U
07C2f9HbbQ6Mmb+IZii3ONtQ5ylP9mDjgN3RhA40vZC7S//LIKbtu2/qnP+aZO/JjXK6QyKMHOuY
mzDaLsudVwyeFD5gzdoUJsmG2Sy8w7CEJBBz2uG5a21f8n0RIKT0+UFzgwfKtX+mK1DkiIQ/9lIb
oq59+mFGItlE0VZ6Nd49P17hE+Mqy/cc+rhieOVN67isKPoWDbcyrHt1lYMLnDN1a6hfkdzd+VDs
GzuXr6d4R4og/U6FWYfGvHSU8p/DBb5nE2heUHNhtVsAPe/VXnxuAtPr3hVvP4nLKkZYkwCllZwI
Wnmo/bHydMPEXruRdtTU1ojRel8rGEycqxpv/HGNmDcn/oPJ+ul6DXEXx4pwYF0K6+qNT3U8LQSb
CZqYN7yQ/PAZTZXLcTS3zFwi/Y8RvhE9V14V54TlgHtXP+Y2d1QD0L3x32138j89zuN+BAYaeDnr
ihnpnlwa+ZI0rQkBg2o3cywdQIBLGDcbmXXgVQuE7ndWHrb+Y0lCj2vVTZxXuGwfa/Uh5wKb19Um
P9+YXPvBIMuH4lTpZlaNbvv1ZqkFjGWfSqNP5l9b79GwqLui8SKae5zhDkMwzZlIcBO6Mfbu6En9
PxU1f9vbXn7MJjdd8zTq95uX60sB8N7CzXyJkDlzDSVi0TDbM7q43KznVydAnW4x66uVq+IqIyMr
aLbCGvuvQjdm9AkGX5Ma6watl/dQtkkzQU68ZTK3w7Jy9MO1c/cBJvvoEyO3wyBuINRW/wgza/ho
h/f+1dbB/3goj+5EJP0xFbLmGibTkpkffnoNn9nx1XJirZE76RWtSgxWLU7Peyx3agBfGABjvhrS
OA697SD7XPAXBtkJw+I2D2T5Fb0vPxcwwvdq9CvfSigo13QwxDB6iz/a4aFLtxS1tGFz6RogucMa
dl01w58ewWT3N+hR+faEpb4CfH2WmOad1v3KTahaUoRqVi4CBSMYjGM+RVFiHCSQQtyHTqjXJGAu
nxmuq5ASe1GoAKJlsb/u6M2J2Z1pJXS+txUgGRc+FYq7AHZPrqMi4Dpaw1rNdt9bLwDmMdhWCaY6
fiGFUTti5eAwQNJbM4/nLHFsIKFEHk+/QKhJrikDW4cv5uh4co6gv7EYJOoc9JNoISwP79t3QbEd
fXllairngU8OYmPtrXoEXA+6/4g9p6hs39VtWQqhu/T86Ds7Ot2g9dAiSTtSL9Cq7hphQlDLm5wx
y7XlY2VjWQ5qa6plrMT5cnlSUBhAcUkVSg7TcIlBwVHctRcK1+ADNPbqBWRPW9wfIEyQPVFj1vQP
ckJEqr3AHAMP51zk21dcV9Yvt8cfU+068ufypZ+i0MtDOY6vtH38k6jwi9a0R4+WP8GjMS6jCdBR
7OoO9Lc8i+IjG60cPJEXH9gQwoRspkiUx5uJKTPvDiPjnCqTSRBc6m5Bp0zEowcLCnuEb8zhpqqM
jL5dNETVINX6W82EYQ60e4zTciny0OhmskqehsbD4Zdeof8d3wb3XF+3CqUkHjlO0CMVxb2SrGCn
T7ttgyWVdydKsxVCn6vWnK0pFLWlnwmQY5R4egarFDW7GkGGLBoYr6Poew0TEfI54vBzd5+TE4kE
NZLrQUIqDFwb5JY+DL6U3I39utC7F8qL4kOdbQzlkOqZrEVfvgewpjkSd/BM+kO7gByCJQzk/UKc
vhvTJDbhPokWTcrQ+qMS/ylD9ipION5OKa6chMcP69ZF6lyXpRnSbhTChUeoaf3k4zPyGYY6XUzQ
KNwODKCKNTjFoK9S3GPT6d8bpD4iLpwTi2sYZyF05H2PnLLIPre+sG5Wj4S5eOa/+QBSfea0Kk7h
Wy+8Bi3g7IiEUG+26Z0YfNXMFDEjSvWqvjDbBPbzva9CwKXFKjzl3PrS+ODdf9gJvNdExuSNihsv
BkgrBuijiush/KREmjm2YUnavfbwfFLkinc5RnRIOnG3Rp1n6KkMMvU9POgL7YIXPz12vkXWaDJQ
wJjZ5LhU2ogbVfCBEfT8TxXHq6F4YFdjosxmw3aAkEgv9Dcz2xOImQlRlQkAWxmMrZywRFddm61H
VxmK+ZnjQ703324EgIgi3OhmKWEdocjg0tZO0JLIb/Fzv/JPin8cP9VU+LZU/D8PA+0QPxrvww2a
2OV7vTJT1ojtWkxdim5YpUOZIfFVN1N2UjDmVHtHwqgtfisHWJlb7YG3GAfOhDZkGp3tEmbdufK2
/m5OZ3UwL21sqT4GL2ScfjRW1PnSh+yJMMGf/+oebH42O6lL5PdMeGti7MAvwDBrLQ7yiDeAumk7
AeQXZ29YjGIV6mUsjCUDAGLvAZLTGm76Pgl5r7eEKcNhrJ3ol8zQNOxQpl9zsFTzNeMDyePvm4EP
FZNF2vSihnnbVetJYBMdTR8oHnihM84PEYL7sSOlhCS485QxTQ+4/oWNsaih0hqCdIjaLtrPtXzP
p6u3QyAidKIlRpLl7SvnO2XpRbLIMDGK8PElGYj0IGGGU57xqIoQ031kF8YicKjXABsWW5+pk9oM
F8cQvC5UIdnAxPF0QsKZvCrbKCOl5AZe9jeu6+Td1Bw3siKQAvXa9wBJaDsZCduZD6gVl98BhDsC
49AfQsCkwvMV8ipaYtWzYGNsU3R9iR0Cc0MqjmFEYTHVYy/JcTdEJWSf/L9mfAjZUfko0DtCWJpL
bV+3gMgsZPI06kOsGTicDnjV3scQxETZuhYu+AIAObUe6T2M+sK8uuydRvqb4FsYZsjexccIRZk7
1+Wq6GZxgGNItEZmXp7fNoe9MMKM/yTzMp2WMUN7YLaYT9RqDv/48KD2gH40lRCU2AHlbiT7keqt
46iu1s+7xdVc5JtiP2ty1AXCg73jj4Ig+DZ90MJbTCQM/LY++7EV69s/qWQ7nX824Ur8KCQ024FD
jRsGiKIOfdliF84yvDCpoSe5NvxRgbEPiENV6h0IYBt/tt0OLZGmDDq4+nks3rhU+V1ppGtpvhPC
v0oiC7sDaXsRirChDYEJ1GX1pS+JliktTm6ViZNwL6jeK5tTxGvHGTE29gOUSbDTvP/RFNvKbVfL
J7nI4/U30DoMigJGHOLLBKESbhgWzZjUxPG/oK7O4uVV032BhbNTiNJFRr9teSWlb6lkQy1wwrir
NCjAc89V2Ec8kjIP7A6y+bHBmlgdkCe+xHIDWNlZ74/nGn/5fXhJsCQaABUEe7sNUKd+86AALwnR
+QXDBxAMdpGFP/01/RLGYq4FvwgZRInjBQ3vWUXI5RuOlRRDDx2BgASiYcnnBb2+r2nbmY06Iere
Zlbso9kaC6UCF4cjwKTFzeSqjrrjyaFs3LPBn+nSGZxXGZD1MaHY/0nl/KZwN+ve4xw5qgC0DynR
wfC0Gb99r9PI+QXbxo1ql1u8HS2E3p+8QskcBnnX/BTOTxzECnswlt9N3H22d1CPbBsDAamPkKTs
AWs+feYBRIGyOiY+fHYN9DI5sy5PblrJuZuR/sVczEfYv5SdLJ0mm4gwb4ApF1V69FepW1VQKlCv
oYO1dDPnHsOM2SlSeX2ZjdvXccFaV5i+zvrpYxw8sQjDSQSStBqgmFZ6h/oppXe3a5Uq5YE1ilay
+LNwnSsFPXxCisPezJYFP3deJZvr8fIRpGv0iirbd6FT/2YS0lGb9MOhuwRh6+zmx7eXDK+O0n0w
5IQhY/kL5F7Tp6OO4/7+lVXKzb+0YvNRkyhuV8LVXahrvOtB7RZtJoV4cJK3czohm1EakYwzRjTi
bwmGFkN/3ZPXmJNC1u0QyOAXcDeKvJSFftlOiJapusFoe8XgBjkSq88Oxez6KZ991VEXa/ckdUX2
35Gksm3AMmJp/gtbfe+a4XvF3/UnYmq9KY0Oj+wsxNzc2WuidhouqenGnP+KAzrHmjE0fkJdSqLy
Z+FVjwvXMgmfh+YtMoVj1TftfTh6Ix4uOBGyuhMzQ1kUdxzNwELJn516Q7ArgKFxMhoKa/92lHJS
50bP88jfq/8BqrUIoUPqcvnc+7bdy0Li+n/MoViimd92ATtjfPJ/JUD520rTcgFzoZCkDJ7K8EcB
08nFClZrG0kPvKTUUt/azYr+dM2q16PXffQ4wH8NrpeOL0UJqSfjVJBtcSlqjN4f1qRwYZlajfsQ
Y0WGxr5lzth6e6cewLKwMAB+xHDMeve47kdkPbRvIf1CtCFI80yLogbsrjcwSG0Fdcwi60DERjuU
iJtSzVqg+IK1CTgtS1jIzGSobwL57spnK/zoBedOWqeJZ7ZUIw7tzzScdR9hT8YdiAQCUruOe/EA
ABfBQZ8yZJRU8V/1s0d2VIZKiQzn57u81M3cgbMBoA9c0JM92/4/NocOE2Q1ivIbNCNRmgZQoyDU
XKv/glDP4fQxkFzO8a5jSyhwtqOsQLHIgSG7H5Gw8EBrEHyKK/dty9v5Y+6+GDkqhjKJksMoT4b/
/WCzF4+vzxcoYz9vR/0vlbXhBwlmTd9C7vr33WdAsvw3XPUQiDyiBOVLBg4NcD0wB4ahAuUDTNwY
6/lE7LY1vSiWXEbjRwko55Wl42cyW+M6zl/sRatbdm3q3bTwPA7zNyuXB4SotiiyDxMawkexXfQB
TdQLg542GG351kDD7d69ooZYa8WSHK72uLK78gA1nfgQBShXhBT5tB3fRifueazs0wxlzxgVhjv4
XT3XcLb/HWqS1GqfQXORDkMgOjnJbxoJPteiXRuOrZsoKyjitzpI+LDkIYg6m82AoM99OC8ICNtU
NFUmWHPOccFks05j8mPESjWV+boaMXHoIISmub8NH+NxOVYtbvYAOsHdnqpVdc3wTJ1UdMxD+ot+
LU210mlcKxywuoG/oat2Y6ZI0z+vlin3jjXapJfv4OgwgapP5uiQLt/pWNWv1qraOZEl3lT0iTFD
kvnmXyVTl9jEct2rHFMQkRlnJC+fRoFwYeN3x3tXI5+P/iLdNxb8q2NGZ0frq/fpEi59VX8XWo1o
Bi4kbQ4f5apWFRu1O+V39iye7fovHHiX/JSNpog0D3OaB5vzlrtLQW6mHgJD6hwB18AHUSIlfcB0
4b8yVw3HdXvVnmkmIU2HgKQKBWlhzcx5sLifLTsqnI1MB/WB5/X5Go6m7axff8pvnibCYi9AC/+o
BnRRZ9LkAS1MmMXDnaTbaJ++5+nlNcHpzKe1nu6fKsVsVQH+uButqvt+mYZkoeetzWQ3h9vBMcyK
h+5xKX6DhYk6eOluR9qn9BfiEvKklNNgutv06O/03wMqLOGC1V6CBv19de6W6PzjPobkHVkd7xO3
FU/QgriVPYzQxBpOt1C1gKF5dcI/TCeat3OXqTX5559JlGY5wMg2rmXDspHs+s0R1sXo+DpMj32A
JrCtv7fqvlLuQXG+wKL+i3lWuUfXDahbFu1H3PL6LSHD+o+k8Wl2yesQTVTeQ1QD4xJolLuWmBDW
UF2J+eVkyX0NC8EWyy9nbuYTPrqu0f3IcGSa1TV/jUvGAiConj8RDDDW177gOnlh6g9GR6hxyduP
p6n8ncVztI2VGZuI1Lpu+denYuuLq/8jOCV9hLx58xvLseCWS/08s3LIo/4dE1clY7p2K1cbFsvq
/D7rnLIboqFqxRFW1Orhfb+vAsuXQdTD8O498UspQ3WS778QKn/R3xLrVKBCHAZ3SlT+I4BAZtnF
xq7NsObIpQUyq4PMBV+bd6wY0vBwvXjP7EDAF1UB9ozIDdw8mnl5vw1upmpFpEj57JTJOVK/DRzF
JQMamDfE3VsftEoDvv/9d1lOyWbPNCTtBohTA2JFrfKA9sZAQpnxvhvmLM/c+kzlFUfGkOhvmWwF
3Q64/Cg3uPgdqEzKBDQKVQDU7MJHpA75nXBGGztACx19OJJSMh2/nC8Sqkx+OyA9JUCR5i1qsN4v
FiYpmfI/eV/tAKx33C+p1zd1LFO2xJmaQiUuClWbzf/GZT0Mw04cn8qsTrHfMPAlqy5uHYrFUaym
SM9o+ZDjDKPJrEhyszEHicAvO4D+RJEVj6KGjkMTRF2rw2eHr6XGQK/ynyzl6U1XsSuvWJQCdQDc
AazPhp5g/VkgRscpdZ3NHszeYiLq0mnjgWU+SnJkuSEfL+72j+hl4TM7POzEbX8wWhirb/dHnvMY
2tNID48w1QoaHNmGMhl4NRhBZeT0HxiVF0S4+Uq5PUQ1QwAQHzS7se8mqUMd/Zx6lwO49HPpfZ6V
LZTAH+BgZdUp5DUEhD8dgYUEn2MxqbprJjFcWLAvCb0sytOAPhqFzd4XKrq2tT3URKpf07VrbKqU
gx+xI5XFxl74VHgc/2lGVP5nn71GPHBlUWWsZTtSyNAlZjJxSBHYMf9BwAwFjYGIzlYY7tqHApf8
JMHqVVejdf9sEe1ELEHVdeiLWmuszg2IX2cVwuQNN/Scm+NGuZWP2sGI136L9Ea8EoQDolPtniHt
t9ejNuvUSgUlfC/28TYvqNCQrdZjGUqECqyqcMkCevwe8sRp1yP1GpwjNKNKxPQdZhYkTwo37+Et
rEO2b1zSBVc0QjN6/oABFn58yzRXh+Sw8qFIYkUK79bdIsAAFgBlvrsqY+mEABaRpTYz1BovEbLx
d5dem56DgelBeuYpXAVDmpCK77cToC+O95IIT5RectvgstPQ8m2WMpC1jfpr/pRBD8TXeaRqjT/c
4aqphmuZ8skBSZLe26nrZxXr73ueAuUYz1CGYHjXEPG2WSE5At0ZXa3+lg59qdxXCMyHq9E5RFwx
c/rNW9x1EDbpYZDG96Jit54SW5qK79DMVV0D5wyOjUxbm5aa766gtmb7Jj17ttF+l8wlE779bGxM
qvj4DoxCnX7WuMarrDhSpj+hgXydDKjqS5vZMCPIzfgBHwn0crd+t7sVS0NWFgnOn+x1/ilfTx9u
lJ550NBI3ct4FiFpxutSo0cJ9v0AVe7GyYsWpdoWpja4Riv+opFfMvGIEL3dujRNCEBg7D0yJYo/
Z+fFxKPrVC89ZqxBiI9+ekALkLC70w397o3rZK+x6myTFdOZfJ9iqN6FJJeFGxFfZXQFkwbTaaNP
j8ZC67wjdtdsJOq6QRuIcol7m0d/zWW76xigddbrXEng/+7ZtBgXRJF4F44KpeCMtJx4ugIAb1EN
uct62aBrOxA5Sw76kAijz/w7e57igM9hi/bKzvpGAqF3fP+rLFDSPwWEDeUIR0PuI5wkvKAfgHmy
LyDdXJqB1+VrHxcpW9kUg5u8gaV3ghq0s1eXWdyYAbmA9/ZSHsrVYn5HoR+Riz+9dgBRXQ4CSytP
eFqT5kSErNwgQY5zWPUEUeVdINXaOWlCnLfgIsP91lGQP+2QrqE9/xpOKAoOrVdpa9gilgyp0j8R
BR6JEEz0ADRX1Ulw4x201jJbNUCQX2rlCkzgZYwFJCHJjcQx+UC8d1mRG/pmnGTrMVFyGeQlM+GP
f18DbogvjdhZ81MXicr+bdYvCOB/jLsRKQF/u0MF/KBuiv/sTL/q7546P1D7UaS/+B8Hc/EuCZY9
vRILVG6vaZZW/qL9CG74vUqhQuE95KoS/n3yLyfpggVBEO39dxHAS+3ROYd44KmcoNqSFLdgNUlp
+F41VuBKg/Oj2pBLmMT+Qrfyteh5DxMUrSW35I4/y1xdZAj+aERhJl3OgrVnwJSNqyN9Unn52L3F
sEx6IH55KpiCJaXtjTx2af2GKhZs4akpgRbd3lJf25xTVRAPqYOehpLafcZne9AFPObb9SYCfc39
zaXJk+1F6VqoU3Gsf3dFLpYZo6082cv9rvQERTntWpr28bEMEU6NUfe3mV1FUviQ3PHzp5IKzyeZ
6ZCUVjBkVxiPhbPrGQLWncZPYYMCT9CdMSxKsSMFpuce7i6dHzGPau2+LWBEzI/1BO+dDfFkxs+q
dXw/Zbt/jp6lAMfwWrY7CknjTrrNnlZQAieFtvcKFXAK5NQTJWxnmjjX7KKMMfGYywmBAZc3FsNV
EfHYqfueMTMFSKftmXoQa2vnBc7eSc0p1XQ+76aRQIhyRMO1HEyHdL4nA2KPziIF6n/Z2D0qUIE+
TYBVj6kCxTmwyOStyOILerPY5dqzsWHLpMVKAjesf5yweY/+dYAo6TIQ1SeejHUztDOyoCZbV4KT
UYxbbDaZbbSv+/kCRxk23fFmhCtdoss0+88qqMhNtQAKSMxqLRO8lg4KYAkYLcbbDgSwb9U2okAz
STLUxeW499ovBeW5G6kVrnFTmGfzOG9W/FTomiWop0r6+Zrbz5YUd3LdzBHfUm7ZQjdsh56XMpZZ
mReos4FaWOCdGNYI3h6LRAMqAOjcvbfRa+MT/Y6YpaD8VTE18mo8t6YDQHLfAa79pgZ30PhPcHyR
ekc+p3WykEipMlfB0gvGmkjtJLqgXDub6aQFBaym/4YYWnsCkhFJLr8tDybb+dMj383IxsIswmoB
Hs/jDpt5C4a6D0Al7wM0dwq/JqSlxjMsrR/6yBEw0UKnQ0yrqailC57Nyxy1csm5uHJWUDkRJcCI
MtWPLiWrBi3FhuBxjfVT/EWD42GVrATpNBwsQb/XzKf3KBE2B5VcO1NBMgwM/LnCxbaeVXmGfBxZ
MuJyRr2ro6/X2ewvvN0Zb3Dc4qM38wM0L00MBEv5qUAHVgmdgbd7BZ1r5cZohRMfNgV5OhZ6R2DW
qBZwgrsCmB1qcJ1zwCFfNvGtToBYk2kF7TyktgxVasDijtro14KmEThFMFeE1PBtaaobHNNhW1kV
EO5fi16Qp+P7m3fYIjN/RCH8HRChecuvmYphfaGdR44HLqUyEtR/QPT1Pu2HtTwZR831h31hsPZc
O2SDJ9XPM3dWBRzL1CFVlrcZef/sy37hFjuREcl2/M5GeD/LbFp3mRTQSgju4DqAB3xODWVqACn8
vef5w75w/nt47okppHO4ULUfLc3c6Ewh3B3fb0Gwv6Uk6Z3OereNITaQHalqMGTyOFU7Fj8TilM7
4hPIGLrD0d8zufgH4T5QlzTgUaC7LvSsjnWg0XHMHDBNEYrcK6LZhzfSs5k6aoDOJLWUFbhi2Zna
sxnHqCr8V8akL8psGiRcSr+Rjj8QdQyQGtjZnS+VkhNgVwpY+jEWbGcHdM2dKxU5vD71tFFo/PVy
XO9A51gWQXdMVhQD+QQ8wzjrB+mkHnP9tOhskw95ADceYIhVc7J6rc0/Zl3tUR8Dxn14eJXt7Fog
b+CmGmhpsUlC6Zl7YcTnQr80Bg1jnk5CcZ3eFakL5k4ikwQAqRX3BrBnuEHzkwHIdTB/0znQRSBM
3vz5zl/2g7O7pa27FaUqreaD6qTBJQVxEwsofpLd1WD83McJTjpKwALYB0KjMzANWZMCY1PtnJYx
spsNiTVuYjCnDYRp4MazTfPWDtM6+OdcRvMEtKDOM3TY2V4vIe6/FIjijzW1isgzTkpePnUfneVx
0nXkkDpjvynqUetAk23QVMPTa+FnIBn7K+iDDnxZaUXGy+kafrgizVW+IRsItEk2myHcjjJ73WGb
NbpTVv9K7budfttNc0GoCxXb4mqn31A3/hDStyYhZUhCp+AwKYTBiM8ylJQti0TR1R5bHqy46lu/
sfAAZ+BTO6PYSvcuL0V78+sWvkqXguHbQj+efyVYCG29H6oKRqQqOaLFpa7Ptlmg2/0MS8MSNnLK
r+fb6Oun9Qy2DWyIAWKwwfL5SK5y1zCKHLzvQeJ8rhNchUTyV+Q0GW1AmHIuQhcdqjUjiXUmGLIn
dv5Rz2MvguYey8+6SEdCTpqU6n4BHUH7Al2Dipl+qW5uXnQCjtmOqX8wXY9d6wpYHoTP9VTRlEaW
xAjqgQD0Qdp9CAt+K82j6B4ddcc0AZmUmuU8RBQZfj+oTNyfy+Gk/jqCJfMFncAdA2NEILFryE+g
ALB1279glaVu/B1+sFQjf2WlOlcUnaph0SmV71bvBJWCKaUnVeXFKQACLLkhhRjGwoRU2ceqLoqd
ZckAQyG9zYN0Q9BpKGDbdyfeUYYbVahcHI7f+sX/U7BFMufcbliYkR9Il6fCdHgCw/ATroPIaShg
CKMDSB+Ym99GhQ6zAuBnbKNqHP3efSEn+d9KefAIKgvN/Fg9GcayBQpuuFE8AVZIQli8eTcSa8MZ
bJykhYtsWpQaXMo4OEZHYKo5VoZLfFwTUfdtM3expQ5JCaWch2R6ySGu1vcKcSZ2YoHeK1U7TgLJ
MWE7MkFmPo6k8T15dj8R+JD30mgb3l2cdTjOX9+XvAZejq7afbuPg6xfgiheesB1kHRdoTN4o1Nx
6/DS5bH+0Rv6V8/2XmjOOrfczeeYbbDqM6j3rfuJPwUP23q68nWEtY+iIuv11iyXJ24T+5mjLjYg
Foj5t3r5JWKoQWxwoacwbZMYkEbY6v8Qiwj3VLuKSnTZoMtuk4PkwiGFq07rFdWFeHuf0o4Hjoql
Or+f5lDoQ/ChzXXPRuqSEBnS+H9WnwNraCrLR05lsRTUTEgJZ54xSLo880uMDmxLeeV5LrtJNRJQ
B7jCWoFLmMbdx9Mywn4SrIQrLL8dkhCiy2mWf3LItwadbbthCN0FnhzOE8vbaqRDY/HGo4McdxRo
gXELK1JMN4UFUdNYqZzZIOn/or9WENXIdmtOavSE3HwP2HGTlpbugwSlC97JRCTAYduatllxEv+4
Ap+uEtGwqgowWz3ZwnFm9vTEp14f7PxpZoK/rl+iikDLxAFIunZQ0ODnCpmpclpLad5kvGqiGcjB
9Pb1x3T/2SeSEZWFqRCK+Z17VdOpdtLhGyuiNLkauoPyG/HoADQ4EoN5LY/R6/iAMNWpil8ojuam
rgqfXmeukAZ7662ShyllUXbbSwjr40UlltJnVKH/q+6VwD0CMJnzVcesVBaDhsBQ2O6Qcd2FSkND
ddh1VCFO1BppHn1o88zT6XoA1NuDfLm7CQ2bmy7F94su0s1SpEOcwDUKDvx3Fk/ynoijxUCZxlYU
37sZKB4Uci81TIp83O5hByEKOaQ2pU9tUM0CmgI/VvDZ2+54getAji0OXfXH9/ExeEt9HjFrhbIk
cj2c274TFN/qB26r7pECCazHBASvlqbu5WaA9cvtMLDMt6+u2CkPhkxaXdsC6e3ZjvQSxyp8dTgC
c409GOOSARAlC/uPvbvbpvZKC7luF6LR1GTGuHMVLK40CwPyKodTrNomnjAayAfLfXKZNjRFs4i1
+/QIrsVkkzD2h808V1TQBXjcnuv+TfmXQZN7WVdc49pVtayDgoVOS/1oY9W4FgIsxEaMOK9+o4j3
FzN06jyDya6hhNgL/aql9XAkLZ/OM2QNJY+iv0Wq0WTiNHT8iDJOOy2zViUm5aN7ZgEiFy5OxjMF
YLEG5WQiHlPf54DdcmZ+Hn18z2nRYWuXcyRMdxSG6rezP94qkS9suaHTFYKwCCfqpvCLNqMPgFjb
s3JjxqT70aB/WlgQJuo/0y5yBa5vxoQWqg2MBHOf2HnL2OdHjc6wwNWaXBUYGlJOyylnzCvSZ/G5
9KLfoRU9sOXtLKUrj70VlVCu29Rb/TPCK6Cxm8Rmi82QqTmONQerdL6W5p4W4OyviEjFGTTBZDww
aIp8SPzoZbPixlotKTPh5kOCNS/iwAKSFiNXcA1z9Da9NpCBC0ZJb4Oe+79YJ52dhTxzsliEwmqH
L07q6zpTrx29syvDMjHT/oxBMN2RImnnm+BzUeJnS+SNteSf+9hTJNPOie1ztX10TizWxZOFyGIV
7QGwKR0IpnY8MJg+a9d5nNj16X3KKNsYm+waCYlCQOjNZEHVZd7ER1DFJ6TttzB+nPYukYfJEXhR
HLX3igOXLGYiZqF+bKmAz9eq3WAhEafKxh1dPFc1op7Cwp3vMf2tXd7cdx+vsk3RfHkSVCZFDtWa
RCDQPN+g3mpYDruaDy+owtK46wBNKD5AwQlWOq6qh6FKeKUq9vbwEBHruC0sJ2qtFCbIMHeYzBWK
wFN4BBk3ySYkYiOen0Sp3V5iL0msBSEVYQM4Xhj6wDS3GZwrljcGNc3qHJcG4yud5lkNfMC4Oy1B
7ued8WG9ElFkZ7KeT4Y8E1AUgwwn3Gtrqp28T/l7qbEEuGvHbQaRe8Jd8zYoQRTKSAQa6cMHr48t
dVjvlE74DFjthNdkCU/E04sKkbvXu/Fy8YEej6gNUrO0w+zWhUrt41+d92MhNmtYooMplApGTMCr
WM1SzPvyyDVJRSKFx/HCjULvwWEJvG8qV9kT9bDePekygF9OI2NfpOxgqivE2taezm1Je1Li5qzJ
7akuL2CJ6AGWc0O6cNU0JevWHhQSCz+xB61Or9hsZm52xv7wjgT8y4KBET5TNhbqe2oyGyM0L0xD
pdGkHYj26p9ErjmBcDKlFWTPymF5klvPcgZvW/TT1NN2hoTXJkLLWeVEEolAqODg0liO/nTxdGLv
EahD/245kRWz9x2awCVSYvDOlA2+tuRxQAyFJPTWMpBaqqQx7N22GeGNAAAP+wGfU25Gf+vDiG87
yMHSjxu/Rm7wstdcg6HOf5PtrnEmeF4meTbPBE59/4G0qi6pwqY98qU2w2BXYaUCrxOaWz06KzZU
p8m3BUs4pGbDErC/As+wNnIq2UdA3PNnVwXh2s1T+XaoF1siK9a1K7/PlklyGIoq7kvJGcRl6qUE
w+5hxTeovKNDXvSFssX9hQK0EVInl87mrQdDKrNU0bJ4t3SFGBT81W4gqrKrlF0DEJ/BBQhuX/qn
MAc1JpjUxagQ05ptY92lKJkJeIvC+qUdS1SZ7jAOZiT2dKgs6lGhdts200T3iaX6a/xSOQqPJXOC
fZ+pTNvrcoWOwml9e9/DChbbAV11GdRLTJkgMncAws9rzduHYqDQ5JDKecKDE1g5FjG7TyXoWVre
xuAMI/Ezoc4Yr8OE1jxT6gOMs9m/kj3hi2O42VcvFxVlLaG1OBZQB7Trigihl8hXK5gEly3gY9WA
GHwSBs5avnGVB619iBAF2SVQYz8aNtBidhWh1ZAzuH+qcpMgYgPLCYwabc/jELEfovgwpKi94CGv
EDrvkgP26N/K4sLQMQCct9LM6h2rgjn1AK9ey2hDmyjKJVWbEITkw1uFirLVTgAJP4H292YL089N
pSZscwOchvfQtdjGc01qECxNtc0nzqKBPyT9OlIx5rdnb5xkGmAXlR6cDwdaw6dbj2YayG6/wXMw
tJPDnM5dnon9Y2g9QaOkYLY1erGqZtKLrOm7B5eLAbSE4W/M4iQW8WRMvjmL6gT0HRYH83gkGS1I
+LZOU0QOZ3TYEGwzj/65YXidpAdTSAbQbjVl+JOMw/sbjhA23pdekvrkIYzQeaig/lM/oBMTWPNj
EkmhDABJ7FOrSacVH9ZTytakZXwuhZn7O4HeNoqFEoqD+/Tl2IIUY8D6uktHjIQhq0Tz8iFi3nyB
tLDjmR16WuLs1FKg42Jv9DznOn2QFSNBEeft7QMYQB1QGFv+ZvXD/K19a5wdjLuGO84VuxdNCVuB
yrXsr6Jq7aN89W2dmk/q5G6pWBgHx5FtUktu+0UyV+0tHpfnEPEP37pa3XBfYgiqSvi8CH5ewuKz
hKW7waPoDqPGhSj6GYVhfcahf0l5rimG15V19jnImpeUFFHZeVt6LqoboI3s/oI1/crJ+LqeY9vb
Cue8rb2SRh7/fS2ygl6UOyVctPshRKS8Q89BiETjOwYK/NZwW5HHIJOOCLASR2tNELx9A4YBKLhw
/FgR0aufmmjqUzqMHHoTDqIrAi5P3La0AmWuqG+mhMAPgci8eLXekdP0D1ZoGLxbjL0bUbMMlO5m
4BAcv2WVD5EpO86SXRsqCZEIBwx+LK6Y9623L70EUkQ2+xeUrOTV4OYhmVAjSUPS9yCwJPW15vwD
49Ofg+srCQYPk9IGb/T0Drh0kh+9pFNQhUysNe0+DWhCV7LfxufMUob6nFnaxSqJ24J/rRXnSmB1
dOsta0uTlkrfnVqiLNoZ9gBIaXbHOfgU5L6we90Z/ACXrav5UMu3reVM/qu5bntnG8kCIBxTUEY8
n21Dj2acVnYNLXu8VKBvt8lhmzHR/dHUU6L6POYLgqd4RE2TMCCBtmRsyAY6KZ0kF4EYBbvtOPgL
N0Eu/h+Qh3za9tC09Jgj685MpqxeL6liKL94YQZdm7REeRWfu3R5YlW1PDhLr50XxhQi3HSLOCs6
XVILYfFHznUIctRsxIYp0QDlzOU46VyON4e9T5abdLXR3eyFdX5b4a+V+T5+5ei3Omsp6tgY+FFM
4fizCig7aVfWWw060JB8OeeE+ocTZPoYFbVg9a6CpYpvg7OYLpXrILwRs+j2WYY5iuOdCclep/76
S9icPOaBKolXibe4XntHqnisOGGt1gv6LfyIvXEQO41zzi4gcvrNu4LLpTRyWlgesZcwk93Bhh/y
B4OQM22uAvoszZRf2U5pT6CZGG/dejMWKa2udfG1kRpPX2g83cgzdvLwhQoY8pSGfL1RbiYdwejn
U6ULcxLp4B3dCHkUyxRdoRrCIgs1dV2znHOjAYBpTUtKH+OT2NBJ8DNPtjCbR4qxaVoG5VfdQoAh
+xAXx064oaAwwbHPixloAQHzr4RxoKLRS9HIy2aWAphKnw/oVihuijd+kxGqAMZb91qhtaNlXbeb
3T/UXKOEAOsgOcpNeCke439EsqMkfgaSDDxQ35Cji2hykGT7tYvr49es0GTa6jQz4zeaa80ImIXU
jsRY7Rd/to2vAqY+sLRjDsSkxuIaWT+ZYcIQZ27TIPEFIYqqNFSM97vZM3UIPLqZom/moBqONYwL
9Hr6W50LJIv3pZo1NUPKAOMJcZLqG2Vu9P4/ZoR14FWV4StwPMCPRxeqQV0nENJwiJVoY6GtrmAH
kAyaoxfXO8LtHGkS6E50cPxLB5kBjudkI4957CWpr4jhcHXrlAmMdWjpyCrFl+HS7wejE7LqyVGc
Pfr7D3nNLJq/a8JhMo2baqqDmDJAflOCWGhbdBKBABhPbjTtVKIHWt34Bxa+sZQsu8+CLI1SI3eI
wGWMWNJnt24pHkyFSNyP6RbjhVfwb+ulKKt67qw/Iwm2yxdij7PGmlfTV+sC+umo7mPK+s634fgo
BriB7Ir+HEu24t5uccqZ5GMh7K8qAugG8+Oq0Sv0D4l9EsyfkswtDSqtBpq71p9MKf1HAecmh51e
ejXiAOTOKECmh9rckvKRiqwVqpX6abcgh8rTaLo8ZePxmdg8V5Ybv3nVU/DqY3CAi2Li8MCdcYMc
0sErc3wmXbLNOsbET4+1Z5I4yqkhIOQGNa86PphsL3ZEGlTMsF0r+Gp6deZz1fN8rKqp42xUYyOU
snFHkB6Voo8SCzvrzLfL/a8qnzwR9FEUIsdvHpvPHvKBUHJeo1FzvjK9+xeNZak+4SSCGMUbz/sr
VUXhqwKScG7Swgamibhq25A7RwugghzI4T7cDCpfxD3hi3BJpLkmJDRuASpNoLIeG9Fuuw5xGjRq
Lx9s55OjgG7Ck0DrMe9nWXb4Cj920h0YXNhtXiRR79Cdq9T2DiK1JcdZ5kEyomqLnfETUItocyp7
5osF8AsgrmJaUbUZ+OLfO9Q+wwz/OnRwSLDcByTPcMiVLiKfofTurKjK66F+BwoXsLbmq0XSe/qA
rpRyvT9mcxRIkk/dEfZ8uoC2ixAxWraJDrNT6GQDmzLjgxN8VgAXC3ZCTBj7PcJi3+PA6aMG/N4+
u/chKL3nW0Kj+cW91oPr8B75OGHQXRwY+2h7bmAu4++6ISjbD5YQWYDOoKJ3vIz+fqMj7SJHN6QH
pLg71tZM+6WKN/wyCgBfoTvihGT5ohUnfQkcP4phaR1eHT8nS6myFyxUs1b4KeIUQUjjFqwXtAZC
vO6uA9eAJKs4QCAUxJ8uFaJ54CmizaXB+Ou2apeKH9xlHnA1c7Mcbj8flaPvCmj2AETV1Sgotlsu
dER38aPBkpZCMOuo6xWrpZ/AsnRyHwkzbtdFcOzwXdTakyy7rqnDSGJK5EutGrgW8QQgqvXZTber
ZKq2qu7Cxh9i/OMa20r2PMY59YoOq75+JddyydKZTZfFIfL5NdiuCdsn2/rK0pLV4VzD9UQYh1GU
IKLfjSkOKg3c3zNPt9i6clvqjo7Izr22NhGXPT7VZryGMbPqGmg7u0l6BroNTXjmJKsRJhIqC26d
WK3zqeFfffxMj4G/DTGeBgCxPFl4ih9kS7n6K16+ptnVava4swCMFiNBNdI3Kw7J+MmCcrkii2YH
+jwFV4U9Qp2dkv14cRtcEbgCOwrBFq3HZjlZu9TR54H/FHBIAFSXrTwCDett+a6CCE5X8O1S8pYe
tCcN1nf/v8M6BomFbKE+cV4xUImwO/5GJ4NYhIIhUyEsvPIJMZp7Mm76Cw6lt3nRmwE5lChHyEXG
TwUCdDDKega2z+v+qsR5eKjLN3wXBy4OMTZby3eYpTkUxNBeOp1QUXNSdgtBCUTAViZU/Sm8RLyL
fNbyV71+b7LP862zyAEakXjclRZr6pxmaEPKpcrRf86fJTf93NxUW2mgWtPZ7lTunzRN7o/8k8UI
qVrF1nQ7ezi5VHEiVUSFsBxAkZqgE78QANAJTb89Opjj9GEO5YGyTr3KHuJSdFJI8UP8os4BLKFx
91eHjr0H9+5nSXnMMJvphpRe2ckftI+OxXrLeONvG66rWvnr38KakZf3ldBHlAOu9HIfNKCq5axl
JFi7nyF3yb4buBEWoWr/lqjEEeko00KR4LdxBan1muIUEk2ILgqyx6+kYj8PE34bzBR9MZ79K0m0
bMauHb4g8b6/VGvLtaiP1Cg6q6p5Bf83afOI93K+OdMV3VgBDRq854LzqL6zVq/XqozcuIVFT21K
Z9cCfvjeKMunGEIN1eX+8X9czyuZ6OHdiJ+3UYmVxvAd036WhcDuXlER592dGxoqV+Z/oF1/JNnK
ZUQtd0Ef1M9YKXZLgUj0HOaL0fjPSCCGk1eXli1ROfeU9c3ejpNpA4MdyLnYy+fizOthK56OSQDB
/tB9QGDruIeWII+xhKGn1G4ZYo0s1VqlX+iGekElQVGRGOB79sQaAno69zyXyFXUAKcOUaAowGJq
xh4KuioCfeWkcXVwkCRHah6vNPR/dISu4LWAa47bhsATjJ5RyLS3JfSME5/hn0njPgLEx4Xvp0/1
UOOUt8A7xgiYS+uLe5mC8ytMuqfXoAxVfdcssTqhP+gsrA+gH/1tzmor1pi1fzzkmx+63Ugcil4X
9RA1x4wg0oOBLAM/jP8P+r+sY9Uo4VSfAXeOSJTt2El4dI6ZBhs+2eedbHmiWHOWcZtDmAckjbFP
fQryrS+tGhQyaYAI5bcZV1plZBVhYMm80zcd0OeBnWN13ZTXiT8uALfx7zC4pNh9L3MKLwyJ+C9W
M+1zArlpyiiZCD5m0nyrzCPMVOIWxHrJl8Qzs9UtI69JKDyMF5J95kDsO5pbC7EE2g5ixCW9YBLh
kJ3br1/0hJwYiszmSbEK6kXwPi4DX2qiWVkeoHGC0VvAIEHNZlVUf60sIhGL0BeclDVJfBgsT1WM
Jy2FA6EGbIAq5e83hBcexWbLi98vIn3rcNfCorcGAbPe0o2lCByqLnhVhmhGGhhH34MmcBhk3U+G
BC48rfUuyO4HQiDegUdrvJ88wiJaATrRhU7H6jQiKPpx6NHPO+rM2HzlQORVgZHwvOQg5tc1qWoL
YcweCg29kWPvX8HSzCt6dUo58yGVpmXZiOKUBmXuJybHoiFjeNv9+uBWCMsZ6+BeWMQKgcTyCgt6
Ocb6EyWlR5d1qBR7CCRL2swrTOXliTdb18Uyw/E4Si8syppeLM8nq0rQddMOPCbgPPiTrFkQAVDg
9K39MFu48kzhPRohrb/NYgr8/lF3UxeqVGJC0GIS3spAZRMtb1guEHlJHqOQgajwOykn5SLii5Sz
ZOSrEOLx8y8ySxbbAW4QqoJ9qggZ8bmYiJGDoCwJdtVQAAAaSUGbVzUILVEymATf7KBxZz+mhP2m
BKJCYPsQz/4lzhmxleanZUlBv5o0+bE+NxF/TujzXQSTGJ2J9VQG8EWe1o/bIoBaDcqQoXH28t7l
R6lbDUdPeOuOGGe0LH/WkA86t98jUYXTklWNQqXLuRW13U9tuaHz09FQ6biI0mYSLSi5HjFY1Gi4
c4taATlY7sseXDhepmSMq8Y2TkoYw9n0eMMoi1Qa97oza3ZT191R8iaU2n+ZrhC4CHPW/Dzrf0Ul
p36Ww+SyUnX7LHL0Ow28wpXgF2S4/pgbIf17M0IBRDF9kv137HccS7TAtDDPDlpIghgTIqW/h1on
ZpK8Md8xVuRl6CtYa/vi2LX2nqd6m9xlSvY5yXuQqbg//JL2Ge6jrK1UCMnv39i2+3c2U8mm9LWw
VTkPsm1gYbwliCIdjhRawNmO5OGlGDiG6lK622aPGYF/SrFU9L8B3s5/P7lXl+8HTNqjzAeJ0YFB
ZVz8X25nhvFr6QI0NNMwasq9ubR/EpQzPyCKFgAAx65vKgCoAnMjQK9qJG92KrO3BA1Pq+72QmWR
x8McDbtBJDzNVlT44Q9UYnncGjmQt0mDx/5Ihu/BI+EhWRX2nbvKb2ECx+kjoLnnQuMYqIpxI/DP
tPS1VyDpQ6QljOgeenjkBWo4n+99dwzldwZqRgkAiNprdFiXWOqaEWNRQMEsK7uxF/msuSTLJXj5
63RC8ZOvQl3HI5ZnhN5K/SzuHAU5M4qYseRVafgLxMmssrzctcG3gqYY9IL58tNvfYM/sFm7rqvZ
s5v9L4jk2cBnbsB1JKgHwsn275ZEXiS2SXm9gFz6XgzPlZd8DeSbC+DouwXiaQk4mv0cfdq+QuyZ
rbhECVMzI38xyBc/3BKLyDxxeLszNgVvQQfQYCRnxdtwPTwrB+Sdvvczvy2KRckiISglg5uQKgiv
HHQT24KAjaVpWWNIO/TdtiYklW3LBetzsCjGJJg6z7voknojWa1/F/W+TeBWdqT4uzBbW1C0FYnU
bomsrz+V4RKdsk7xu82wvysyJlpJsn7NeGh5wOztzoyGAuzU3WPXmi6pq/w7zyghJPT+EYFsR4cn
VjIV2ksI/SDK+2aGZYnBqTpkjmTnBLLPVe3iKSQj6Xcy4wHFq5Hlp5ac98cNi4ABAYtDQpdIspAR
JJZW1oyZ/x61D5omAWNdGRc2kds5jFpW9xu7cKh5iIJF7rcMy+lyhfHLiV2EPxgbm4+l6sWMafa5
AsLTPzIQhOQHwmkb4IlR5FqZkKgkMi80iu3FJcxn1G8PoelBnfUZrDZoJKss/A6ynhsXPSsJKFH2
Q7gvvzuGf3FXdiqXURYncpnnVjvwRcLrliDn3Jl9QaOHQ+GWgFp9hSUrLYT8J3BhmRXeoNNZX4Vc
Iz2HpwY67nLUWtEHo3xyoik+5kjL1AiOAh+TNP2tRLK9+j91hvz0+Rc4ZV66C/65+CTmQSP9CQ+B
u5P1BdVBluatteoQcyfcN9LGYLBCCAhzh4Fz58dFpjN28uhFlv/cB075BeMGRDVTWTxD7Hmu76SO
QDIPtuo3xG7j+xsRM8P+2Y0twXpL2pZBc77PDuaWQmljbG0Rs5k7Na9IbibXPMlBzED38kXTQr3z
VgmiNg31YbCDx5dgR4i9O97NJ86vwTYL5MsleXIZx97Mwkoz+tJm5sI2kESG6d3wU5AUDRYzd4lF
pml77YT9p0v2rJ6L3wgf9C1ZE9TNsJhTHvFOFExs2yalmw11xlJVOSl+Ls7OMqsnGh2tVsDzQHHh
Tmk63CQtU5Cr2hduXLoJ1NLBbdgSnGyPUXM2QDeYzbpz3vWfj5ytRvVPqmCD9DpjOdQFPW/C3bA7
SkFbDiFXKcfVQwuXM32tvKAsFhDxx6z/mX0xqGPaBRncnPOcUARDQ66vb7cxLMSU8Go6Vi4yVcpD
0m4YoPVYGZKJb6w/t6OLX9Gs3RFI18LUxp0NGdZOiFqoHyLK0IRxwNk8fboDcZ613/c9u8p1Xq1f
ve5AFljIVBaL3RBqPExnO3kFOBC7+NQL+b2ntmWLuGoiUdGlPPaZ71yx7oeLCymh4KdxhIax3FDr
9KQiZbxoZJYogeszQsgbJDVvW2keq/EIhu7zTu3LtGo6bUtLJlEMnr899nX0FoMMP6NQ7h+ic9ay
PqPYrudO0Pgf8ZjX3XCOPSqha52K2Fs1wgtZJJvhxvB0tSRC039K3NGTxKtnwvZzPHjyT93SxP6t
S2eVko438d0KwBB8FzjsQ71MX6YYq0uZH59WvMgsvTOjddAOIJHlRCUKOZnKV1bWMpVxmUNWwTIn
Gd7mRx7kvbD+4sZUQ4kJkWA4+U9VtV9ngRjE52PwOChW3pWn2qlVG6bCk3cDlvtAwuKVlZxzhaNE
O20jPhpMPzHV9f9NOoRLSYpAxC/L4O0ulRHPCo+TUqUcwdBwLAKUwXT7AsSicDv4UemX4oOxdJMY
zWopJYaNkt2kM7huY6hxzhm+rNGdpzKL+olFHPRt+bj8N20rt/rCMLzYoMkMPadtdGBJPHG9kuWX
EgA8JUkv/kxhPNP5x+RdMtc5V8/XVAhgC8iHHz06D+2jXC/v1MXewG1vl2Hf8Uo1a/JaVfSivZZ/
FZieArw0lCPNJ1iJf7SRSHFx6wE3vBGHOqeNw2oYrw85HDCx7wFQZ+T5LeWBtv4/4uJCF83c93f3
We2FxEi2Htd/bFl31Bq2Y0WPCHhIgEL13gduLsZNxbfhRp1x11YT/fuRGgNdNigAeNupmtGSB3XR
MCBx4A2fOAQvOdV8n9E3A/n3gz4JqPave/L3XC26JxI76lFeyjV0Gi9VBITU/ahAjyRULgwPzSMm
BqvBBK+k8B2Tvc7UXkAwDJH9rGbyZ9Vnwj0gEJWBT772aJWAoRXp2kS9DiqviPTS/0iK9sofYbdt
XotnRK0EHZhdy9GjBxcjOJnDd6KlfEsKijbe/i6fJy7IESPn2cz0y21BnPJc3803Px7hCzbfAe5U
V4U9wDYR7GKUUD52pERMTpsqhS4obFfKpyuiee4RgkRJyvBGtvjBDwXn/f7UnUJ3lMZ96nGbIKgx
JhJH9M0KYhzIMYkEbEzGvsTu9N6rml7we3Y28VZHV+jOUCwQ3kK55Se2fbJu//Z28dEfZfcxXY3e
0q0cpziJd6XWzVhUMMKbBw8lEwUHuefQRwkoWeXUolYk5r++EIb+3×2/bDe5alyTt4z/PGPrQiUx
8TIBGrWiDnSX+iFjHg07uqJzoO/zVBQGk6t9WwWm1Se0OEhd8l+3vSetsK8KGYEotzrP2RnD4XgV
M7R0bFo3DjN70ODTquh/acXaKaUcWG+K6cQXuz80KUfdTFv+Mlki5GDN38j75ONJ/LRQrOv3QS5L
8K53HNxm5nKvTz8hkPHFUuBPK9t/x7gr11BISF/rWo86p6se49emS8UhMUDdJJg98KHg1Pt9LWo1
2f8VAo34gzVP9Im7+KZRs+UcFqg0/moVKpJMN2UWXKY1ac/aWg9S/XStQOUUODpV6C+CuwurcqRg
RiM+Wsr50s7ymT0qI6/zxwKeDjVIHwebVX10+/DRXcJHnXfg1fg2VV0TYruSEmtnhj5gWOZqFF0z
PxcIWYbh+gCnSGyH8JZm61rcYi68+moB3UJfSj99jZkn2S+nemFgoZMYWVn31VZ5TrCkCNPkeKSZ
rys1VncW0xZrzWuyGkQMkRzw13wKeJSiSz0ek5CyGafnvo96mbc9rn6PacLVidfY68YWT2P/KB7A
bibQOgUbdG7ioOL78YNeRkMXGFNWD3DgFeH61unE9+Y/7dbMsRsnkxqdoi1dLswOFfW9mvX06J4v
POYV+X6HtIljKGnX5eUyytG1ilRZk/GKqrZKVJvLvwZhTNYdOsxhge3KIr4yosBNrsyZcjkM50TH
nqIJ6518l/F5l8dgAa73pvG2cbf5uWcbdQaSu3EOI++itS0jZDVNfNi9wVJd2HNJm9vRwKWCPV7p
v0iaPZgh6Xwy+9Rw9T8ejfJsem0IDNX0JYwFK1x69xvbzkrqp100+b6OqIkAuE3l/CtlxcfW+u24
L+TCyZkqXEQNeMH94tqUuq99dWZmaUNSagPClHEAGbhlRXL+T80381l2EG811Nmzm7MwlN2kjqc8
eqMY9ACxwqrVzQf6MW7ajUNjcgc03DMA95irCVR8zDyV0CVXRCAhCe7KrIvFKaPiXGJPfj/uaMho
2bdJz/7dbJfgiGnvrjXS/navvZb8Ltt1xwN/Zc+IGRyqI4wk9L5wq36sxVNFDACSHgENjPePDAob
xUk7y+3B2FDdcGA+IWnvgplk3KgBK88/LPxCGxeS78af2QbMp+kYH6So5ArHK4UtossMk56J24wd
IgEESAt9ZehRPwK5HXRFjG47db+ONXHUX8VOxifyI2+gFJ3yk0RQmgjAbpGDUPHTSwunxDOqJeb1
g8MLTEuDCAhob9geDONMV0QM5p47YW+xqR1vnnbAqWwxx0Q25Q8e8QCqebdaNuHH7ywJu4B0v6WE
T/sYYzaH5S6YwSR9XkRQIlrOuRdAWNw9/irYOTA0lg3jciXXbvR8IRKsSDk7Z6Vfoqg0n+CXFKrs
XtDM7ofai4BXjis5bk++yBApRkIF9AwENH6sa2qQnjLh+inr15ISi66sMXitQxSpfkRgjdn1ihbj
NHXnzZ2Mx4JaWDC54oimlWYLAK4PDvWESpCK8SyChhvIqBeY2RTZJX3tzJIV80T+XOB+4+ab1jJq
e65/8rAMOy4ORaHH1REYqOgSL/eoGMOdbUGgRfNR7gjxUSiIuvPWj6n3coQBFaaxet36E10p3c23
xEL5QV1slt5LPCLH6o937P0jt/4Xjv3ln9+WFj5h23Mw6rak8eYSD+9gy3F+VOhWAa/YmaSJuPu2
Vz+nnEhLT82JrIB08rxtERNL4tCsxVdT65ssR0Qrhn/bKmMQ1OQC6Hf7wEbajt3Wapz7UMmVbi/e
fr1YzfQZKGEdRPGMUEa6bsgb7omMXcbCYpTOznjHsHG0oYNhlMUfhLUzeqSueJocV/HQp3l+wnW6
LTtDV2mHrnueSVjRgJj9OBmIkVXJ9338a8oJS3DVkUwWpR6nezF0bwCPp4TCn7TB6vNrCoVynj0R
ay6jyVQ2T0ulrQsTNfWJrs/0nm1EAdnS0fsJnU+peihuvOlUNczSJ/cRjyEew8Sz8G5OHOckV7eL
j26GqUol+yGfwJ43yM610rSb2v6RKS/YJRtYB1NhoNJ25eBWbjqPAeBmsWlhANXuCPUGtIxk2eNk
lLfypjqWK2CIDWnrxEKpy7gkP9dyjh57br0ZwHPec0JViPNif53nVEr52kVeFhHCF3lYX+z+1vAd
IB9F4pYccmPLAyMPCj01+9kWKapDIDCr7W80dO06gyhxp3hW80/v4/mAzbN322l3fRyFwDlwPqN1
JK0tDQZJPvV+wCIGNIGFm9BQUinhTJFNj+VdixkIMeOThh6go+g33MgsEh6Dypf9WfcYYkWUtaLJ
1O2oERFGfpLBwyF0TSB2H03xVvjyTeLwJsk1ME6ZX+ofDw4yUDHVB+b5T4BdjpMisrXG4j3Myr5l
zuZLlo9AvgtlEB0koEibT1Zh9ILJXKfUKcGyWvOYMOyI18BXG+sr4zt3/kkgrWkJLYe2rZ4T6mw2
chZD9nC1HX4wleEwm++w1J+JHs5IvoNiVjiUfv3n441ghur1bDgzLpIw7izyMXzKlfFlpn6jAKix
7BPpay/HU7AD5DJvGu2lPjN9Pr29wCGCsEXJim852lo6m4KPAV1DTcoAiBhuGEruwGMPdcFUQWof
NHKJELxLcrHPED7pdJCkEnch7jpw3eP1N96reRyHBgPPLAZFokukfTidsIOlnHgh0D550tl5KXgR
GMKnJ80GDiQDSzOUuC1czpiaEDQlm1sC/wkGcr5OI6lJyiTJ+EVU7YiDDOo0F3HXh6zOzfblCUCu
Bs5sBtBLlnN7UjsjdP6YITogyoR/YmjlFRpblYIdfPOsM+DIf3jTvN0cxFfMs29TnJdOJNyG46Z4
/Fn5zmZDLujRcVIW30dgs0rWemHoXJtgh7G5UDrz+f+5p1kyx6nrx5d9/h97jh954NgxGqrRhNEJ
QqQbTVypkM4drtkYr0ss25+Mv2oF3dLsmsWQjPU/LwVOKe3IjJDXeSawW0VqA51U/6bGJEWf23m1
q00v0OOM3pLtRjtIJC5eIuOcf/AdkQQJWSWATxYVuA4SbjsMRQEDjvDTo36nNWp7jGfoFh4067yH
Yzd/cA6GrwGXUYHLqVXmjmaJLg4eD/orSv+gbneDw3d3kViXYri+gbDakVpP3k/wtj2VK9T/miXR
aMJ3gzDiQDnDXNpaQxR9P0aktukb3p/TGju1IOSZ6sk1rsyCAiO1IBBvUF2QyMTyJ1l7SI1BFFgt
2Q3UV5TEbL5OieK4NdS9cIRudgPukEOww2H2OnDlA2gUDg8HHVP2wzcCP+nTD8a5uucZyT97jZLI
MEQxaFzk/IGeaJH6jWKLFbFCXOLhulX14/pR0DyMNF3oyWEClLxZsQpS6Sw7msNiXLWl4TBTgVRN
e4JCdoHlhOpHQJFXGz5c7UMnoz9I9HT9dcXs9zlPdreC/veWoe+9oqxuqkeyBEKGKYU+efF+6PB1
/9i/SGRbQ8AUkW9b+SXTCnFtaeavmm3FU/Ce9hRsiteqYste4Ib2Ck+vzqmKU1dRGqfGeuY+rJog
dhBIKfR74F8v04MrAsiOQog/qiz6RN/szM9uCiMTkDM50WQa6TsdrcnXZOoq6zyH4VXa56zESP63
Q1j+zjFoHEgvBwt6XTodML+Jv7KCgR6ZqEXR4GXsUEzjfBRSOlbJy+33kY+NC57PHlwU0eNhA+ij
GsJ076uf0XpyIWfGcGQZFL30KMll2SnrnKXhwKqPkwyH8gcE4mGzG+gsJmgiRI2WzLyBHAVkt5xR
+dQg0Llz/q72Hm0IDaG3e+XCmIbrAA2+8LYUFFEUoT0pdmfJQvezEqBGUeXyHlCiZcDjIanfuJ3C
V3IR70M1UhYkYANU7sIHuZ5s4qrjrYTdVtTGOMDcZ9E2qtdmiRTicEAa9nCrAkmMq5ssco1kjU7R
MEAYeXb5ZDGUNbQ9OTt8FFV62WK2+bh/c/lIF0/Wy3jTYuzW0ocInxMQ/l8ME+RoNNKrywvtFzzD
/6qWcvRScDUU948vOpRYbNhRXqQSHrof5B+2BjAy/r+NaHLxKxy8Vl1e1gbzbAbc3oth+AwU/TFN
wJSGZknRwJwDe1DmnNuT73YgPSBWxz0uluSI7NN4qOiUAWhie/4K1b4m9DAa5qv7JLjWHA5K4K7a
+5eFM6/QuRk9wdTlakH7CTmim6n3aRxI6emR9AwFNeg6+EsL7MRP2cpJ4d1xGHFXHyQXgpBfOr/n
c/Mj1ymTvJy8JKw595Gg//toC9oCMskdNr7nDCVnYw7aM4y7deTnsrw0Iv3zR848lgBnBGBDH6k4
HLxjL3/KTp61riLcLJElXNMaSMtjrXWpiQCuu3suzKlB5+/5GwGHNwGtYaR5V1IJfLB/eyroO2/6
uHkacn3SP9V4MwwbCRgu/gV4LZxya9Mm4T6wyFaGRXppJm23OWcGXIQOHwO0C1HRoMvQwFiJYMAU
0oyn/N41Jxy4Yq6Yc5ZQY6GM1mO8/Hl9eOnpFSOpkfniVtxU71/LilC5IUDwtUYz0U0BJ78VC1aQ
DFAsjAR55i+Mv4yBXYjdA7VzgX5OhAin+jddyIMbz0YxqnMFHksGJ/E2Vnev7Sy3NaQTqcSxXGXD
Pfs9VxtRlXymRgvQ8shyHxL2jDn/r30e+XAI7W9y3K7vh9olfXz7etzSOJuJutmj4pZ1th7wBn+/
/amdTE1Lp19otuI1jeYQDCqLA4TYoMsyPc8F0YOhw3Hq062oB716/2Wl1j9+zCzqUobIBLiQ0Igl
W8zO/jNhIKbsEZvKsmkD5gVxUpIhCZ+trdq51rXQqAFFSxOdhVezPJPdeFGCozi7B6VBn9X9Hbkh
LqlDW94PPraBO8tPeDJhDoYqUHDuRC9tIkq5r0jYqQyRps79YZg7WDK2aOOOkpfMxt/PcWXnMIXe
V/5xBuUrgJ76owltVnDCZPFZ0wHv4pjsCxzsBbEk9qLZa7r03AqpKlP+SQ0/BZQap4nbzVYlSz2k
eH6yTzPoZ9Sn4+XORsKYPGXFzCh4+1HLC4ig3WOjUXUeiEur+J3mB1eFffrki6sYpUBe2BAgoUCA
vWxLhLxHq52K9BuKCOlPoWrfPZ3r1q7rbAWB8axQr5/70sbOew3KMf40PYSwoew2PIjr0ikJjRtH
5knZJZPj4UOzs8SV2Kx8BJJXgO3itsIEfsYe64yu+eSrUtU/IGxa+ZXWuWQU14j7Jiz/epBkFEI3
1yjuG1uz6cfVuL4mBZtr5kW6XwWpnSyYpiy6rTMdiAOP2ZSANQckW3hFq+UVBLyEleETZ9yvIE+H
PtPLyxSdUulnPKXROVCaYEWMKMGyoFVCZ/9MDnmQAGPdcdKG1OUQvdbxKYO9Hvs2lUEnbhj2vjQ/
DFt7X0BdX5s0uOxWn/ko4ASYjPpo49WF6JfYixhgdbl0HvYV+7ScTyTHU1bYUTJQbQNvddpt/oRZ
jWUpARgMgDQFEunBga/+1ep9r8PVGlf81lXaZj32pml8FtM16CuPhTzvB6gX2mZVMsnXmFrgG9hS
Kx8mQ9V4II84D8nz/6STZ/z1olUtoYPBHdqi8vPBF8FslVY/6mrjWbfz7KkX99or4wwoN1YpKPPz
E78BaotxeOlXhG8VeRQWbH/tRA0Y/eJOnbFAw5pg0Z8mWtBndRF451qv3qpaMs07Njbr7wZa58CV
Ot/knVrJNaQcKiVrbsI6tSrMOvOYFi7yXcojfF+rxMCEt8SxxMIAVxPRGrA1MXvcdRmGhfG4wo/P
7uFqR4GKw1Kfg3WyshwIf8SnbAddjf1FB0WVBDo/bFpx2dKtGZuLYSEalI22RWdxWUCuQSAEsAAe
zw/x1KMDYuxbRxFoaAjAARkUCMiATBoCciARAAmCR17Yux+v0Wj/L6HsfYoWkDwnXrRAHXg8J18N
ij5v6Q/sPXuv+F8L4S0gdf8L4TwnhQ44DY3Cg6/4TwmxqJAGxvC8cB4UOyfedk++992RyH3f/H/H
bK0LgRcw//n9/97+8B/cAMw7YHIds23kAch1Wp6jpuveQ7JfGjOaKd8gj62usInmDqjbrY2LnN20
aHhQ8L14OFB17rwAAde2wOQf9Mx7bwhQ2zbQAAkbNm7ds38vbs5B2ET547L7yWT7zyUKdoun3xNr
OaMZ6ZeGs6CZHZeF0oRX/feuAAT1wcVBANjcVCA7jEoP9AIY2V0ez66bADCn5GWR1HRKVUJgBaAK
IgbGC0weF6/7uGY/8OQbYHhPCbH5DyDkG25izCAchAMxW0FsgH33n8ou52/uru6CcwSc45wwJrNI
KEG+pwTMPu3oW27ZtochB/f/+g/h9f2v4vb9s8p6bIxvRPm8V1mlruWd4xE9zDfNYyO+fz7ux+xd
3SGzkA5fLPA6LryfE7GWdQiCrvyuFOHbK7CqBS7lIleqdwURC4mDByEalJ2tx2iQgKhWIAuEBOYR
hHCAAo4va+PqJQE0+pWNBIyJhCKb+DW8ghMwXp0vhIlRzuHofu2TS5g9B/6f5v+mYgzB/+A/s/sf
2v7sxbaGYuQZiAMwgHIcxhtnIcxhmH/D0HbMx8gDkGYMxgGgWxp2ghp2x/C+EDwoeE8K+kH0h1Nw
97E8ag85Cr7B6DH+Bpvyf2nPu45Ts/oaxZdOC2w0ALZtjTg07QbZAPCdf694S0AeF68AAAA+0AAA
IgDPoc3gdER0eGpd9HT5PN5PPn8X72zyOZjgQACCyiB5O2vygBAIAIBIAJyDWWU2Jx0IDOUBCID/
QBQIWt18WgFt8dfncaXAboh39jUWC0gEAA2P4X3wcgDkH+H0j6R8182PpA+n/unyPyL+7Ppx9OP7
r/dT6f6Z/dvkfkQAB2V2V2V7t/m91zEG2ehe6/3h///2f3v7v7h/f/YP7z+/+w/v/u1lfwNg+Zi2
7ovf9ZvXaRo69SOVYPq35GUYX+x7SAWLA8L77z/fef73z1f333vr+17bJ+L6/rdx3BT2pIU9o9ce
uHtPW3e03ELIqCgBwCEalPXZx2RwgNxWIQgQD916sAKEjM88dZytkTefsd3HRYM7imcOOrQBZJ4R
t/zz+DbcmM3n+/4aRADJpcxegUCXkOYcwbbtm28g23MGYNsDMe2chzCHIQDMXIAzAHIdt20Nt23/
rmHMO27b/0zFmPbOQ7aG2bbtm2ZiD/a2AC2e/NO+4/9wD77zgdB22f5ngdHUvmm1SQNtRwlbbT7s
J1dFVcVPckH46P4lcogYv5j877zSQ/IMlFAAaRz8/YpBHC/eqtpyJHZwAfpYdrIAAAUEALD3ngWx
S8XjOHFMjgAjxee4vB3QkSJBARrwQbMkFbTnwD/B88y6dtrksTiszCMIDUUCcIEB/oVoKgCxzp5n
WAUstjIwAZISRIQADwmxuOg6+TAAMwf5Q/zgHu+2cg2zMfIeQ8g21/eP7n9/94P7//8OQbbtnIcw
8h/67ZyAMxB//g/t//QzB6DyHkPIcw8h5ByHbQ5AG2gFtadbYAAafbYYiWHIJLO0fTGeZIuWI4RN
1y5h0VXlyxfwXCz0k0YVHR8+yRiAeEVNAMIABWXXZZXe7npnlALUPZgAWMm3OQHaF+tv2y8SoNuy
HeK1SqSxy6urqwb1QPfq0TUKg7t7wOtD3/F64drJwCEaj//9f+DhPWx2UVwgVxgQAfyAVBeqYSBV
3fBFRSUB+A4IlaSTIq6w5Dlk7rX6M3rEBvebVlfYxrFBjnwkmh2NBINhgfe+QeV5fP5x5/Ied5w7
SfvPJ5vI8nP+/9r7nmOfo5/CDn6eY6XhAAeR5XUK/McQDNdt6pPWag5Nw5byMPr6VfWzS8FkhCNo
5NZFs5fTs/FPxXUUUV/fTl1f+vv7u+8OK7u7uK+u/O83mAAOcAADpOcAdHggdLo5ietjsoYIcYEB
H4JBVRaFpUBhTwDV+vtSgDhs8F+bbt1XPFiL/mnwFigvwBtnINO0/QNOeX788nm855fIfe+TygPs
vunRzeH0efsLnzh5PKefyffeb77zPJ5fvPK8/n8jzvvzzBozUFo085oj05DZRgEYXO2/Pm7C+c+2
rqaxxsJG25TDM3TzAA5g5jwefpDp8Hwujm6B08wc4wchGpT1tcllc5iAbkAiti3+BxTRSQChIC04
rDoMkr05uyLZJIee+QdL9knihwNoLOozInrmc7yms0gs56QgltaDoNsffHn++eU+2+4+79v7ds6B
bOndcaDPf1KxjWIsL9fsZf7/jAAOQ8g/65isnkMEms0gllTXo6enmAHR4HheF4Xl8zz+cPN/F/GP
bAPa9f13rfwnrv4nr+t7b+H1vaPW9f23t+09f+H1gAB/xwAHL3bADeNzlAOV4XhAeF0nheGeFzjp
dHhuY5+hL2lygVygGRAIwgRSAQfoT4PhqQaKIGHTS/4IAjBH3YporcgwxcuOq7Q1NTVvecH33lH3
Pv/vB/EB9x/6P4vbfwfwHrgAet64Dzn0cB53+4Po30Y9D6Ef/rz/f/8fugHxAOfHn8/nyBw5cebk
Di5uXAOPADlz+IHAIRqL///useEzbHLYpIAnFYgC4QG5AI7Afu1BKoXaDUDc6ZykSsIYqWxfXOVy
UIhGPS02k0/xlVRrNs26P3uYg/heYafp1s6ePuPuPtj7p937p/cANOtrTrZwcFjgv88fz34849CD
7p9P3n9Dvzv+/d+PigPuAPuB/7PtuQfwb8x5iAMwhtu2chANtzFmMAzHyHMUa6fbYAGnWxoHgOYA
AB0c7mADzAA5wcwDmAcwdDmI+1OYBuGxSUA2FwgRguMCP7jXAH+AXrYjjYeAZiMcwAa1ZObUp2SS
+9rSScDXcANA1/AwVP9p/Y//x/cP7H94HIcwZizFyD0D0PMeYds5AHIfiB+8gH5H8ID2fxJ7N8Q/
LHxHswA/uz5F//Q/L/8kAzHyHMXM+nWwABp9t6D/+f2H97+5/eAAAtzoxvzyytqvC3zjyA8g8wG/
bub9uxyDeAbAOCEalPWyi2VhwRggQSAQwazrhxqgURWkquQtlbiARxwXoD/kEkA5JorUhbA42rmT
UG2ITxcoKbLARy+HNetKCHd9PUjicuWs6hqqw4BAR+vwHLOtvdifcXc3+screO8fUXF/MzC54yz9
xYQc2xDfgKUgbDVCwpuPPlIM07kcA9t7QkSMHks5CW2C79ljvP2SjG3ShHVkiDkhITC4yrE0BMjo
uUcJc5uNSw6bBvRNL0u28D+Ol/hmuIGc/WtTH3B1B1YQCCAWx9TOpwQJuJDcGgewAAF3jBXYl7Uw
rFSGEQWHAgIJAIGwNfEwmIKtRtQd0P8AukkthAJ/WSg4shaBy4JTDFVYjtc0sh0FFmm6eznR32XA
OdH75nEH31Pt1crEHW8JcE7/QXCjj4CsYeyOlD21SKE+/845A7Vv75a9rrU7U9eqZh/HQXfssd5+
yUY26UI6sre6CBYKayed/99YGjz6J+Pfyo52y1HfaqjcFSIBTmOmdQT6EAggs3gCCCMOKKXNiiqw
qEr5L31gACWsBZwhGo//v0rgITl2YUioVhcIMeA0Hx0AJJSvPhbK1Dk88nvqebUWZSYlyyxpR1Gw
iCHdtW8UmeCAKGzkQ9OZVg9Xnjjn4qbwBozgmgxxJUL0+2RH2hOlX6EUxPL4NhO/6chT6JhLK8ax
YD54jP4J+Bapve4yb5v0oAsJGGLfHMDgGMGGxguZYYb3wkAAq19TN2NKbx8N6j2fkPZ7rn6JOF12
kslGAWut3mSGDaVqq3rB4PO6IsoE/JhVU849BzxyKxMP1H7Pphxt5vtSz/30r7yUViAUVrAMCUlD
cjBsMCMIMA6HxrdHj2tqXlcb45DNCYU6G0Mo0eTI6ZSqrJNxwdJgCeUjyoMs0rxZv4/rWWdeE9OD
GEP//Hlz5v577AQ0/w/wB+mxFmQi0/5vFBafRP7A/udQPDA9flcrlcrlcog6/b5ObyUkhxZxP+UN
tB/MLK78kna214+34H444VlvxoS3ihnefkMzaVSklOq9VTqpru1+NZPjIcAhGo//P9/oAS92cICk
dhcIMBix0AhLpAl4OxsPJhKRrcnJtpUWW0Uk8fvSPOOTkLoOEBoBICic7B2bBmmxrSgkoNKim47n
HPpNAQ0/P/1DEf0bbDwvhfCBtoZgzHyDbOQ8hAA8J14LTkeE2JtnunHWf9cw5h44C0QeF8KGx9s2
zbA5DtuIVuYLY0CkdP5D/eAAPZfEHzf0v9g+a/sB839KD5o+kP7B/YPmxyD/PyD/HkH+TkIAAAAf
2f3f/wACXcV0koPACdKlA+7dch5BJicczWTwk04sjmMnwsHrweEl5NEBgkG1wRjt+ohYEEzEHINw
pNJr8wbYG28gzBtu2ZgAOQch/xDkGYQ2zkP/T/D3f0PMWYeQ5h5DbfXGg6cFsaf3//30ENAIkPYh
wIEJwhCR4nHSccOAH9jPmvpB9MPkPkfpvkXyID6b6c+QB9M+mDghGpSl2cIBcNikNhcIFEYCEQAF
oBZYfyA9CrQv+JCiwhzDuBLYIJIyBLhGoJYDtBPYdI46iiQf9PQyBS/4hyEgyUTLK5D7vW5aDo9d
gAacGg6eGg23p22baHIMxbbtgcg5CHIMwf5P8tAF/z8dZk1mAFwIv+PIfdbeEHZPZJAQveaBbdth
bQBmIPdg90/xD/+AA/sAAAAAA46IAD3/vOOi977wAD3oAB+RB+H+H+H+H+F+FWpfQv8n+b/PmLbP
Q8wAFBl2wH94/uf3gCoAAAkCAASwCurhALhsMhBwHAJWRDiqATSWaBJpSJSycGikzkAgsuBzB/mJ
FYQKz3YP+mBl9CDkPoWgaCFs6Bp+nBtgByDQbZDTtBDTgDbAzFmD/p3/12Gg6BbG28g2zbP+m2W3
/20HrsNP0ANA08NB0DQfdwAAAAfbAAH9/9p/+cgzHmDMPoG28gAAAAB83/Yj+w8hGpTtsclkANhc
QBcNhcNhAojUQDXluBfQU2W1g9vwAAZi9DorIUTA78qJ5J8UlFlkmFD3TjrLRR18Nt4cSKvta6Sk
Cvup/+PINt2x/aH9wB9rMG2hyG2tBti2v97Y4QAeF4UFoA2J160wcKiiQeF6/yHMYbZ7r/0zAH9g
B9x9wAAf2gZg9CANsANtANtB/eD+1/d7t/j/iH+O2Zj5DyEA2wABagmiCAqAAeICAAkrcAbCAbK4
QC4wOI3CIgEABd1sJKez8KDYtEAACNAHCwADjmgI7CxRSKLB4S0IHHUbE2J4SikUUjr3XvCUUgAD
hAAAWzbOgaeGnW0FshsbY/X6IAGxev7H46DYgbEIgATQDYuxNibF2NsfwnhfCgHhPCWkDwvXti//
gAH2wAP7j////f7v739j+7+4AJwzAGYmAHhgdBYQAWMHIRqP/2f/0aErdnEAZHYQKZAIGI0SRSAQ
ufACYx92eFIosEOkZiiLH/UnYlE9vx0jLZgI7/7+s43+aeuQ8cZMibNf3/3/ZqdPD9DqkA0DQQDM
XIMw8g5CHhP0QDTttAOQ2z39p3XAdc/7kxPJ2MGRoi/PkxPJvFMl2ohf9tP062+uwAP9tB6604LZ
yEINO/vf2gAH9gB7I9n7P4n4h/lPZPZeyHsviT/LPZD2Y0HQdB7978tr89p9tgH++ngBI7oAAB/I
Stqk9lkdiB4AOCzmHCoDkHIQ8KSgA6/seiwE8HWuytmLbf+1mitm29B07/tUIu9PrzZ7afID6d/d
vmvm35HYfNAAad1zoNtZi2yty/4ZhrUuT2Vsz0L/HkPIeGh+hPQTxaYPC9e8LsbjoA8J/vgAPiT2
YB8iAAAAbYHINs5D/hmLMGYuQchDMH/UAAMHIRqP/69/0OEta5HQXHZQFYpDYQMInCBADL6lreGz
jREfcEDN6SkwxAWjIwdyRa3BFEJmNI+JciSkW5dV0gQEaxhfU4I1yyGCfUOOitnrnQP7s+RNz5rn
uen9+vrt5PN5/u/bB9x/7cdDh3Ch2PZ5bNLUYPAbk4bZF+nIAATW2QDTgC2uuOurb0HQdAAAAAAA
AP+uYNs5B/120OQbZyHkHIds5CGYvy4ey+J/yo9n+WH/fQLZ0D/brnQdAAA0DT9A6NsAAADp8MCi
tQiscisrkBJiAoOrwP5vh4YE0fQEMCEuRcudFmgtucp7/fhFpcaMxHAH8wcgC2bZ0Hyb9pp3+AD/
uWwGnW1oIeF6+FooJgQQQAjEhEJK/TrTF1x1/T9ADTtB0DMIBtgbZtu2/b+4AAeY/vAAP7v7X/7/
aq6gDvgcIRqP/67v8KEra5JZQDYnHQXDYXEA3EAVCBAJC3ACoCNXQWanri0AWhgCXGEEoALpeT4j
xEn7y6uTrZ7AZZIY+OA4ljcEBwi/0P+2gTJFtnrkHsh8p+IfTD/JfIgD/Gt2UHDIQy5j5Bk8uY8x
7Z6CSKUkyPQZiB4JGrRI1ofh+YK0Z/j6FW7MDKAAHf2g2z/30bm1LmOkdsAA/9gB9r7YAPt/d+19
37m07VtHPcltHJclz218lz3/sPtfcA+4zDtgcgD/EAAAzGAB5QPKD2vXHtgAAAev08zpcwAAAPMn
7PKrM4QC4gQIQMA+D2aKoEnKBGhAN6vBux6KhomIdsLnd/ow/zz2XzXqw/+n4kG98ifEB/YPpMwb
YAB/0s43EZch3QH6tEev0Sjr/XqJR4QO/v9gAA0DTtA0+2bY0/F7EB9StvmTQAB9z7oADyed9/9/
5fOADrIROAAAANZBn3VklGRMV/STKhufh/qbwRhmFcfz8ldl9X9blY1zP2uZbJVz/sXkhOO1BfLO
Pyxmq3P34LPGeMZN2dEMhTInQ9aNYYYvK8OcnwovSdCaJYaiVBNz94ZNZMgYPwqKWOz3Igu6xjtJ
QeTnopbF/2K0UBJEOxvpCI61o6DzMVUWcIuYSt2xHB0Asd6RZXD+4dcnBzpamEtPv4Ybckwn6U35
CRx464kWl6G272/Zu71fLmrIRoXUzKKofVD1b1Y7Ny7S49AigA6FGasJWG6EVuGBsMXBZe2vAAAF
PwGflm5Hf/2F6DgTnWNeDROhS+1vTr1NWWD+ukNVkF5PQ5BFR1corbWj+eKYrjF9slsVULVitX5W
9FDCEznSUbJ9YtnSEm0TuZ4E/qqJcewat0nywDgFl9sRFOUYRDOl6Cvh1WwmBFbelu5pV1ojPfd9
uMVLZdCzAiOT2i2+z5wze1pro6oYGgV3YLFYW7Qzl69OBHUYGnlZx7rT2/lMS7KnNdhd3u1JiaxH
LainJIKPYHM5uESz1RD75CPyx3wR7hApZCDBZ3fqx4fCYm23gOQ3X/+Pg3JkJTGvdWFi0TyaVWVR
LU2RVHJJvpDr4ZK0M/p4pvjUPeVCuL0gVqmwv6GuZSl3OpLZ1hpaYl+fUXZXUpc6ujx5+AVgM4lG
vU43rpOfJyHTO0VP45FHgzmqmbwFa168Yd85l524zvgBy8esL+TAcM4VJH1sXm1r+F1H36/P/YDZ
jK1pdTsp8UWZewx9QfPdmdfxN6GZb8UA9kqalnQh4o7lSGMZve3y3MhRa43lAhJPiDT2vqzrbZNL
KD3YYRFnK08x6qAmDZNJXtE8KyASL5YastX3lFMbbMhTqm7/eBdNavkf4heRawuIcqoCOqIx94Xl
MvugIx7IXUxTzR3VnExqDz21mcet0DkvoKWqibZ0vPOXJxlF1+mZqqq04HLH8APWW7WW0AbCd21v
rvlPcONRs5u8ucVhIu61PDSdZe0l64S+WnCrJXYEie20HGpweVJfoBclBqy93FL+C3+gtR1XnkC7
eM7E9ElznMHN/qGvQfHKVqBKsJHjghhagcvseoHFOPR8UcfRBhzp2Sz0ixqWnKuqPfckw+RwOXUn
fBluJZI8yYXZqyQQut1igl9b+q8chL3jUEHWkGKFvXeyzf9en1XrBZuwBN4pKtOvsHR3vf3bvAam
Yth3DxPgDbxPpkra224U/P7MLH8FfjVdBNYiwhxF2OJZEdysinvySTzxgK6LabN+yHDDC1CkXYgr
MO1PIFGNFhGSEn5Nal/meheS2dMxtD2ys2GQ1Vb9K25CIPV5KYbpFFToNqYXk6KVT5trUDy2nP1U
09Qg5kMto57J3JhptkjsuRO1w+GFcrwPb/UzbM0SyAV+dVZPjpAGOhnk5YLvbGWP3MEE8HlRwRw4
sahTDEyj1+Xa36Ybnwn16LhoyC5sD0U4G+adWZ2mxtnuECy0tpd8uFzVke+GrskODSKeGUL5hqTN
WwKF9df5+IFQXR/TUMv8pzSTMi4huVef1ioF2lBA8aP/TXNDRFAVlelmXgako8L6XMwm2gUYdlnb
bhVS91EGon3PRVLlPp5h6656BwMyDl8+B1r2HcbVhpCR+PK2hkIuLqHKfMI3sqBgsdH0UIHxmhv9
et6r2Kduz1vgudSOFmXZkFTu+8mIKxAC8FppUA+cpsk+puTSAYz03iKU2VqM8lGpcPz7y+N3UCDb
LewAG7sp9Bv1eBbC1Z8c7SlXDX9y0DeqWoXFRDH8ccFQtoE/0jEBaoK4Jm6QstDtY3lUlXax1gh2
F1B7pnK4Ck8ktt1JXjZrbcHHNiTNzUJc0ZikYbLdGmi7SA5NBlSSyqNsrPocl+wa5As9cU5ULaYy
c5r1beSnLfupmf3FGRPnfNe2v2e/DJebF/L6E+lOQ0zmaVkVnfMjqG6ltM78d9Bugorz3mv4+ea4
byQ9K6nOWmoCZi+URl7WfxjB0X5oG8VlSmHHuoh/Fk6EvTjed92dOAmNJTlaoy92GtDzfS2zqI27
CcoefKyNqsFPIB0dd0YsErEm55DCQyaXrgmIhDt3ijX5AAAPSkGbmDUILakymARHvAMJiNux/60E
xWqZkxaMTjXsSAwi6YispW/Mgmzxnln8tQ/7dYuTHSX9VdT5RZ4rrSaRhR+kP+KwxWG3kEfu3PUn
LHvk7KRMJ9mFXZWH3LAmAeQNmjqPyFGTCLvLDULfBaTnQNVrwYuu/iNyyumsEXqIl1N06BI9Vqi7
b8Mofd3q/A+reyN6P3W8t+JOj5lfg+PqQmKFLhniRkLH7bbYGIK1B4VTK4VUlN/GQeRV6bUgi33l
t9TT6nEydmOUWYmeHAAR5ZPyZGKJxRwy6RA7/Rf317lyTKt9erbBPRDvuyHdXoNvICAKHCNxfBdg
IEqnrSRJGqrBwtYZBIvzWyQmOZ938ePnKVF5YVVfjD82qu0HaQGm7p5iccloEVIShNlp7ll9FqoK
6TJdFgi3+0ieGL+hJwwAqYn4+PM4vtck0K3CgDb3YByIm+FHmGqhXZzcnUAiGPY/24qWqrNtfDrd
8ByjoIPj14n8jDnqHGXzzcQyQiaQy+XZaz+W7vMBZKZlgw4TkNZRXMVLlHYAlW3QKz8ClHzPRpBp
Jo+t+EIjtgfXkRT3ZtDbB5mglKUcUfhxlkLIFkKkRRThg9tTssVkUouV0n1+ge4d0VAat2cKJu8a
UdiNNetwPgKMAfHNOOm4EnqJSNNWJwpCck5GI3mfh6sBapldOrkHoDiTdToXwuNXcOmBrkg98DdD
YZ59kbntlRZCOidz2xyeGBWaJd02BC5uZfYQD89FXgR78/Eb/UNMfNDu5zxdvTBwNM1f6jKsOs6S
PHqgpQQ3jMwS9oVpTfRsQ86QknE7viCPT46eWHsb5Tjh7dleb8JDRRAzQOtlwh65avYNZN0Q9wI+
+h2i/I3YvxGMVBhyxSM+Lysl+BH54qboq+21z/nWZYeNWBIc0d2OQobKo0GXd7ITARf0wcdZ0k9L
bgFHWU2fFDY2Xly2EgFRtufx9Q7q3oAka1nyyLD+HrxAYCLGcnYsD95BB3akBGW1QXa8Pb2ou2+G
MkJe/xr7fjqKAAzRulNAztRsdQYA7DXS0bdwh6HM58mgsRf+2zScShS/L978cyKGgIQJ9gRndqad
Pw4HX50afnYE8+DDgdcSt5+xafnTiIPlMcqexw5y150aji+K9xRQ4DAUV8geN58bHXbqZyhYnAEj
RwOyOmgjv9aAe/bZvZzpIyKvWW4B60JKnkirICHs/t4i/2ON5ZsM3EIWVV6iz6oNOVDK+Sm+B4HT
SLp1Gt6omcvThK4jzhW+sPWhEViiiRQrRM0IKloqA8Hsyx3o8g34gDy8mpK2aDvv6vMk9NtMa4ZB
EOvKnpw+MiJgAfQ+tqbUWHjjKpj3TZnWyyWnM2K4yW+tgbgq7teXbBGdU4JyIRg6o76FeEGryMvl
Nq+QJ0sbtyoFaIYgWiV502kJRkGZeNdYOJzN7FYRNR4l3obkK0vmVQwrTRsaVwbeB9p1WPr8NhQu
VjEO2W7XDH+m0Ayr8mfVr61aOh/LXcNco045+yw96TgJyPr/ceqptvyq116k//dIF7u09eHpJy5U
N9x+D++FGcr7i10oUAfp1yODFAIZI0oDuXfg7mtnqf/kbZI99lCehmfUVaC1lczJc08kmVYZm555
3qt+gD4iLrYhfHBvlh0PKi+MOmsPAZIulwBVPjaVCj/6Ck+SRa6XJhaMIlMUz0Ne1WQKQHkTFehd
LObxnBvdZUmhPK+2pdesSzohIpqGZon8yk/2DMQ34tH1rpL4hT7BLOY4seQW/cxp0PAkCWAXGwc7
iUiDeW/fvR9kvdhA2GxO38fQBRwOCCGcNOlF+2e2a5IFZfOLZsPaYYGsSXUsiRDyWJrUsODfbR3U
ZlJPjaxEhPJQAgbp8M+4yEGmsrnystK6OBhwAYeFFmslDmDKfqBOu4WYm3mSiUs6+tq4ivYCAfaX
9Cn6bOCBhCCYyd64T74HBmPZ/UAWUaPRoUIVM1vx1ZW5JOn3DBUhILAdJsp67WpT3B112BnM343L
TfrGYQV7635pmHwrIPhy046/eWwh9+Aaw9y7O3yJNNUjtUXCatloi7gMS3lc1K3yQ1MxjOdZ1cT/
6iJuR0Vwze/uESYeA1Qco0PeJ3tMIvOVGB5bITZpCJCDBBtN0ei0WFYPI6W05PtZnAozFYoMznt2
/3zC6YLY5rAPGNDkeMKul+kGBpyggEL2hkkbnPv3S7ue6AXiGcrs2eTwK2/bLr3cqkILXQM5QfBx
BuQwKHHAaCxJATlOPQCBmX+VwfQBLeHopaSB2dU+luYeEAOE+TfBywLOHK8lXMAukQIlpIkIF+C+
wbUuL5JBwQhktmQrU1DQiu1Za0dRSU0SlfZnu1axsW0TnxYP6olA9IUJGrjYADqQv4asF91hyrRl
x+Oe5n9ARzkEYQlK7RqixXc4b1HrzUCFIEm26QAXiS/aiUrHANrMG0KsnIt9GuWcFZXB7W3JXqCp
GcFlfdZMZVg3EzCVg+jaHD+O3ZUyCu7rwNw5s7myHCfcdDM6fYxH98mQwF2KZg4UvPorHDJPwegG
IE3FL7ek36i7Gic9NoaQvxl3ZyKI7lp1uFFTbrB/6miNcVQS/TemdphtUgD6aooRKM2QY0kDxnJr
BjbrTdGCzkog6QZ9FO/7DSTzoQgJ+LKGde0BSNDEnZZzxBm1YkuFql0lqsBp3qRJT/CU2i1DNRBa
ayx+3lsudUEK1qmfK3IQq4lonaikJ7d3VVypmyqVdGEiFIzjdDF523w2B5kymlCNUv6U5u8PyZEn
UpLl0XuvfPSr/V9za5LJ8ze1vBw0o/jTcIs4sMH6sV+4fpg/5/nDB9x9TCX/MGFgtvT2tad6WupE
r1gaweSE7n8SR3Sdw3NPKJSpcERWeVGc9+h2Ru2j7qgK9TRT2itGxijOELn6OO+5YG0k+T/udSXy
gbmoVrJl1cO4dbnpRn0lF7UIzC7Ks9RcQFhFHT86vZJH4+LBC9jUuGs7qv+2Ywc7UiyaK3iMth+g
x41RFN/7njr7eIWE131g9X2OWAlHM1BvngF/CZqyymJ/LM8SbC4phGIa+2W/atHjOLnNpDHJZVeB
olDAn9dZ1dZXRdp9V8J5OEa4M/+l/8cMb3aNmZdRkrQ3QzdXnT5DXDb1UanKGT11FAsYWudP9pm2
sCXGGwgTCsYLqp1g26QFQWnvYQcHojUPcCuiUiD/HSVRW7QDgBH/E+YGWb6bcHr1cRT4l4oP5h2S
mLLZit7lnReUsMqtXeWX4We2dl9dgdqjEoa2tDjUpLpoZEaxj35MZKzaIMNrWsxATZsHQFs7F+Sl
h2cIYAgjesm5w6ddg6EVSIb5FukgWnEKhsN0Q7Te38XI0/UcRS1J4wPmty77zD4ovovDahE+9URa
0yAxuGg9RoyI5genSzw2xO/QQSTgB7bDK/uUMLFlQXWfIJaLgFrwrDsxs0f2b25nxCiE7SdxeImU
yOHlj6YI6w9+vzEEqIWZ+g2oKcK8N+6dQvsWbbyy3Si2r3jQ1VQyFCdLV3lCUcFqz3NHRkHQZhBV
D4s2SBwFWxLGJMPwYcBNoHe1IVrKozjIBdNOeK+XM0/b4c227x5gNEyMmfBDW1+uzYFRpEmcn1es
HKvEzNYmm6MlQ3HVyGVvqrN9VAA6WllZxia6/5ii30W+gDWgCE6DYUyXX0mOyjJeEl4vWA1hVx+f
2fLUjIEaADEVnHS0gJZYyBrcMIcws3C4U2zgCNrx7pYALjbLJrWj3DBsOcKOp8phKK3eHTQmauqc
qbucmv3+WIVDGb8Mx7aBCK6hpQ4qMNMPcbSnJtR9zaZUyNekWI7pTv6RCYUNCR3WJT9EYMIJs3DW
nup2niQOQpJaMeZ8wR/gM4uOZgqyFmF2jTSdX56ILRIyzIAPGg1hXMAJlgvMfDv0746cgFeZaXXo
UfnQ2nNtcZDJOdwvOeDAeu6w+J1bFfAcnYSsNhXYods0mZA4kE9mK65Ubj7lpljOzBsQdB8UePRJ
grPD4sCqRSDSvL3coWPyIaulfKF6XmtpTZ7VCfUWZ6He2ok883DWsgku3Oo9Pgv9hxjRDQIGtSIS
eApCKF7uGaZ3YyCagYiBJUP9rE88hwyfavtbM7CW92iFduNrkKqHXxUeHvzaV1Bi6KimGA7m651J
/nvvx8ZPE/66HkTmCDvKLFYjKu3MfcMKUQ+AD6f0bJroQ9ZeOGIx6rDrDNDESchhiZdofd+f8FE3
fwYb/yIYwBn7BR+fUg7Ty1GY+o8u4B3vjG2XkZQJhnm382f8OzPz5ZdqLMaF9zprTNzcusRa9i0a
tt0sxmt9WESwSuLK410BLzfiFGE7XMG+KGSkOifyXdQ/aM8CFC/zi9xp1MFU2AXZo8OgyCX69Ham
H1f1azoENetwkM97nNE0N4THn45F2uYWDNn0aCIVeoBOyXQGzllIrctsUWeUEt29Kft28X0Qp1Cz
OakVBH7xI7UvHuHOxSZKhx8MLzasADIN0j9T605LWBTw+WEyPBnUg9Z5V5gw/aws3O7K2Q9iqFR1
wALx57COelFVK9jX2FPSCb5+zJ48HpyTGOo0rw2GfqOKDN2KkUGNHmoXLct7WWPvjimwd3aiVDfu
OgE8Xnik8iRW78f+k5o3zzcCfNIAO2F8YxS09PC1NzDnDW5iUdYYvDHpfWAHeymlYejKAaQ4ZFUK
Xeiv3GsVAV5oIyBU0LqP1OZwVnmeG+rlaw0b9QiiaF/m/3rMmvZFapUgRzszcl5SEaj5QPySl8aN
zmvP5ARLZZHRGWmmMvmrq5lg/nIathqN19h0Mi49o8U+x+3lzRDfdGIr0fRamVYRRzQeQ//qhYvy
xHSPbmC4N2YWni5Lpk0emCiSBlt1xPOmylg15aGQgAJf+mzPiyO33yLR79fF/lbhN5706TBR5zBL
BdxWcx/g7CYF6tnHDisr9SnGN05F/0KMPAxz/SMbhh/oFuRE7TXAriFr9aLCrUyUEGPwiPns6oM2
EDV94HntaQUCgoOBwagW4J6Unc7WN0W9nHQ0PMSU367TuUVGI223ZFTH/dXEwQLYPysfkMboqEv6
6PlWqVCTN0569lx1SseR9axk59n2u+9HmaOtBUq6p2qFaTLLQBJE6fHtRlVJq/RFxYop1KgKAcpZ
kgfRbKn0vl3vueg9aTQeda3yd9v3ynnlQIxZ0Fcrf+bCLPzV8vXPgZqbKqkzyHzQI8qU0ZZWObrg
nEgNqMncAX7JBDHlMBxv4/TPAAA4PkGbvE/hCEKW1IfA/BRA/BIACM/jcTxr/xq/3v4+x/gPKlPn
KL0Z7FWZQUQ8pF4i9lt2KYJMDe3Qr4xc4kV9scehrAxxpQNkuUrJAytzpKgzrUmyGpftoLI3DgiP
J8pT66GaN2jDHj0QwiYHheScXhRc12XycWs9TZd/q0joLzOvxghDxXtUtzN60luqnuBJ8mdM3ZrL
RgMqjsJJ1O0zm1/F8ZrBW9kRfLSGsApUNgRwlf6TWagshbVcbJejNqrLbWUlUf3rf9hQx/4jSXvY
iUjccCyB0J37QKuLlH6+rijDkn7luI/1ixYRsubW6i09zHVlZzgVq2PQFvhDTGt4D55FT5diUuue
SI92Zp60zeqxzh36tX3PMLGBEl3b6i2IuFWovK+PG38jJAJbJ5BkPuYguWCX5Ho/X2/FR3kI/r9h
LzYJbGnD48h27Dn8CQRPjbpubzZ/E/oeVwarQKf5pXuaQx9iXGMNpDFYzo7g8OWJ+HFoOAs1br8S
frG0dNvr74by1eb0GDqD310hky+hIW0g+IT/Pk1JeotvrncDK1rjOxi2ttjH5FdvGTfFl8TBOtQe
jP6LXazhn9iQyjYjwKfUUGyLheVZ1cHtgYJBn83kApwdzNTb3rX6g6BfJdW4nuL4Wi5syuGyi87w
PdDBwdJeGUFbZDfprE2V6+misrnJVbbcFP04paKBrAPR6tx5hY7ij0ua154pUOmS03pdJUyZbIrB
/UGBEZ5F+IyDGCFR25JsQ/V8CYLpxY76gPAINAfwfaaHLMH2Yu3HLnH+uqNjDta+6bbzhfV0Vau5
MnCVXRtX+psmenxIuvyvPO0i/VVw2nGOi9jlXx5ZLD7IQVknUv5T8Ip23WA/z2aodvb+ub3Yr0ku
wFPgY1iBQ56JTKD+b450u4kvllipm1P37QedhgNwIj9fMivYo4QJgUA0PpoWRPJw6KsnA0Sykisv
naGJY4KSSjqTBLTs4rA2YeO2HlWPKV2LkZeGPrCbFpKKyb7Xc1R5TsVzAOBaL962qD0PjthFmLXM
+Lz4pMLWdA44vb8+VlRhZVrJS6cStalJd6ERiWaMbtWYXqSuWIgRMTgOULrmk9co+Z4WELIJZvGC
fZfKi6MPF9j/jBfJGob4+yylSxN4HqVES7EGJM6Q6drE2VEdFwL5pfN3f1TjIYBDn00o6b1IYk00
IC1pFEFKWxMxdCaedMJiu+8Xa5rdInf6AycPwXhIxCI4a9Joe8l4HS6pijmUI6ykp175ERm/hFQi
JA2yaB6fXft3rk6vl1Wzj6e/YfUeaYx3RItQost64J6OhsdXlrlkZzjl6KAg6M1PHnFfuu19uVw4
YcaaaLHDHSU80EoAytFX4PFINW9udO22Q/39OOcCSCRIN5ChnDQbSjnHBxnpZ/oTd0Nhr5t2kAeA
+rsQ/+scQcl/qdqlwvHuT316EfFpRDJB5s+jDOZ+uw698bgjW8ts9gTA2VsDQyQs+xmHQPZIio7y
kt8RfUl18f461J45m2GRlm/Vb1er77mgI2dluvkYK6ioAtEx/11iPnmDnDrA5TcOoodgsvePt0aU
+Bf/vZ4HlPZc/KarpXDR7hcyQrpsBiixSwZ2cbiRTPL9ggRMy3nhLEXQU9oJMguV1TbzAOoB2kLG
Mle9NFBP989ioElCHe9kQDOKB4GGPmFr/w64/PQu/LTrQqsPAnVpZr4+BLAafEUZ8c6F3TXR5cVt
iCQGg6X6z7535s2ziormFzLAU5Trvkw3BMk+uFl9sm8Gjy3yZEcSWKR3YhQxyypy+Jv+YclaoO3K
rzBmlIbvwPJVPC1woCRFH9f3sq1amyKR99v0uQLR6mvyfAGI2kVmIxV2nCeYrgvJJ+cCn0LAq6oY
URI43wf2hiteSZkyWzB6Qz6FoajHF5VmUieoeGyEK49bMUPN9DdDEBWUV8jXQ4XkRT6PlkUKb4JB
kaXp3XooI0ZvOOo5PNdgoKFXoiwqexWg//CyeGUvsis1cvGr7Gkps9M/ZkNUcCyshy+a7Wv+ebpx
E7EHn99Marow9aefFGnYz5a1I45wBQLUZq4i7c8D51s2BpvkTJyTefI697yb++NWfp7iCo4fkKN3
WW2JSdd9uSqOoXsYzxoIq92R9hHUCCxCx2cBbU7qC6b3pjoH3sIM8x2d25O56kBhneGg0KJ9o66+
TATgpYARbM0RxO93cDOiHdgiG0yTXsJBhrMzsTA5fve23iEQ9wMi0BXlU1s9JikOCFkhsPLz75qX
ygenrLT7DewMdBJsC1SVGrFYKI1t4KawEQomCxJubUKU/mHmqhmjbfbm8J3WM1URGigrSLy9IOa3
htBb/T39h99ZDYY01T08p5PeDUzQABQr/LGQPmU4miwfmHPX51zbn0XHt5jDngW9/9pQD28gtJmQ
7meUKsLsrtXXSLnIc56W6GYjpPbHzO/sKD+0GrdzHuE5VI1zwaHTfo/zb0h9F5nM3FC+j2oGFYvT
G1Dv1IRyTQg0CpCDLgPOp+Yo0MPGK1xYbfuaqapVbFAvlYlIR7lSGC6LpMebqCe9XewJEc3eI6aj
PUZSrrVt8FZK7Gwn5kMSc3aA3PlDaFibmewKaasX9It7r6yYfsHRaz01nCDffJ8UMkY6WaYe2kSR
TQshTYJ3IW+rQk+/h2VRiyXBLfyEl+iQGTAEp9H7V8/36Md8H7o4tHvfU7KqzXMo12txeTAtCRz6
0SLm4GkZgwwySEOSRkNOXSW3in3sZ/3EoC/SAgGLVuKVHT2MFG72V6rtZ6SEY1kQc0EkH2CC7pY7
g+iGgfRAx0AnfoKUlhGdpGFn5Mxj4GjDru4HJQLS5lsmFC+K45mazwFCHpZruzHNIFosO/RkmTn9
ML4XX48ysbOkDUTU/l1xywmnRi5wZXrARWeza9QNvhx+i172jmzqnJX6yXTECDrbIduBaKPlI3eD
LOHr+fwFOXjqGFpPhRDVzeFVmQJ4qwqsXR79vC8SvH9RdfkSjHjGeBLTO4nNOjEhZ3CLUci2gDNU
0GJH9TkzMNZVgykBZkqCuQW1DbY0vY85va3h92PJRac1dN2J078eSI6N1WZRYBChg4RcQOM/XnxQ
dnUzBD2sdRBCQZLbQVid87CIlxO95zaocJPs9pfD8NBP0fz9syzPbDEf9BA8plawv9TLixVin4x9
u6x5uELhtXMNjiCbbMJA+pUYj1xfvEyGGnvyiBE37Iwts1kcQ6gmpswojJoGuA8Eg+OoHigoMjAE
MrjFpsf11lf+DDJdnceyHKzetDY62aBd1Wdr14Xm3gCk/sjnV2I2ooJ5+q357CU/slw7IQQEYfdz
U2+aHvI94Czarw+MsniYYPw515adL5p9Rci2eBHklp8KGflkJdZYcmHSNrc/ylvbDjoDLVZjWIDR
PHoIbBdrEAiCl0jv9tUfFHmAoCkvhy9QpEol7uykvDcl+xXrget0/2hKJ/1BVDnBcwdUvj/NDxEa
VSG31FP1d804c7wll0uuhYmLPB4L193xo0nAYIgOdxqSuETPVIKR5nQ7rQhPaM6BMvShCUblUZYx
VJL3jIZz+VM9NsuIYdc9jK09t1yX8JXhJagWSyYhzJgM8h7PM3/R46DxDKCdef5ujEzyNTg2qcj6
tahyMGsrOrZhWVk9tc/3VbitloPfvd1FbydI4NBEXLX7qxMnwrR0lAjEiy9Y7OKckoW2QhVDMO5R
ZCo+01eNgMDx+4ex/5xLvfYRmm8GU46O3fpuv8dqRBl4YfD/1YfzI1WPcoXUHm1tU9bwjbQ/mGT6
nRbYvvE2RZVRFjxm4oPq+xcOX1xYZNv8ZwfInIzaAH2KAgwjlngoMOFlApQqBPnyC8sdK/VVVSmM
cvC64v2ylT3rRS+XWNp/e8AZtKDTZpUplzUVM2WpAgXh1jbqEMPs71VNYW+gIPsG339APDiBB1gh
QBtQO3A+Qw30pzMMGyIePVT+igCSRFl3YfkOzcqw/hKoYvP8vzqBCAKdeotKyovGBALw/IuIbenQ
0TvSrAO3Xk73b6XTczlsgl8OfkRCFTODpVJe15EvlJmU3PyW/72NN/3ejn0FYo0KuyW+sppxgcJB
NixoYDQq8BOAK//mDLfo2tyZBevrYibZ9TecQKffvHfPBOT202+2sytCB9Th1dOoXLVDTXbcGrIN
eWOS7xxMG46MAE4jQgeoY4+PTuKgFpWBhppSA0EyILAM0OVhrT/4tXySNWMsaefSpEj2cSRkU7Mo
Br3yP+THiQmdN8Dc9I5D6OfaJRpDwTABsmmVUUXAUF4iaNVqviesXKLHRkcqKc1A95KUBADYPc39
L1sYoidFtgVvR641L5soZUtNSixdawwcp8onZfiaNwba9Nd/FWERjjjdHU7h7Tj9skymG+AQ41h2
6ewMLEUsg9r1un7C0+VVMfoIQkm9euv/4uu1bSTA32tUW3dhUxkIQ6xPaUY4cjH/CuBsceGdpICe
yHXdii7oKARFCga2hoogJEOG2P7tQFV8GTXm74ds/68hn0a2wcj1jEin4Ub1xYqXTTLWCvGQ/oi4
JRLiJ2G2sfxGuIxmNoMB0Ty5kJfKYHfvt66rxLbXb/DByQNsDMUJyr38ZLi/DMGBwaE9hRw8iUSR
ve87QQh+13SUast84Oafz7sqTADrckJXyfHP6FAXDX+wPwfBPRjpuqXAE07zYWZMuo+eatXpbawC
+UOtQZTTWZlg0371OBCj2pUwH/57a60wZGjrl+SfuloYqz3BX9M7gRZLuUd9L6GpHTNk5WEuUwAt
9pbvLfxr8SY8C0z6/Hig613A8x+YTAA6o3nCvD0baKtzpkbbg/q6GBEPV5ARIu3pMxqaNlQxuGcO
eAB63z09RxLGNXgwlHjREmGNjIIIspqd6iGQN0zb3MXz3lnJAELRvbFw5SuqrnbCB6Pa153oy98a
n9SMWbYCdJaJs3FGhIO+fXTAlef9L3EHoRXwIf1H4GhLFvZARaRGkFYsbhDZ95DuKDtmYoK0lBZV
Lk37tDVP9BtFnDMkHythSHKhyjHdBNM7hPphg0zuQVthoZWU8A9OZp6YKgJyFQjnhxB7YXNvICWE
xtObv3yU14GrYU77DSbW6Wj0gA9fY4QBq1PIyanhDuPvl7o+rwN88a3fFEDmKiz/at5Ehia3M+ec
DcVx5rbE5EAIHA143CO/rFDlBm1NzPBNjm7VnahiXaD3sZG1xfSKMcgaGqEiY6nF+AxriuMPZKyt
bVpvqGeATOlyB9sLLUSiZWPHNll5TkF1q4L8acl+ZDx676yvRD/BjQDUx34ZX1Sy3UVmtG4sG7PC
NaOU0GPY0Ho33w7rvAqlI7rA0GShObj77eK8ZYsyp/I4nW4nUFuLOZ0Xgnx5Yl/pGjtgciMnUCMy
mQ0xOuRZgNGaq7lCnDQcXDDVttSOZm2AZrfj2F/3N0UbChF41uIgN8aPNrERUccukMaE47j8gcwz
qsDVaYGsfW2jffLBYKIC3DH4Tkp+aGOEgwmsJbrQBz/CsLWT1hQOFij1pI1hB7CsZ0rEapBD/y9q
+g+pT/EKN930dyR/tQdceGhtkXHqcmFMXsdzmrlysEA6tdD/is989WX8KgnjYmcLPgNSYcJe+3D6
Jqzj0pyQvnp3E5dScfrdNlERKE4apaj2UKcoFCOfjVJ4pUfWTbTukTYXzBXe3RAVChww7v+NhYTq
QMLFxyg97Sf7KyYWv3sAhTFMiErlqmph0nB/YBOPgvhl3SKABEd8fDevSW+jrx8z8DSbtFSutobH
zuPFbG6QFAMAFkP8YaHufOEDdn6bB2yIRzmbWI8TMY6Tt0aoGpaq9/BntM2ne7e8/bV3rndz4PEh
+stfy/pOpvMnHoSrj7jAoVtEIT5iaqsK5T4b0kTPSKcrmE4bF+llX/o92KimPZk/Y7KLwz8FFbqL
RnIAC3UHid7E7Dn6UCkR0z1ceCjAne13wQRoNHeYyPthisp/jldIoXEnAhjx+awYF0E/1qeN1hxU
2vgavJAepbYBxbaS19B5yL1x7SNNQbDlh0IWv1+RCGrHf4USX+YQED1ufcU6iK36V/NPCDdLKLX2
wJpWU/g/yI3SWqPpPwGhTfh55H4I+dHnOVsu2od2jSZG2x6dJ2c88vSKkTeYyS4TNy6FSXsqaOMz
b9ehI50mMq+IC4TEzUfNeqI0xNhfGTWc06824Sgsedyb3ASA9fOxbuQgtTQchh6L7nzkYtV4Eyit
1umdKQGQ+LeooRrkeFuGweKqOu5gJOwie80DIUgq2ZqzhZ3Guwj31tl7QNIUGZTyx8hsjrdJqCEd
EsPnByK3CHS3c9ZSpVAMiqTK14qXhxl7qdvtFcZIOUNtPjw2EBs/LDHOfNG4UJ8B9qteQB5p0pGq
Uvz/WxLP5VElGLphB1kiOU/dHZCHgoPZsH6X8M7b4x5TZECtVkwu/vRRpwZ0rVw/cRrYv0rWF58K
d6rz5/VDZRBGj4n+6emT5IRYcFU15mVDUC6J1IiRhWt7OJw/VocWLTVbnHVCNtXKBHgZPCwu8vxs
h5M7rghByTVCw+GyZeJ6im/J5BUImyd9D4vjmMcbx3VGWgi72ETZ9MPoNa5cAQQsYUp4qZkv0BGV
GVPwfsBwPBTLBs2MRPa9TRfsi0Et7GoWab/FE+2qHpGYaju2FA+XJfyCJpEG7tj0svSKnKEOVdq2
DZy4BoEVC/gxTJhbvHOMX8rwuLmgV/Ka5SpR7Edlknl8v6woidMZe4iP3L/sAAzOKWHzqdDoHQ/S
gKrbuZdQeSWwgJXDaBc2TNpLECjHTlDf7Nrou2yVIOtctwF47S8gCFE0KSVC8rFTiBVZUl0I0gR1
QonH/SuHkpOt4E5Bc4go+gOF6+AIo/0yoBOrpW8WfJI2P50KtuKSXdr+VgElhHkQ372PNN1Yyxht
Ra/7LeLWBz8zDsoW23+CXNc2gIE+YaFMUEQUXXGHCDH/wK0tSTyNBeHOjFLiENLiBu+XXVmGT6hx
uwwZk5BnPzNzdU7EguUpusB64AnlSOUBFkZFFDSehRBlQeOKt2Fgjw6mYvXBB6l7bDDZA3QpEVIG
TlRwh5mm/zLeYuYu/dMVBfmSCqTO20pu1Cp/ZJT3zYh+aRfcfdrLmFn5U/2wiTt5TJsHa1eNDvJW
ThExfEEzR+GDrapoB+wLuOhJ5KpJdDZiFxcadBNy+MaonHPpn3yFmMlGg9QQOGwakuxAWTni8eG5
4wLSFZAIT/HdI9s/AJlw/P11Cey+UK+el2BB2Ipw8m6TpW4p4da4Upkjw8EgjD6zUgV31l70zoqy
IAeBMI7FznShZVsHsz/LjSMaF8u5AuWnfQlLlVghw91zDtoWCtTbU4vBo3c9r59zaphfPNq6uEY0
eQmCrb+c4pwAWLWtNfxbovDHDAhJpDTtIydu3E1KPQgQsfJrGyxikuGovvSJzXnFPmwLBsgb3BGE
Y23bUDXQ1Ip05NbhLEgNcQ3sR9veNyC7ZSwNrBQFHnfweUIklkPmqbcxDCjmlyYJGqaqrBg+5GeC
rgtWSVKhxI0SasduJfBseguh+a3EXfR3bp9Ze5rrZAXP2bpMRpYQCs0tsS2PLewlAZ/OYYJ7tnxk
6A0hnOPAsihgnIJB9yQ+G0tAAqO22FNKPghg8PO2CI8CgcOGj2B+W3xq2Fe1YW6XX+jxbsq/0Een
xk9/3C96QmP7AWW5exRnFCIZxKLqhQ/c7FNeMwkAue5Hxwg1slXtuYfOGKZmRYps6OKSKHtcT9Wc
vy8/zCl1t8DgI2oitfc91uBEyDnZ2XEHLHoB0CuRY+x2zK/hpRc+m71ZMrZOFaISE8+1mwJUF6Xb
2brrcPGXJw7ohZ0jtZiG0Eq9oxDXY6iDTpnyC38PVvGJcB3RaSWMC5gNHvDC4p8K41Oq/LrYoDud
GujeQKNXzcu1cKkdSujxUShkVIDS+fLLpVKd7Yk5Fc8PU4syW5EwxRVMmAB28yStk6M4ylwKvR+r
9ZEnksEwsktPuP7df3xy27BogqWplikryo8tqXujPCC4NwPria0mYUvuWgLWSTeJKLdEZzouQX3N
y8OK7KD3k5m6mZ9x/VsT1jkRs3uRBBLyEg6KZUJCAkFF2e3OXRZTyDc3yuBerUqR28E3wqp3haVz
ntlG9w2S7taCweART3J2ftlK3uOXgY1wgEAKR6UCgbCCZKCKF4OqZBTiNwUJQDj71RYcY8/Z7Bmy
rxLL/kOWTsjINM1EHNrd5ZxwCItw2RlQkeSEbPZ5o2TmyT5ckEt7oLIiRbIztP3DTxSdls50h+V0
8qMfP+6opRU7cD21+8I3sS/PcwluuacZTNfb+imZ+uLgfgj/W8kHf2wcykVSfyVbp5chwJDOew+v
fzjuExwVp+KrH92/jAaPjnZlqa+Pl8hifcFcMSiJsSuyXTd+FIeBN09hgLje3JrcYtbLCd6YJn0B
tF22F4TW1lttmIuYlMdaj+Shyf6H0JJrPvq5CnqFU358uIcFEGVdhFq+Qyu9VgKY03DMKDxjlYl6
PiD56i2nBL2me2Q42a+FQ8WGtMCjNVdsPf73Pzw+yenW+kA0hjE+o+8BgxaSx1VT2QLEG8Qr8Gbr
BQc38gLc6KmHWzFuOYB9Pf6QQ7B/LCP8bWSo0YCqgPx67KRy4MU7QZLLD6CHrfBJPA2JL9E3810h
7REg3SODu5wqVM5n9AVUgOYB3sX/oaEDuovzQ3ie+Xq7dplCKTm+iCzGVQ48YrhGZIYeojCEuJry
JuRmkcPWRbtuTy+ZwzynfoRqL66zGWsJoQ8nJfsgYSqg7cP3wlbn/iv1Z5PNId6BGV00PYv/TVxC
5kLIm7F9T9gdEPdX0rd4c6AL0qOkJMkuSt1exouZtkLxgwoPzkm0t/HnvIRZ+h2U/+xXOXRgDsF1
imWTa8mlikJznEBZvnDEqsHe1MYdB+8b+bjYtygbctO1qCrSdHOQw1XdikjFBal5pEcg+UWIFHKN
XVZiJslvf/xbtxrLn7FoK7w918OS2TgKhjCgOJbanuu4sBCQWEXMWplJEG/mo/ayw9PGBqCEA2XX
BjTTvl85vovcJjbOjuhHHXAH0qrUa7E4oEsIqLreCx46OJ1gseQEl4EzBdyIAbSKM/ZTtJ+te5YK
6xmE5OdLABN7A46AilvYwPsJjVY5LfmNyi16FfiKZvDGdOKjSg/L0gWsV3+zAvQnmHKTpVBm3Gq7
dJ8Y478UjwBZ0SVqQvUCfyTT2ZbKeIcVaAJevKBcCaaC3qk/c9C28fL8iSS87Gxb5i0Q5JI/Helz
fX6WE6crsZnKXS0fwuGbGv/Mgf7hxFl5xh1T1zKwer8VXPnmaYKtIche1PmdW/ChFv3Cpmt/RrhB
iYoFU1E3D1Zk5IPflEhsUW6ijODTduT3OaXr+6CG+Fe6fVWY1FgdvS+akQsUmLT5zt6RiuJDvxdq
JI7Cat4dUw8wVhnpjRh5imXnntxxbjKWIdFl5ml4Ccyo6RAkhJG5X48THqhQsEs4JIlA64hJV6+M
C3p3ZBhlQ5VVdvHCgEr9SdLnKN3QJGrbFCle+4einanfY2Yl9Ozc+SfuIFKpoZE+DXyL3NN87sUe
yaBvyjqNd2PiOLkUG1nfDkSeh5Won0ORQpTdo6Jc6ZoFPMy4ahhi3Ddrg9CWGly1SShMxrJXdzU1
5pzuasrKm5MDRDhIGvIhCjIuihLpxdQmSTZl3B1ogs5I4ju0/tncAzqZofviTLQm3yvRCMSWzZGl
aU8zdIjxAgUGzt/REiZL72wUzhHEhqdEpBcQt7SIUM42u8dMMMqoOCfdE1IUJOjV59FqgrubmiNu
NOpyvtwtoAoHlQwzrwirxJYJjToJDkoagI0J3G1C8bSTrxH2gD31Lt2l0l7xDnjHewzv7EMVcx8g
NeQlEXUw4k3EAwUMiUBtYjPsXoRCtig5t8FabDWEmJ5FUeyylb/x9b8qhwEPKbcrO6lwqN3WgHcB
gsxWsVQRKgNeqaTsihfmOihgTYRSTluo1aG6YKTWqi9CAreQbU3B3tW2c+j3XjYiDyJZDtTEXjeP
VRW2Vh340ezGWgF0rOP8DRZo9bGmteKBFGZXSTq1ArYYjYkF3JGQeWuw1YnEom0roB96+N726FDO
dE/loziAzFxJpqlxzTsTcbWlhB2KxI5iFzwsnMYBejJTsZHBAvRsIJR8g4lztKaA0MoijLmZo7Kg
NcFnfP/5I/tCLPISL/plr+dNqFQW0ezdER+23yGAOwqSIT8WzRAAveAqIZdrHh6e+HZLCEE2gfIh
Vg3OFlW5dSlD9E0lFhf6StEDxp1PTMpQOxclETiVA0rv0i66iSCQkyfe7cMimaXKPviE//JZTVP0
WdRV07Q5KXfrXs3VJLEI2KelgwBMBq+gTeDtZtcrsf9H4+iWvPhLGxJThqrzVasR54dGprppuGUG
rZOq3dkOaRvCe7PuLnbIbYPG1MxIRK3Rq5AOtoUuZ/CFGgXwQiK/c5YxDExY2b7Uqcf3L1BDWd6x
X1GFx6s7ld+gRa5cGVWj0wHp9T4lrkfUZAIQ2lFFDOXogz3FcZHsavFbKFYbg+BAS3zwWm2R33F9
Z2NqJTQ4pLFY89whfMUoJ0YR0AsQvXS/9pSTHM6Z/+lIaVHwPyx2+XVaqnX2EUkCH5AoA6Qob8Ne
GtGxubuVFzJ6gioN5xaktLXuU2EuEzj9KwgDLec1lwF2fvO02xDx5+DHY9FGeYidZ1fLjorkfga0
oNojDkIVLqn90fYt8z8VQmzA2Uviuf8TncLa757FdpDeA/KEK1DQ2bI0MQoFF2WctX+zobdk2L/L
gq6zZkGdQsFSzVUzRAwh5ZPDaI2Y1w7lRE8gRo8vaKV7XODGAszNW0mBaVH2BU96I5tFQiVBusg8
+wJS2WK47t2raCDZh3bhDWqSRLNljVeVV08UV6tqn6vtA6Dcle07G3FEZyw+yCBgVtOSXO75teJc
V+5pb0x6JAcQBAx94q8nX+oHwqFPqmguzr1X8ZnLXdfP+2fx6iJdJSUgxsJb9xuEK/gSCrzkOVIq
SlNxojLMwYGV85hnfQZjFyOR/zr1YWk0CyyT+Zc+9lWI5DwDH1tlRpYMi/74fFunsbFCzstJv1Is
37oSuh+iVns5GV7wu9QDyDM9L87+R6xoHaenCFOswYcQGHPD21oDy60hI4RGB+sxDtw3JmpbmJhB
wooKOO75NGZEILm29ZUqhBs1RE80kZye3OzH+NRQHTcSjZn8m+vQlpC8Pbhy1hiqOYyEBiA8IxEa
RzcK6El8D3/1HdAJH3RmnDxBx9v6hP3Vx1/CPHXApk9FLzNhFZf77OXTlDtbQL4sQvI9K1Nle1tO
dLMI9txhR/khTn724uZFpy2a9hPWzLrFH6n7BzCM1BeqtNPfFjJ2IwcLw/4JM64nAw6wgLTjRQPE
Sy1HngMbqXIC38hiFXXj3/LftDSTikhQCXblcgoL91IMsaVMFSjNB6RVLOxWUtojlaWZKKx1lnyn
nPofZENNOlMKCRbCeeCutsk6GAv9bv0zRy8QAkt4ILz2Jld3ClFVRnvzgW3mQoGh5P5VS4+Sa0CB
C/DErsrlKZqcRBiPfGwdr7PEDGx7PmQZVl/qifTPmVP/Pvzbk/DN3nRWdiMPrhCqlc7oU83igxgn
7XQ8FgD+f+iVni0gXPrdB/csiAHh48Yc7F/PwRv/quCQiNsN5w9UQKZGmCKedh5+VvWnoN5Raf7R
XmkSPKqm3sO9RLAH8zAnKIH58iCseCftQZEjMwm6qQqhKx7BpRt02a/mbwP69c1NM7yUxjo74tsy
qpw9vQfvedhsllDK6y2bcTd8CwjhORzbjqP4ROssAPumkG77MuDhjP37A9KYc9p5Zi1C1RQyvcU0
JaS12KlQVh1NFOeUYW/trb1WgYavAXmV5AwdnrXRZX2D3E3svCYTYQi80awKN4N3jJy4ajbkzhAz
eQ83OmCW2btTQQdp9TnN/66SfxRwM544cqQ7XbtjY3DW81Xzea10X4++fg/6NX/ZuqqGE+HFnhw3
fiAyvivMCncNvDXeZwaDyzbZXy5F5zFSKtILH2d5I1E5I4ZDtnsj2c5YBtoO+NWULYKiYdwYwBBu
t7PxhUF/nEQ44lKAfl/yPSvKx+uH5pO91eGW/aXciggYayf17lHo9ycym219Rl46hyaEnOK0XQQ1
Db8lBWsl4awuFC7S/ukdEPI46yMowLNVVi4/fQubQdH6OxNSZpVL4uBCKt1ByRaode6XJpYyh+WX
D31bxcWnFt+zwA6o0uX/0e9jtPkLYE3VWiEBgeuYBE4JaXI84GwEyL6qkS0yLl2ut98bhuz9tnrW
frrppWC97XxDnPiItFWxnIA3m1kmfCEUWmIZed7C7r8GWMyeN1hURoeo/v5cEBFyAtl8PcOIcWeo
itTYFMKirIswrY6qfPl762D2w9B0w/GR2Ui5CD0Hemx07wdzdDV94OvDFqe2vD9r+le4xZN/boo7
i8Gt/sTkk2TYyKp75v6Cfe1hhQQ230S3A/qj8wqtBXv8bkgofqlNJTPZuoeke/mEG7o8JxLgAZ7Q
n8PCSbNX2MSKa9XzQjlnG5eWjcLTv2BvZgykERh+m55oMDc3u81fwTfQRg46Q4hMU8QrJvllPE2P
GsDL2t4Sw601HhuFoDdZOtA1sYmu7zQ4afVOB+8Col6g7//Dev8nzLWWU9StlsXWYrp3QxWJNV/K
EArojeVZUqcDZU0cU/Jrma3xHl27ew+y7tyOUqGnWiSAE9yazR7Jv8RRd0pZE3rzmoPyV/qWm+z5
rYm3Eq6wL2Hkg/27fPIMBmswgn/xhj3OSHPxgyyCh7yQG5xFSbdA7ptqTqhPtSvxDn7HIlxHGpoz
weyrkKlizE9CjTnyq/RZuoamCy+Qiu/hot+RH6uG9VDQr6KBcFV28Qy5GfEa2g9ftk0NN19kYjMf
1yohCuXS73epZ4TgAI8VY0TOyQzQACLxIARf5srV/RVVRqjdN59RF/hoVnPiN2aoVuSF4/cVNrlz
cFQEm2Uk7gTBCASnjFt/M1vjwmjdcGG8s6aA4fCm6bvw7VjynJo+IVW970vhomqBtaPiYoKdvt86
r1aIPbt+wt1ejHC3M7GNlDCM781Pbw6h6Azgz8q4aF/n7JN2PKu4BBIQKzgzpKC8ZHjf0OVp7GqV
rDrmSUAyJ/2ZI9E6R3bt9D84BgAN2EdSO87Ka3fm5j+nI4Nyc5MfAgheYGnEk109hRnt6MJ6owz7
b2ClqY7DIq4apdx7GnLboJ1KdzwehKp+QX1wb9TOCNmlbcvzKvieMkDAmsUp51OBnzbiZi72Ox+w
U2Shujv1vMMhFNpzNFbLYqNZ69Eje2QWSeig46tBK2YAnPbJuCDrn5cSeWNKX7WXHCvLIM1uXaHJ
SGDU/YYW20RsybGa3RCHObU21NQJMYzl79CNpVLUfMm1ESd0MvWxp8DZdxSPyg8naVVSz//ccKbh
zenmNmOsc/aDB0K40TkU0U1Is82i2FD75POwd8EUwVZl27zMDX7zNwfmiLaWh7UWwq0CKoVZRDC2
hNcxJ6xdExmEeNTxiN84Y5gCbGYTXBV9X4FD2FGtx2j9QqiCVD3pEn/twE+KbrRq/P9mM1Rv6jci
/DjUyBeusuaYtJs7D+D8r1Vs3r8bHR0l25bMXnJfobOmBiFUVlxIRP33GmZzeCx7+CB7V7V5Xfko
I2BjK6VgYqLWLoq/1To/ykFigprF+LmLmfVxYR6c/JgNSc4fhSFTgiJgUKkL1PCtoLZ6gyGLRJnJ
hJ4vVpykaHP2ODjJYQCptUOkZyPWLPEw0bpUUiPEDR4qszADZtIwEy9pwDxKPCzZtSyHzfwkI2XN
oaDmkSS8+sEgiDXyft7zFjqY62lAB+kitejc3mTIRSen+l5VAXE77pmJsFT17w8C5z0iUWvJPCxx
YXGdlM0MZ5qgexbwyrjLpIYRzx+BHjxwGCeUkxXwy8ON83v4fbN5SWnc8S5gKZOyR57q8hO3kxSA
NhbTGR2h7yPzYGCadSHSZPJfs5YjDB6Lm1Iakk0mW/iPyvniOdw/GLNqa7GExgR2j3/Ty/IUGHIC
WDIklG6vuP6zb3YQmD1XU+PvUAQL4d0fX0J24DWxyo2FOfHrP7gqnwV+RpK6XGm9Sl+PdVIpvsQH
ycoAKPdZSwVHwgWRrEFGtNqAUSIJsz5u/U9EAvNSF/clG3yEVOp8ah0SErhMStSr/vngD1Acl/Xt
AfdX8Z04ur/dc7lP3JnsgR7qYwcO78SQID9pYHauJgzKYux8CEN+Lelhphr8RhWYWEK/oTDQsbtm
mIrYZOs75qNS258hbp/ovXwAxS6C3Nealh344xde17VgBQVBA0hStlbxV6dzzOziLRfHi1CCvI6O
p4Jw+dq2RC/yL7FJu5b3fTEp55lt8KNM1mP6EV6mhul6k08hvoMxglsxkwVymApLnmAV5cdRIJhy
I1NLvNpsJ1lCir/6Y0TWjbUTQF9K2FZ5RJhTjQ+siLBhETGoBK5sf7/USL3ccC535GJeiVeZFV8W
I2FgVbulEq0pHQSzlCXbRNq4lP0Hb/lCYb8uAoPJ68Ou9JG4Jy/UaoUmdhHZ+22vE74luiPnbspS
Bf0d/MFKzyR4MRApjDQm3s3fladl1FX8PlM+NJSeuqc0I1+ZDMCO65vjj4u85osPdcioYTpEFkMM
F059SKR7vLtIqQIDFalRIGuI4K+6BiyiUsjGFsQSb6QQ5enC/0StSu0wbWRLVPGJAyrY3C5S6Jd2
FgM3q0fHAVQDJugpqHYaF3HbWr42wDC9MesrE5dJGltsCCZ23NHMTh8x92hqW/dvxFDXNvRnuYgW
FlV6VXJa7yKZXHS1J/7Z1ejbxdz6oAn2cWaV7urdA0UncfEyJe25130Ng37Gmb4Dkv6wNuPk84Jz
0eY23wDrd06a5qlaH0xwYHUgtVIfNAEaHKEr/TKZFo9jKRbyZ4jtrhODYANlNGb7D9jPID//cyoJ
y1uRfR1nE1LYD/0p0zlDasx0SzpXq6f5fJ+uQEsX1Kcaj4P3e8XxL4dTo2qrwM+fY9SnPcUXr/Nk
PWLLpgFJY+W7bQwVnDVyuycE5MBGPlYk5d7Gjd5eRw5B6BQj3WILRdV25dCiUIy3SCRWb4wFavpb
dpDsdw24IXYxEFqXuUyHaPyIycWwjEqIVgFvlrmzhyhvomdkWOHsvjlFxBl7iCiKHNxPoAzJkBg2
h0usFr7DcicIHf4nswuUcEargxERn/OTE+E0VE+5EEFuKGSXaC/bWavUe/6tz9q86+n+Bp2smgbU
bE7uaIMz+8d+VhO/qEyZSDENJg767ScjtWYQsVlIls7BpH4ise36RqZ4zaGYV2oVx9and8u/Z//v
4JIGvrapNBU4a3D2AvPp9RLA7g8Fa05uSGrJ5kN1xTS8gyxIJEkLkGpuO3k/RrLJvwNj0aoSn5uh
XPlQAPbIbEQde4nLSG7XvqO4vXsLCAWwPJfmoqBmiELqZ3vUCmjCncLObWm+WV8lXcodL0L8jUO+
+kRSDIUasR52iHNU0qLfpFZyjnZPLb0e6Phy02ccoRkbl8F9Hg7KyFLX0LXUtKqOURMVDfj2T2Ml
xvn9tXzKqBn01ANMoHTlQC2tFHnA4phpjRNOuNdXjek5btD8FssSuk0e8d/DeSBi/ldqKq3IqB16
B7gGTIp/Xvmo9jPvKlJWzYMz6sP1oum+hAgtdktnJVExkMf4t8M2RkSP5GRSwG9476NgFy+J3Mp8
VWrLpPr8auTWBDLL2CpELv5qpHL+b2+G3RGT2uWakh9wpV544YGIxiQi800H8bbJgg8zUXg5OAnK
viQu9hrWYkaRKoNrCTI/Q+pL5ZpBKsH3pfWpvMII6CC9GsVdmuwDr50hzfnTLDyNKmeWmbRceimP
hRbf1m30NEAUjbMVHmSjFdjLpWKrD9ddRPnPI1mK+fLG7Aj7WrE6vB0mqwHXV7Fgm4goYDayyFPP
6xAl45jSv6Wbgdhj4YmqzAnGSfKB4lC5KCphDdAwcqPPVEbyCqIXpSwOyTkJMNej/gNoDrjlSXXf
w6osVYmXb2n4Qdle+AkMk3QDGL8+kSncVEiM79BzZhXmRMWgyKWLdhRqp5M/wAfFwrmDz4ASkjRn
qWZi5IGNC4A7o6QQFYewZkJNh+cYvpCOdy67uIJYfi0vIsG6wLTyq7RBvp8Uv6+gsMaIkCfdZZeo
zjN0Q9wFP8KrEGh/VMVJom524zDO3/wq8p3+MOvWYEhe69xVYT8LNVMmDg0Ifw1Pf8aMjUKp83vh
1G8ixyussXP8foxns6ITklvDh9KJJ+fTi3Fs5NVJepd4NW24APJA2nrdEHlwxlRAJRqtVavo+ChV
60lMnktWyLppiXi6ljDlnZZfXgE3mPeqKI8cLAk/R/lmzeJrcNt1qbIlNq6EjNX8LYlpxdaNlNFv
BRLcgdXuRNSs295IL1vzB5oxu3unjpLANh4LNug/DNx8b+o9cQj3HGKYo4pYLm+trm5sOz/s+qeR
11Q7GsEizKTtHqeYgLIx6nHmC5I0kyUeApAAg8VinlKIxYwaBy0zShp2uJRbo76jZGTZdTBpM2SH
Bo0TED/MtSeQFjamHc+bwS50FTNtDeH4j7E7SZpbRQo9yYnj3vZiu8lZDr/JYI8oSx0eq3oYPs70
CJ7cWa1eotk+lQbTx97UkVG5FY9z4bvZKCsfne5BFmSHvqKsjVKRys2zQmJMacI11mmIxT8CU0lT
ZaImTTzAZlxTyrqY+Wb8NdZhYgEtf5hYvIN0+oiub/Q3zcRz8PxFKrhrS30ZNeqwt1pVBW1MFFe5
Z95AAm32Gb+o/luDqZ7Yp6VjnjXccc+H8hZPO4cfv+fyo+v+pkIFAVWxf9fRR1Be9SMuG7Uz/tiy
IHeA4h2HSiQfqHfXqS12c1VmujtLzKHiOdIUbcLPL60VDQ7UX3amd/QLrkf7r+USHaWcc6T6c/rC
xXiXsNNYuGT3C2Rqp+fIHu6cHk4bDlGOHmjjBt1aoRVnQcvKztTKxwYh+orawHkXTuN4C2HhlMro
fKr4LKveu6+1Q5EtobtOoFWUiEYVYhrK1g+QjAIUYt1b6jfAwlPtEZc6nh3L/rrTfC0k8H0OWIXi
bFOQiYmPgIo1P56V1Fe5W8RQ8WQ2zatO0WGVuNnipI2ckV8SK59xwy8OvzyCpjR0Sk1YaTYKNFGR
U4nQ46Pgp0vOPdv3PvQGVGzAJo7DQES9IBpEwz3NtqNTEhG1mw4JigE3xFI/hjvsBkW6HKvMYGaf
8hWQZmBIbKCwlP7TmVSf+X90OtoYhRkYOSA5b2IvcUHLuT5kIwUXuA3s6yaw4uAMN/HDH7wxxdyX
eK4VkYjcn1sUtPB65GhAWwrh+d9RnJ71R15xILqJR0kbUPRihpDRYug4F0oKmwGj8Hq1dUTI1UDD
Z0rzCyiumBKjMYb5jwUpIAUrTL674XSfivWRVm+F0aUhUpXX7F3TgWT2t6UYFZ1bwsM0GJtnRh7c
VF2rbP+qZwAu60R5fSdOUDmwCLUggf52yrOhvYG21hCMVEiF6vP59kvgYEx9JCH/kA+Tzd8A3chV
vOHGFPL72bZagU3eXdzhODRFu7r9oQjLXhjrmj/xVRixVz7GIs3EbPwBB1Sg7FSMi4qlPdAPtodL
YZlaxqlB+EXMUW8vOu/zoJ5vIH9OkcDwK10hhhn4sWSrY9L2+FusmnbtBy5HqddmNr1a8A4VzScI
9Dptu4O5SITVFbOGMdhNHtYa4Xfo4fxVHwke9+pWxHA8mDJCvOsmjQmoFQS+ZF1X4V3IDQdPtNWD
sWC5M/pHdyremGDYtXEMUCO4t+aMYt1U0elKkPWKJvNiFfG2LAGW1bV/CDrJCa44hmBpFXTHAT/b
8We+7+zmHZ/PDlPIq1fPbYi3YKw2iWvX7LgBFhoCLDRZ0bkwMjfYPg4lO0fcn/enKTGCz8Erg9P4
gSN2bTiJWLvY/D8Gb9HEttz/RJlPPrkTRaiWg9JKeta62PnlaNL91URE3QUgN1h3z9GqWzEL8M29
2if3QFh070O0vdeodw2QUMEHLYuh11FsYsLGly0c/DP6lspzREQ6v7nsttdCvDMp9OjppZcmRtbA
QaYo0oLPHd8/RgjU5K8HSqnZQ70p+ALEdk68VRE5eSUULvTtW76z7yVSJo/2nPHcWw6L+zm+nFY/
d41WzMd490CfheIGQgdA++yqd84+00dWYZvwOWlulD3sNy9GYrO47bzjmWO1H1sSZdoj1JZwRQWx
LuXBiktXXlE9P3se6vkwvQ+ts3nvwX5MkbRBuPGpqvQiR3RlwzjsDQ+8nAtUjxl5MlwO/4sOZvSs
vJwAIH6PcU8dBmJHOp2R0+/XpVF5tOCndpvAbnzi7lBKerLzqRBfTVeuoVYOxqvyZpDiySl63Yee
JH+nQpClTVUCOExW2+Smuy8XsY7Qe2hvF3j3ngFZcWKBOe/pNsBzTQ4cm/uSfnIEeP5lR3leSGCH
ymhkx5RFzq4njf6LGvdlfjDFHoYR7dEEPBGhoEmXv+WtkBCnJ1gk7dkmp7yxhJ9JYCL11GyBs83x
yOE454o1ZoABjVLo8GGOSuFgX9JrwBwAiUhFgfI1458md6i86445wS2SezLLqOM7FO/eK15uRNzF
N84iDZvit+2OHPjpzXP/i6XzsvAgiMSdfC6j8fUW9DSxgWHHxm9L0v3zL7vHurxOFcI6mLR3Xv7I
ggpC403gjw3OIMV7s0HuWuD9p0vccFEpohRF2rmY+d2l7IVytCWSABIuDZwQf71lPHgY17MONMkO
oAgTJHB2lzyNhG9Hm27PfWP59r70G9j9lxsvJb364PXBC/ymtLdFKQu08XTD/giJJ9JWFjxftc2e
pVZ+UzIx8+3t/0rHjYPSHm7zX1XEGL3MDuNNT+/tDitP7Z6bp8d7RvKRpJCvrfL8WPG7NgN19D/t
dMNPu36SoVsnyoQ+pgJ2L7GDCdE0lFntP06S3Taib4QVs9mNkIHbK6UB5N1khoZhZyahNseXItEN
Xs7JOuiYikeFJYTm5IyXsCD7G9y4opUTima1vI1TMd2BO6BS7IGc/oSyeOXwkFDfGUyxCru/u0j5
OCvKSk1RYTGVOqVWNaGRoht/Y6d/dajKp//KuYplu2M8JdGZfxaBrmgx2+9xD0pWJPMLvJsW56CP
GO7S1X2mE8RX3jeYzwhjObFEjheyclEtjpcDgPFR2UHmQdh1/EIUDGPZ4sbHXxQCTPkQsXGYyYAA
ABZEQZ/aZJRU8Z/vX/5AXiTg/uOAAXe5oYuPWNzIhXVBtk9gep/3gbPXbzuxVZ3LovUIMr/KXHCe
cszQnOOjgNQMGP3i8sZprbyOI3SdVYnH9axxzUVgidSjD1IRe/YfPYWp2Ukw96zUCajqb+ObaUwO
gguRcuQ1axv81Wmy5bhzRkmzo8ON9m6LaqXr3lCe7Jqb/V/cxVOh3l1YdVTpU5Ra5IwA1gqzLUFW
ljatQAYauISNA5IGLrGGvIOO3MJ9RKD89lUVGE8gnKdiQVoqEF2f8lIBzqnqYnBswFO6gh7g85fG
1b/1w9BsRyq0clMfGgeBfYPkSeU59EmoI0Z+2gKLL1W9S4Ur3vx5OutJH2Ao+aei563CELNanpSv
inaw2tG4eqLOCzxgclk0Y2A8CFKRIm/v1bIJ04JBzQgjeQs6H1jONLtp8G/mxQpJmcfW9+LX15wm
IjC12bZ/F5fzpWrqoJlwWI1iPM2Cytm16pY/OT1HG5QddmvnCAQIes9xMKzJE54kt0H3XIfJPpKR
qeREH9PPXUYSSzgJ0NE9fD6eLXz9EFU4mzgiGwxQcl+PY5ocFXUoXzVeK6TUNbQ3CrOLOmuHGDyA
OV9O99c740+gelyI/FUKk5CQPCVQM8OkARyg4KwY/ErAyNF49RQLZI1pgTZ7HZ7YowMkgL3eod3f
Xsq7mNlpHh/LvmnVmFgXdnk6mjLrKO9qBBTG8aKOF98BAxiVNdkLILI9aud6xD9FuAQqjXXCX141
pR1sfMSIk5A8c8Y5X6hAE6tH0nEL4q/SAjPBTCeQS+SJE7yJIeo+mHCLfEM4zcZypq/fJjbkPHC4
egd35leK1HYdochWZzXv3yabgxaabI+Z+E1AAJeUDKJrx94mKcHXQA2OypyN8hZ+liNXX3VJ6SxL
XEYU5d11ck3Sf9GUxRAOec7p45P7Ew1eBfAyGZyPRL/+D3gbpZvYwzS1X7Y8VDGULrJLd7FqIXTJ
fF0qL1bqiJy8VgHZLfm/7X95i+ERihIP3oaSugPPuaAKDgfkielzNcszBHrvfIic8Ck1abOKkD7L
3EmamlxrlLDbGkGBOKUdpY0HeBjJWbbcL0O50ORs3hKe3fa0URQNXO2hbxgDLiQms2NOrzcQkEMB
ewg97QkF8NKVS5Ip0VFrDFCM9rsNw2v2GEaggFXA482662DNhdqQG0t2fvvrHsnEciwTRTP2fIDW
ZgtKYlnIMTNn3V5ZGgf/UjqJl7eG58QEu0WiuozB2ZdlIkW3B/DAXl3dCIO55q+YWTPwO6AtrYuW
th73BVtRprAPFkzsbFzHcU8E0IGRwWbTf+vhhiJ8PogcHDuP5UvQFNS5Pq71QC8XwM4atO2vu7dE
swiUnHRz8WP9NnT97FTFheI5hsspJa47bjTlXgsv5RQa3IgTSqn/YEPHoNUKLzio2F32jgNxQC7u
F9u9cVlFqQpakztqmQqNax6t/emwXZetXezhhpDIe4nWQuoDDDY+drSOVUadKjl3jzUOPj7WiBDE
NChmiupdiM0BkuyIuOPbu/XyAAXbwEhitnEDNmbvO6EI5Oo0UkLn9QTEMYOpqyWd3RiJDxtN9akT
ZmJ6E947+wJlivoCVl0mjuP3fF9qBtKC76nxix1czETKnVgHi2RNwRmLwLNKcqN0+yPgjg7qqnbg
zu221UISpQOj/lt0pViiQ+hbyJj6AD9hOX5mvELTsTBhQnhXRcT7Xt8TxC9kpzKER8LduefUI2i7
PfrtZI8+zVuVnFSgH8VNpNPiiB04fU0oe34hVvwwERYb3xxv8aVJ6RhdMoCdkhGP7oKGvH1r4eT6
WgxrXUOh6uSK1kgRHO5pxtLumi+A/SF57KQh5BGVhmDRr4VLPEYuFIU9GxsTgAKqlKboFKUmKtRn
U3H5BoHsI77+YdrHo6xIDt3Mrg1tQ0ALZU7CE5hnpGHxDE+Vc4XGNXKYQCMW/R3FBOCLAHyyPVTC
pGG77IaKCDswZGtSXpGpAAr2KHaPCRPBrR+jI03AvA0o6nNAZ/w6XAqphSXobM3uDnwi5uZ73sMw
Y/5mWzw3sGVP8LXZU2NRmcsXsfOIUO1es4Wl7jApF8OA9Scz2MA7L4PqFHFCWQnlYPL+3iml9B1J
hzeC8i7iBmVpd+R26mr2Vc3fGYa7cyJi0ezZ6OHCH1Mr6NvQ1rOaH1s8i+wFyZiUY6qDCb+WAqGm
vPSkmMloXND+XjNXzBJhoTUrK1KTs8ffN1ekvZjqtjWqoWSAc6u7LzzEBYT3eGlpqHFTyeUeJlRh
z62QXQfZVcfpbkV8JjRysn2bK/uxi+WbXajS3iF/0D0qzXRveTYVC0Oe3/qXm/BDbXO7aIIuacwS
WbCEue5IGoB+/c+sNaz+xsQr3KlydZWn3vXAjMpWrLU7RBDrlrMcfN5XCK+UI4M3t64pBNg+8lTN
eBSrVtiXgixQMlZc/pF/9YMPBGpJRfnn6TJbZH7Hwk1usBj9aUNfvEJ+qAsO5gCwQXIDj9EpGv92
RM9KRBH+3A4KixOD+HIdaEZa00z+IgxpCcpvSbY4b8f7j4mq4n8BIdAdNQq/8keEbGZmFFxTwX7r
s/RX+JdEpn9r80xGqS9kBeaACHGh2uyOpx/nidEjc8TB35L5BjvtsfyV44Yt+tsuvR+50NgZT/hd
PGqAVa8sZSogkZ8YBblgX+p+7+0RsNjvmgOGtvhGXdCdyMX0Z7YlU0nz08iN2K0kp7RctR6eWuAA
wgfPAk+/W8+3+RPXg3147kBjSfyBaiIhFdRc0lJSo32EfXGNPI4RJBwaQbnsD+7a4jj0gMhPyyPw
Ax0vMpDdoYhUYoyBw/A7XHbdCiryebRSJpC9pHbavyIYqMNMYGAeUxB26HdD0Mqs32FVqGtObu1+
frXW4LLNJSEwgc+JbzAQlGuUGfV8vO72TV1YBOxUuP0FT0DLeoyAo/zZA2UJNTGWdKeachNyBqvm
6VhK+HlucAgnBDU+P7iekXfAJQKkWYfjCM7c7fxmG33Ggksd0WBQjC4Kyif1Dn7hFahBnoHQKYq0
vUOaxmW10be1AFiX9PVMxg8TMAEy92oqn38ApTUiUdWLsUYxyGEXwHN+4nBUDraE0oH9NUu8+Tdd
8dClo5JfaE5/kT1qbG4k6z4Z3quIYsIk1Dg2e9C2DaTIbSkPStIHhOGr7xfGWU903xndwHt1rpCM
h0TThxYoGrQZ/HfI5liY8fOKfzYr5APo/zEk3t2kkkUTJtQyAQzqFaGq+6jdO0FnQYyYfaiWHuBQ
VWCDidQr74xVgLzvw5k6DHpytbu7eX/6/jlLO5e8HHBQ5zes1mkXSZxy5jvofCvXGgHK6gP7cP4r
/gx4tQVYG6tSBUYy7zTG0yFcnWgIIaOHQjK18CgxDTJIoQKhMB7p4SwSsbIuWz8n11R/CvCuscrj
gL+zF9CsGxtAxGuff+x2YjLnfgeNbuCsu8mCpV5GkoGKgBp4zvuxdJ8w2KtblpB6M8VxiVQcYiWI
Ik4lRAl8Ho6gKso2mV5aszCZ1ZeUK+8x1j9jKAsDgLa1irayCLxz0YvcUZ+sdVB1ZSq2nqPGRFdA
KGeKUczmMpBWr50QqEB3z9wJjtx1NPhAD/1V/A8VsZQM7mT5jmuqXRO55F7o0Ol7LUpBWFriROmR
0EUybeJCb6UC5CDJyXlwt7ZA4oXi8X/4HcPmYRv6KohAMZFiRCsAaBMg2cFMu/t4Cd497Z10ihcO
SHWNkAYZsvQoo6klacjWQWz3sboLdml05N7PwypLVBDKoWhZTaL0xJ9xT6ZUVWoh2gRgnmiU6MCt
xYyNGPQ45ogD8/71ncveRT/VHPaDooYucupbI0wa7pxfixZ21wiXALQMkoQ/WSUaDg+U3O6HWs6t
kHYqWh3QWjtgiDkpq/vNyDt0cmUbPg885lnbZo1VPaIYLqh2XiV7yaj1+RLc0/VZR3PHUVFiGc+P
P0v5OcsB6kq786kkXcReZUIXwakeqhJESrJhz6WxKOgqW9MnjneYYji+S+W3bJ1eh+hPELqk4t2I
PQPg37KJiZUHdgWRG92qXEF+9v4zXp2KXtH3pKDBDsFTrm3J4A9W60IPpX+bkIDDdn/xM+nT4PZ3
mpu1i3pb57oeN+TIEQz3gFeYMp0fySzD3fuQnNDokTmCy+eotD68ZZBIYbykXiR+qCTH4ZhoWPRj
ZupSeij3cmN+WlfawZWNEoVwF80iZ+fmoZcwWVrKUBKc6Iti0Igtk4iX/Gqe/FO2/GyrABAC8Zdg
/1edRzyo69IEkZH2rSUedVbDKU456/iUsyCSQYd7IFau6HWcbeRiAyZEB7KkmATq+YMLhIRQAi61
fMvAH1pGr1T3wYNaK7qNyyHd0WJp+hNYaXm6aA1eON/AnKoCuVe+nPilWiQGHqtu3K9b9V7BG2A3
+zPOD+xsEg+/KQUwGQ74hd5ugN8Ytb+xkdCBT9JMzeW3v8QXsxu20siuimCf3ToHuGMIcRrMdQlv
i3RpJiAbeaAc8G/wKox/jLNrUy+dDqD9SCj6hNKVmSYagrRi04trceDx+85EHeHoJAYb0s+LGHs5
i3DxS4zvyr4UMrOTuuB29BrFFk1junOG1XniyzxQNCktc8ZAj89EbtZsFoX5ZfTC8DLEWhEC7xfs
BJFm35k6bK98r4yWnS37yxtLLCTvusnY9AMlQQIF9oVDMGcB9bJP9+Akf9WkwnJkn/762CeRr/n/
fRkRjzRkcOcW2/wXlvMtaYebhV+KEOJ5s3afE8LVQWW/prV9TLPpT6qWkVeB987o6gZ28NlkICoS
Sc5wo0VRGm4I3xDtqr6yALYPrjQb8/O4p57g89nDK2atWfeF5MAfqi/zh7wtR4ezjWjt/XncZNJk
fO6GKEY/NkCHXEVWbMGiJLltO+xlpZ8dr5/qsrKhdHARhPb5Lii0GCa3V3hIqjwBbM9l6R68SX+6
0FrNcdy8n6YwTaciJsVQCKI1ZBHRJ7wIhJBU3IjYeEUEIBCWYiVgt/e5VZVUB6vCN4xdNn4JmMb6
0E97qNGhdBqPmIQAOZEvh3VEKU75qQ9UYIMkZ3Kgb8QxqjdwRIc/h3ym8Dm5vFXG5QRSY+E2hepP
/rE/ByBVSUhKfkvQRarUtq8IIHPz4njLrqcstY9Kf/7ZaWkBWTSCRwv8+CSnoeBwZ0n98KACmnnO
74WOWA87RSpXBAOKo3DgDlJg0ACY7NvGI1xSEjcKzMTEJobY3USnjgc3vL3XQS5WRWo8HxlB5B9i
sBhvyJ4P317lwDIIEPmfjd1AMGOZCDf5sDv15bVdgoQWN4xi4K5VfzuI5zu2wrdSkMW3BsJWvdDO
E9aV0CkOrb10qwrzXQhxzrUIkiZUuwcjEnSziypvavpXgQ2tL6lNol6o4f6rCV2Z6kpeRM+yz1Gh
ggGUQyO/A068YUwC/9fMz7wZ99fTPUYnq4XrzkSeUMvtKcet+VCN561GKPzhzz7CZ/ZLYM0d5QWW
xjbV+v+TQIzuiWYsFGEQvEq/eXxDlY7SPeVjOOs0TjgwM5Ur+XNw1qxcUzz1skH+N0c2JLktHn+u
hx5N580bo57IlySXtGoJjpblo8i3BfyDXVRl6wChrDzaVxgmeetXNJkb0Jf721i8GP3fhk9lYp5S
OoHTauhG9XElFW6UEDbon1cSURDFgr5ZaEti41+Ch9VybxyeB3/175tOlijgbA6VJ1oQbNMmIp5C
NcPaRbaFVRBRjnlSqeVPc4SWbeIHq/KjbpGolNplWpc7JxXvGCmU62MkHQwYqG9bPpIrClSVTeyz
MZrW7mVXSW+8r98hgj1T4yDmtHxuV26sR6IuNTkz0Og/Zjmprl/P+y8WwlW01hNK0XnqkgSTj87y
Yx7cB/xXXh4y30A346YmYCP2yjqhZM9QbXmaTJY0FiJ4DImt45wdMMItaSIZP4bfPbljr/pK4iHq
Etes3zsIk6XZPA7o5wASiWLBrDIVOhTk6rupt/TY6vurO6KlqxbbI8ILcJAftkBmizABf77ZTq+G
ioywr0JVaPYGT2uRglqmf4pPaqIz0fISy1TPcXk0WRL99wK+g7FG64qp3IEnHt1026+2sHGcwsqa
xNV7xumPZqgjqa56R/WuTrC5YYJf3QhoABYSVoQW0ivXoB349yVfbxVhB/hcBL3xvopEey4X8WYC
rDCOyWVlYdaoppTWDyvzYu3gTDfCfo535eCLt3Tpd4WVJVTo71wyyyd2NMCoMOofuCDHxFtOzHG6
iiz5h2XQK/+0ZSORnMRhYT8VjRyrXiV87fQU5QbjtqODTloDIaqsij0muJlMM07yq11jS4G1R/VA
sxPJnVpm4p2xBuUjs5mIHSMEwBBtXm/4BPIQ4MUDR7YNYFyHcGLvml3iwrAasem65MltnL7Y13v2
ea6+5doBqf5H87yjRKCShBp0ThkjFsmiViugvPo9uOSu4+icI025hXmUWddb/337T9QhGOGZStMJ
OhJEhCgGTs3J+/Wg11w2L7i87XoAkKNE3aqihrat7w/bytRVQ9WbvJVO2OnUfUT7ekVxXYWaqabP
Ep0Ov5id3aHFA8Ghr/eORSbSPjMZ199z1IWOrp02hWFUTi9ggdCBpCXeHolj30Wc6/ucPkYqRaGC
GTf0WMIGpdKhtq6RNrBhxplXN6XU8u2oLMaUIKDtXYxythZFx0KKOl6v0VjoUvuppFQeSsbpEuI6
tBDwEO2m5JqrUExtKaJzbHXDiItOv0PBprnSJZVGcYylZGmn3sk1EBtD7SlBgDzwG6/0VgEkd9WP
WPOEtkPIM0sK1Dah0z5uzlkgguKAPE4ArFTgR35z4llk6jRkwelzIKt+gSRNBNqB7vh9peD51+J3
IA9pauAaSBG6mpzgo6DQ4MSteY97zWQaayLhJc/DrEZx88RAxznDp5A66qNS+gqgEGr7n9mGaCDI
hrgkDzpRDOjqScq+BqprDLyV3eb+GgNDXdrOiizmcPKGdWGF6aiDPvMES3iffAKHD8p7xt+04m+8
it/e2L846h6bj/VRS/V1HnR2FetjoCmK5dUwUti9d9EeGbnKZw6VMTp62jlHh6F+a0TWJopq1kwE
lEKVr4UCGFChdcnO0OEkj6wKTfeGOLRjNWW17rDx8yqFzTieW9tuNYHpkqMdsPbh3qYgj0Qpnv7f
ThuMIGJaHhViJv5vSpP3nx00bnJVtKyEjF7lmKmS34nv9BcdDx08g28d6pa7rsdbpEGc83W1p0ny
VAn7soO03GaXUCvOD/tGF9iqd8VZxt+6P1AkwFyr/5mn62UEMd/8pDapdgl4XeaxU8CkW19OjMdN
py8M+0RumTDqWeS5bJrttCsKXja+XRyHuV0XavGEYI40YOgvIMfowPgUswAficbtgTDq3OzzVVcE
0T4s4RcxOxUbYs5FgFEFx1Ql4aihFG7c2G6vTaNwKF6u40nuZ4K+3LnMxU7lyLVuyufRqk6ya6fl
qHbS0jzQfv+M22cUJCE+15d1BSq+kjLhdq9We2qTtKFPg30++A2JcwUq2A6SjAOpVgxaseenkl0g
QWh4ivlXbycniXtcy4zKQvgIxiK4tNZWhbCaNsRaoXPy6hFrpdccoAT482/AgR48IYGNFtvi3vwJ
Da3RAAAQkQGf+WkRH/3Ef5RH5+Z5nNrLYg2OwasZ+4zsG3YyBizZi8OGUMSNC/ocedUArKJ5a325
51ZQs+JNMu4ZMAy+mW4HX3vHDjVN7GqGZpvg7tM7+xj2Rg6jEUHsHas42Z8rGR4G2KUL9IWR5Iwz
N29+aZYydBoaCX9EQJOfHNPyYZiqE54WD0X9OnUNe+aA5uAg+y70LSfQ91gLkbJE7mBh6n4taaac
AvDD411REDO5P+qxPJF/r5JK8v4G3ilt4M/dXIMfNtGr96e5/dBHrH2YIiI7fka8d75UV6CNrlpv
ondcuS4x/B/NjZH4CbCPgchuS8IY5EydMcMxxnoeWY1yqP2Ut8n1Rd+dPUyo4/zqQ39kfEqF5IIK
y5JOEjALMutstFWLsFts8f7NWwKm6E0dGmyH80mrRzsE266vpDg8v3ENFEWLp8BCSsZM+SZ3VJ2b
WLHszmjvRM6NMphtTsgAkY6H12w+sKcskpN4f1gEviQJQfv2lkhbKrAr3qodwiKvGQqpb37KnIfR
gi9g2UKMuejr6yr7ktoBCb7yhILnfuHCfhYYnrDTk3jz70LTcr11jCOr0HN3MRQ1dZPEQs3g5ZPd
6hy8qQTpjg3djXUdY8o0ChBrqgJMt/R6mb7zXw8M2H6xghtxfCKwjRKzNdvpz96iw6kU2xZlDa7U
FjYAW26cikmLmOUPAot4OaxdlC/IZB9nS6alhvDmxZdHrgMQ1EojTcHnPQ46xBlroROKjTeVE+wz
lDNQSlIkUVJLzrpPWGkgYSYwgVz8FxWrdG8zBBKyYgJIYNDVyAeUy8ky+FyZe6m5iw+a//ZxJbCv
W1451RbB3uO0h2ZdpFc/RTpIUO+aaHlKwE2MF+QHF+neVmlO0/MbaSBKSz34jmHsTN6wW7fEbH2R
zaHRrJKMS8MVLE4uTgCe8Bhtq5Qe0o2vpB+ViUDZRjaNmClgDiV0hbFuHolbbqe4aYLXh0E7Y/J9
yMHH+oKufvJDhcGZWNbzE9mV3wDhHZYkPztuJ3L0nd89mfUNP+dJ6J082VMRnU37tksh0PJGvKpz
G+YPV5hciaDfj6t1KkXuAA1cer57apQU4U5qMo4wdpV67w2N3tkPLgWcvRxuOfSowVW111QDegUz
SmTdgm6XW1s5q0gSK9XViDYRwl7qGFECb6pE5ZFkhtZxSmYlk8SeyzAlmJXpUpMacBZef90ox80m
Nyb5U3sKS7fvZaSHeT1XiUOonoOwrrFFSKlhLBUU5qTI05wxeJGuRY2REzOyC2JE/qrFQXHFxrWr
qUT9p3KlT7PS6UAjvumJG80hRycH+cYZ5wpnMIwXx7xzq9l0rN7Q/CXshee96nkABiF08pD14x4Q
FM5d5e8iVx+/iZ8l27OzD0UNK+ZBRTBE/b5AzwogrECMCxvRLtwOtYU8bTpnEWsqdU/wrEOHVn0m
9Ak7Jv7a+cTdyuCHWgSthK+FB+tX8R2XvMNjB8sby0iXJHYIsxje4q4C9JM61R3UFsBhqJRkbdEe
a8hA7Ej1Sjc3nbmDi5tFY1ZieUHu1i37EoXM8Gp+IosIwhZ14h5CV2JLbx5Ng1F06ctewzkunQGM
ruJn5WtqaTD7kVYvjYa35adCupNXsvrbFBPoces7FhJRhxhprO2X1rGiFXdXq3qeY9jXLCvmYlYf
JUQ/l//vAoBlCUVgQFBXJg5AGXYk49UIpgOAr5NWEg9Rq+dvrApxZa5DNqv7dabmrBYIaFUjxGPk
QLn++YBV57sItMg1gNKTf+FXYYgAEZmOukBia1dpJRSTVe5fuoLH8Vn2b35KeQD8fsdAvdTUHlyS
3SKo2d5fTSxv5E1hktkwhNoNaCP0PHN2hGh8NX82Y48tMk2guIUu8F8/6cIj4McKwvC+ERuIFu1p
kXX+q6aCCKhEzri8LlMQ0HSKPpo++gy99CCRJGjHTJsZHYCOWhQjtMwVsbvzil8JqdruKwWru+bD
N2B+O1uyWaGajoidBxTr1nhB1pGWKNy0LYKLwDSf/TaT1LGznajdaqTniUQLpG2MrvUQLOyQOM4D
PFXEPL+m1tGB/gMM1V3WESkudj7Wotnk/qLp/scJuDK6MjXjzz5Tkbd2NkLSMlqP2pIZ5FlldKiX
NRzYe6/EFLohiNjZVG6DlTCz+dJlo6GNSCVt2QKiHp0eB0GFLtmdgz3LEWqK+Br4fUW1jCkfmnco
INjhnJDOBffYo6AA03AxE0ph+OMtrZQLEor64637+8NqtPT9EH5k2jLgnuVIfnEMjI80vR7SeuOr
921mj0IESljoObekRAYnq50MNCMds9W3bzGuw6M7tiM8jeYUUfE/PQRDmiwBGkYaBLutYsuGTYHb
zeRTATLBQ6XSi/mm4U47Ks9tKUEolF6nA1A49vBD1Yhf/c3YGS2hjEoM1PvXSlHd1PbzNu/BNjEb
+B3RL4rIbK4JkqcKF3y4yTc2DsUwlfohRewBeHv9fD+0pyxJLgcih3TXmStuhA+2XeTWlthO/emz
wY6jZ81h2xdGugFTf+nqVQg3SjlQLRSbXXpnQpJM2NH0XP8n7rkR6ZK14e05salgZ52nXcf/26Zg
cixuKDvQ6Lv2luAOJHfLIO6YuVraCuPewGPlQ8C4YH5Hl39Oyc5C/8X/nAgBbVgBZveLsOrvroQY
4noNIAUvcNHE6ssIa3PmERJMNe2A47UnJj+opNxwjQUOGcmzjPrW/OkVCj4n/+2/Nb9uCUSmOuxt
DOiaHFzjylhFkG9HxUqvHsdKuNQIc7EkNsVertvAWb0gZlEjHWU90H8zRsngoYRoUpozADujCk12
a0sBetuh42Jk7gp9yfwoP8jhJH/bA2HYJFW1zbuqP41HW5L99lPgTZruiZKNfhyjA/YEzpzH4/Wi
dnn3xiz3vOLfYx3eVlfwVDEpOgsohke8yfYFcyDjMZBvzfrFMCDa3bk1WM8tfHMdOrSDgriYXrm6
XJgEs/zmlc4hRGcwKCKNc+RCmJ9HsQaaGMhOLTIEKXSbP6F3ZuXyGVLDLp2qNCoRDGbdBW3wsH5l
okYFMccxIPNKfB38N20nqwn/8GCjxHNzHcNSQulVuS4Cq7vX90uLi1z2hkfmOWd8v0fv/ZELLD/O
ohkyXc3wDNObk4sWslX8zmYtevBaQq5t2yG8zHOndguo3bSrP6b3qZGO7+s82mtj2D9wT9WxGqNg
lvFFcFIvYFRGMjyEDY7AfRg9M7ryupl7sNs+8UnZ9yeDoWI+eqpgQMvduhGMIcDjeoa138GPvfJK
zYn5wZu2c1ivQ6r0zb0VuyraVylZQEalvFdQJabIpQb8ziaWsBnB+x4xGzyPIF7CTnbvlx3udmrs
6gGpZTFGbfxIqGk1enxTY/nD4aW8IAz7Ej0HxrQcukAw3vA33WQ71ZiJjRjsttmCAN0nbFyp/9u/
xMGIzWpB7QyjixHhce0ZR2PxVOMPPvwz6S0xRdXpwxN5PFMfcHGqR3tdzaxkIDELv4xM7AHuh/dL
afP5rWaBfEei6cpjXFjy1PPvBIlSMj0uLe0p++WNdWHALBsWNBaeJxnypN2bPEwA0WC5mA9Qr+XH
v7NxCSTVaTOt9amxksD/COeLTFcFTkqF6XLQfRS1pYzfpXRbNYCOkbWLGkWYJxsn0JuB4IBkdaeH
NUiCZZ0+jb6VG9ef4GyHUZ8PK2uxPfEGySSjd0FzZYcIdUZiDz80oiy79fA0hygoATCF+GioJSW+
nuyzfRxSMdPmOHdxZqJCjaiqJmRWTx+awQfqZ5Lzh2iIzlexanFpq8p7I/vweoCPj4WfvoJFgOkL
CTKZ3tV3igZfGG4XLA8GeExcYF2weNZh1X70VaJv4mjPDVFO3A+/KI9MpDH2Avzq8fogTyEreJMc
cXSuCHE/tEE4gCIZfwR7clQdN5CU/BIo/ef8sIZgUz6sWOmziJAZIWOoZt98N53cdRCKCwB81mNQ
XAU6oxuTdwJdxM32ti3QrimMmzOmyuq7/jmfhMrWNTzq1cIaaydCRtDClXw2WP9Cei2bbG2sKvuT
hED0y3UXzEwJWEgp/IVu/xIVgbyRXViVmDc//2gK9CbrQe/Kxw2HWjbvbnL5cwN7lRN1lNF17iNa
KhPD1XR23o13DJTOv7ua1kyxRTGA4wYljHYQ7MevZ7VnoM/u1ElIuvPRqrB+2fxN5o2kg2nyC+vr
2ydxTQZmy4we9vkSTu6vlu79doy9HVvoL/v1OSvziA9vM/FYFpl94ORt+FOm9w7DRkR0aI3c8/cT
GaN8ERXe0G5PQy2FKgEgo06gtWBQ4AEgOL1IBXzlP1lfzB3y58TKk8jVjpY4mja31HyhqhNPYTnE
bqMr8on6H0REi2A722UWQKz07K8Re+GLKYikF4XIhv96NTFsrWNsCQ4zjS1GbTfuSqO4un6wCxu1
I5KRH8KqFYJzALx1nNooqQnHOp8ICeyC2fy5++J7yVEacG+XykahJGqCafU+SFnnBSPtAPPC0Sev
6iCoT5JRrtR1/XJcFW/nomRTqUYzPIpmBFIOxgvIHqqP469cPurOFGOSdYDdiD5pYUBLKsfOj7C6
FqnpkeL9Mt/tA+MrL4FlEh8tJAdUlRGiKJLr8gnlFCz4jmXAbpdRZNOqgD2FTsy2v2oEtdZClFJp
m501O8KKJgiQRPk6FSTZD+zHzqxlGULOI/Bjihg6JffNIHzKG0OgNZUl0TzJMj09mQvS/W3IDUd0
KCKuOkOY8BaNwbsiQN+qB4XTJPAKD/28R0QjqghIapTuIc1pGvDkRgwBERh19YfMUbN5cjmV2q+B
+5D56umX/gpOyKxS4z5V/u6SgpgyBnu6wZzTUyQDuNwhT4jh05Ss18QoPq55wdVXVps9BV7YhBgY
WH4NJb57k1wgtlSce3dv+V4de/TmwoP1487VsiGr828l3jT7BCoeUC7VAYyp5abTcwv9LuaVsnx5
uG/bgQKEPi04Oamz+G4JNbtOnoYWjVktg04+nUmj5siASEHi3O+cnWxqdsc5oTMfjdk3d38+Laky
fmeeTGQx+Wb0rO+Qd1Nqs3evX6H452NT8q99BMrBq7nbrLPCuBn5ZoqvJKJRsoJ0OU2emXxblf8G
NA81OvNIuy3lMnhA50vOGq2v8gPMTSRHsW8isb5j42dkMHAq5F0IYK+rAubaH994OkragbOqpD5q
qqqIQaXnhoC90TyfCclLrqlL/KE4ttFcznFVSMM8/tzgD0IfYRD5D9o2Z6jzV2TcrxdhCvksSjIj
S/KQHZ9egVxFtPHeT7wyhYBP0T9UejhSGduTdZNTlqaEYoteTS2kYg+YMdyBnyJmeJ5cTZjLEnw0
8bUElby+7ulXWcqUXyodQfAEhWVbCvDpPt4U+fLisuu2EmXg3Z4LTa3ZYmCufxweB7AhEO26AALh
4zJiIC7HL6ewRBSpGquV/E/IbblXqoav+jyIgxSeAPjMj/dEcXgyjqx2LKDOnHyfmYZuv02ozWe5
5ILsQ4keytrIu61psPe0mmm3AqIlrTw4ykKJtItn81STCSX6z9CT7SKHqdNfaivkT67gSs69EfF/
EpYAuR0xtn34DojNiJrMLFEiPyZBRk/3mnkXknxM3V8vKHoKWw1CPterOxhWJ5MHdR4CvNvI22q+
P1eDxpH/v4YHoYPwDclG812w6dJdZaEcw1dgp4aYAAAA1QGf+25CH/lcrPAFVooZMfqk+I60qTuC
QbzDSegUcSXVOCYywTnHaQKgCGLfwcWUz7hvQH6Krzuwh/y/Z9lg4WpQRHKwwbFgtyUfSvfeAfpz
tqqB1ytB8w63tvwGTA14zi2hbKH2DqdIxyI3GyXC1vTtFhhyMdBgeejd9hYWgkGICOR1wewuQ7D4
myRk4CT9XOBMgVc64yjZfJuFZl820wEIP7xPbIn0evvoFrN0BFFLBBSYKl3HfgRYQMYSX9f8AcsG
7FV5U60pNJHGz/fW2zbfXYK6YQAALAxBm+A1CC1RMpgE38tO01a/CAbUpXdVE/9V//9yalUmFPUd
0choshuEr9uDrtrJE09k+9zPR9XrzCfNqfzslZjD3LPGzO//ysiqD2cEql2mPB3Nxb30XeXCVLC5
4m9lDd8W3IKyN3aNX3wquR+gxePwmDru2LjIL+AQ9K3vDdmpxoPpPLVoo7V+4uqz7X/7aSYEGokf
EPiftjSR4DPr/I7e0cL+23BEfRRsB6V62iWuihiv7Fn11LjmMSc4RnqAWlmtOgAoFzv8tS56kVmO
n9PN+wFaUZkah/4LUkQgEKlNhw5bmkTxdLuLRybcZ9AVDwZHgsraPHoi2dN/+xIwNTfcxOf1KMUT
25D9+KYMhX4pt4Oc1M7+qBwxuaGynie93UVILR4wdp3iSRF2SVqY4qu/wETm7bqPhZ/nTTcpLxIS
yGdMYbzAxRQdaSHRpwXokQPfFKlXaHC97Ei+EjDGfy8K20/dP44Z79LCbU2v1cFEFaAjVD0O0izC
0mJ6Kf+Te8Bvs4qWvu7YXyzpxqswarmBltKExJsjdZ74CqB+fs/UH6vrPHsh4wSi1Zc0Ls6/n+8q
XUeDugx8rwsUc/nFOlNI9haAcY4+nafuyrX7o8yhUhgKzVLr1sdXN3zdJ6IgHEvPa7Vy6LKUZagI
pe92qX+OWq/NUmJs9czxSiHtZw07BOvJhEhOMPtzcIf4Bq9oqtoVaSWw0E4mcYov/oc+J9QAl9CS
umYMP0XawitStkQ9IS2C5e3eGUvgp+wB0RQrVYNj+4v7I6HPkqo+I+bhU+lppb02W6X8qhOCzGuC
m3kX03/juOreAJ+/wlXBww4l7rDrylC1ZmRIEflBJpI8kcUDr2qxMwKLATBF9X0EEpQLToFRPSQ/
hBrHbi/+4Uzo9ILZalE2h3attwX8FhQAK7lsgdUo3LFynL5tXhzGkSsnJE50IDoBIEQbUTYVBefa
w/lRV1buye8EmIZQD7i3M74mXpEPxJ3LFjojfZas0WyRZoy4Rp7CwRkUHjQYtsy5Iferp6vyXHpT
RLIQKAZOcdB4QpxTPP1Tc36Oe101LJ9Y6CRjF2OuNbPX++Tfc6qrsTL3+lvBOggKaS5PAgbcULBh
jQQWzShFgRLYzA/9971TbbWT6V9hvGiZSt7ohCpfnn+nGYLGbKjZGFVgfykmLvpMglsxjXheVYNv
WG//MlEg5mpuycQBApj/DDuqg93ul5SXo6ueut0qI20uG7Cun6s+TlevnPKn0ALHmVcRR12vWEbW
9MS7K8QwdxYeQ0/975+7/7+BLIirhau89nat3Gl4uPuMFR1Wdx/XvDuV44VNXIl5gAbVDJL6cWkb
0jo/wSN5I2dlnTEOUw4AP2JFAcsyu6+TR9i6KuZoeu/qkBCgrCj6rlVAcpSJmmdXByKi1urWgmTj
FES9y1OPZRAfWtFs60GwzWQ5s5z5FisyWlwrsJxqBq7gKhgFwiTjF6Bo1LTb5WWenNpWCbp4hbaB
yMKPkhC0/+90VJD9RgIazyCRSL2W1O6WFIRaJXzHzTF5WIONMg3n4Ucq6tuVe2PUqSFHYpHMhPTX
ho3ELHxC6a930B3tU/prHMxy+ODWLmRUzE7nu4sGCikeiQGZfi/d4cOJuk9B3zYg58BijbV0X7P9
d1ByPwYdajeYjcp8ZegFYGB1MhDFm6VFn7hLAhQb+5vPdh8AbQ2CP4jUFbrU/5HIsF1qs6VFtde6
VYIz0Fce8f7+E4lOX3Shm5MqC2zkOZlhtt3eL+6BmAlpqaRiK4NmcLvBrq7tFZwS2xjR909F+fxt
jzuOlhxe5bZ+9vS7TCBTZbqSk+Xp2dKnnpHtX61Fv5t8x7uKGYTDPr5fAzHXExXfuffD0jpIvX1j
DtXJIbKJredp6f5RAPXtH3+vWTU9x8GiXfriwjFJgBQpXtGEnydlJ14QjFtJLBIGzh818/z8jS+B
1rFEPTfVsO/IvaXfMjXeq03CeZdxDsFz60QUpoho+NwEYBN6FGxhoRK1z0cYjFw2bh5/wahUbfQW
wuQcn/1JN74CeB5uD2TmIkLOHKQZRFfyJNSUAFUtW5XYDZzgZCx0MzfAMuKcZ+vn21S44+Ojwe7U
OBiW9w4h6+kDZYcS0DQpXfX7aZjJNvsS3JnNw0mZTJRhiOIJmXnmXZ3PUohG36gv7b1k8ae5xYbM
Dk0sHgXYTC46Q3Jh9WOLQv/8hWZkOz4Tk0aBGQqFrKiAzf5cnnyyN4pznwoUsYuzqOXAvxDqKc5n
ntNVxLuOZIVqpif7MQ/SYurFvVSvXFCQzhjf/y6IsrujuOHipS3LAvbGGDV6aPtVo5LqzKSrB1Oa
TXarO/cnEgD1qz9NpxsOmIXpsv5rH0jGCNKck0qszeyC69VYqwJVkoHe40nCaxXMyIFsCqDLx1+w
PGcBGijnBxShmeaeZedIzob7s95iwlbvKldlVfIwN6kXHkum7w4Wgknsbs9b+exZtMLOk330WX2l
DHJmG4GffSpQX20yFrkOtAmcdeM5sJ0LAToNqIgpCbkn+6F4cU9THy78cVOP+Be7TbncPOBDUNV7
AsemMZB2PVpj3W1TJ+B4CWyfT/m56yya9FoLZM6aSt13AlYRQX2ludqYC4zahJGi27vrqDb1CDUE
65er4CDusZtR2Q6POTREqc81P+mJf0jQH/iFz5tHbXx/NpSXBMv+2WObsLbIkuDqgoFKab9BxUla
Zg+C/SMos1CkAsJ5YfKZEdi+xUoTvVdtmjwy29Wh95b7z3JcQ099JZkCH0Y3m6Xv7Sk68PHqKCI9
oq9bviU1M4+Cv4B3GzN6Gkh+ntaXmbCosjdrjxXT7hJrEceWWffPap8ZoRDZLw2HRL/9BJjqkspE
k/OcNHEqrEC2H4ml0U9Ju+oF52g7v5Rbnw4WYlAGDAAb6DN/smU8M5NfWBfsOpDmHHTS0YIzRIXl
QKMHvqtk7otNvmI4q4VlXJF5wdFiYkwyHMIibv82jcB4onHxOX95/kRi8EdWmN/2nlOspw8ZGadD
dhMdiDNmBm/J0SHLGRjDo10nCh4kb+NUGsmNGd8FA1KsGQOPVobSkq0tRgkNBe0uAZBP4XB2DDq2
ODCeXH4inzG8wVDNaOjxOwbqLEMFCt0LtzbQxD/1LTRP6okIoyoCUGapZchfm9meOFImo6O53q/B
ugB1UjSy76+GfW4erXcDkcJz/MqBdqc3nlSyFAWnf75TjY2chpegleZF1ywQkG0Zl7weG1pW+Cne
k1gopuUy+3X99gj7mEr4R2xc/PZk3exB5ZcN11T7uzF1ItegT1bGNFBbz5Su8l2nLotdrqDru9NC
L4mJj1hqoVWtelEDGLS+Min71/fYS7RE+dTAuzUfvB4txpvj+5/ESC68tQ7yCRy/9CmvpsIAriWs
lSuopFyWUGIET6kURGeUNaptP5mHDq45o1kh8xMy6d+rzxjbYsxLUmOy+8pTiWe9SE0WBb7OYL2c
pOkEZdXk+lLozcRnh66Uv85ejAlTRCk2+njpVtgNrK74WkVRfB+jfjsntSLJVleTuHjKWWrWRr+b
rY2o/JL+jKH14Kf33ndRrLetvejcGXMW3QYVB8lSzPXNpQZLRHOxN+e64Ud5mLqZnc5n9PSg+dOd
pAMcM/bJBJbOTm3fgPpJubMbmYhtiNzl2w2LM7JQ4XZJJkUJfaew2pyb2/egQqZ0D01DJzOPtCXI
l+pmzzWL1pcB20pVO2TU/eueHC3MrSREEA19KsCKnH3NT9j/HE7SfN+ScKyvDq8xd7uJKAzWxQPB
j6EizQ/Ix1jlBlt1r38zFP7qblkZ9Cv5dfy7sEgOhC1Sx+amuz42HRczu2CzMID/F4jxSbf7HLdm
i511uZ7YtCJJnwwhXWbezZdvXampGeBwlgpHTw4S0UTL39NmWoewok6sWj4iX9j0oMET0THc83VB
HrksGxOG6+829QKnEWpAMYdEg1H+FKZvEWw8GeChbOVEmk3tF6kpLfQO0AMKt3PlmLeg7VeAZci7
rACi+SHrgii3Uu91xdti8Kb1Xm0by9/rQkUX2b/3XxhWXkT9Qk3+i8mPxNdaYgKnrK7voObEWl2G
IXQx+e4jrYjxvhD010fWDOU4SMI9b7zETUjgZUcThMkpJlz3ZO/Vjf87RdSo93h1X4KUSw3CY9s1
5d759RHNZeHz6JmfMSyPlaRs4XY337Z6a2bp2DgO9Bu3rnyUXXTzVWIemweM30wMYRXHAKf4/s39
qoaVqdOnbjf15DiWRnLDr3meCqZwqp+QFCEo4SyLXM2LecDjTr9I3imWyxluNg07zlAHVAXnRA0c
VLCXniRyDAqgHjXQ8eV4fQhFPM1fpXtEk8BH3Lw/r3enPlCW2zh0JbxsQ69rH7HxPU/3LdrvQBcL
XukZQARAK1VLLwLfHXIFPm+Ru2pz81GkuV1Usd1PDS1vEzUILius1ubsUoa2A60DsUdQ3ifuMWXz
FyKNeNdWCSkoAUUVJ4tU+zcUov6E7D1Jz3Us7hLGosI//tneBi/a92bOrLGoh6GfzCUoxLmBKseL
mRbKEaS8XsKi24SHF20Pc6o8lpf6U74QbmCcsnckHKp2mzxy1WNwZ2Z4p7cNOnucKnIIJzlnXNmJ
vQOi7EijKEACGMRwOXpU80hijA4UMUfEnUd9ucGMly/qgK1N5F1iVaMr6pzXIaCiqZ08Dqj7JW1i
vvpwEZAkrIrn5/p8+n8WYSMGm2lQt35NhlBOG0DJ8yeULNZxJwssQ6NFKDJVVgVhvrbZY5PZM83u
xr7JwFSD+hui854U4jBXNcChxwLekfQD5kKIBQdUQS+QT2htn5CBARRWSV37wG11P6QFmN+JKc6m
bQ96TaNyk6PKKnvVqBETpaUZIfbWGxhSC9HHf43XXnj+NQyIZMoMhXMkXceg0yR2KnMsXFjRjRmh
0c6FzSL74YhvrY2kowjRuMbWCm03KX40SK3w0LJgcYre9pgrTOO6f+eVn4rsJ4wkx3TOQ8S5Q3HM
6TcySfOf0fa78bljiB128IAnRDKUMszdvz579SoEP5fB6ZmVdFffjKxjacjHFsPn6doBG1P9iP3S
1AzQHaa7oGclBKRsARkO29vJyXEGjhu+ZQ2T0w3+SbtNmfMNBDzqHfNt5dDmjggbqPFgjYYOaL4S
vn9eKb7VkJI/nEJrpol4c8Fn5/6nIP2XfR+OlfuDOSqAFrv/0SKPt2/6rtG5x2oXsPsvkJyjCuOg
cgzJw1s3ntY3HBj5puUgk0AgJcORpMoo+UvvuPvUaY1WBmmsz/CCdlYtHbsclBccBBtaUtXekXc9
hYb3YcrxpDFkH/9pC0TF9iLVF2B7o2VeIuROBdUpgYpMSjhzrvz1L1+lumMTWNzjjO7CJKllkDQ4
Q0us++KizBYX9VEEKV1BM3TVHa0vADerIfsStM9oNR0rrdYtSIEk0ZPXmX2aWq/zZXBHHe4YwUjg
DMcRTRLdRYq0r7LgUZy1vRQowN/l/CjOO36qfKNlwhmKlRBCg6+lk1DtBmvpLbqkfDeGJAPn0Z/k
KXLSL1AmHUsPNDdXp+s0mP1bR8TIm4LCQV230XisSEHdIsIzKbJ2jpBgAjrVgjeC2KG79nmlNskT
cWoDdF6R0X8n3rbn8RdqNN/U8thz7kfxwWmCirApluUjStHOrIAEa+YMjMIiFmpgUGLj3UlY989w
Ut89VwlY9nRGOPpdKouS1oX5cTsYnReBjkPBpp4Y1NW/fJBmVeI6+R/86l4JXUnDpcQolwXOGa/g
0LOprzsh89L+oVdUJPqGdrZdiUQCOkSbLaTmhCX8MxU95Pnkqf/Awm+gaesxePZvLkkkRbcxFJH0
D3z51HNgGXH0vRobWkzNkipkU0Rns6s2HZ2c4aavE06uBJq2+rNQDUFEemNlFZou0eZ/eq17wXkM
9VIAbJ3ypJvymoTWV9gNIZV3Bp8kujy4QpPlWZbOztj7NYiQd2h9EC1CzzcXSm+O4wFCey/e6P4J
GjKG05NU3hyawnY8HwjX3hKxolKwTELd4FNW7oZZVLKDLXlCQQ3eEln9Ltn8XNb4InoWBNxLdeQM
lg6e5StSlwFfNjhzBBym5iTjwa0pEl3PCuNqHELbyHVrdeRAYuD2WuWJngnoNXAsv/Lqaf34G6dX
jrCP/6m3hHg/KXV0tL/UlkRhctBGQ/o2+m14GLMQRsCJPtpx8sbs44WqcFivQtaZYhhsbMVLX75I
eViaJnv+QSsBE1iqb8Drw9cxhuHFFSFUYkil+4lMmLeNusIx55Qz8YcgsOblAiSIt6Qqd1+sQ7sX
Rcu9i5ZSZ59dj7eX37hgqgEl443JHPtxgH4wxSD+2N2bgMOQy9yBj+0a2+x4r56Zq6GXr76Y+lPS
o4bd1pst8b81QWbAB0wgg1QfT0x1V9Hm58MAcdecNwvKjIM0+mHxSqLfXNgQBv9JBfiV3it6muz4
9r6f9hWGDslH/f1O18a6El3gGKHR5ZeL02sTizkXgnz+E8X0QYXwxckkYnO+k6/1OflunZ0w55cK
diaSLdAhz0d6jX51wUMGAeWJjMgvRr8xTjC4r2hhAQu9muusVQkK8rTPlA3t0X4KWe60qQz3d6BV
wYYC7Go1Oen01W6n/kTlHAIV6zx9qrRWXKWCc7sb4NEkr8DdbdnwNXmSOeK/CPl1NmbWmYReNT/c
49sLtGbhnIlC7hmSnUFNC12jZMwla/zbPm0WEtiXluFwvwcowN9K2TKqh4JpPruUmDWelhu8XVeg
G6oa2Xdv9klo0j4m5y+x6hH1ad2DPj0ruqBeijfFg15dyhssQQ6FmiGXydE8gcRuTKX+zAn1ozkZ
pTWzyz41ILV8JpX5L36VB6VB/PGYhIR4TNYLvMfWwTioesDXS35hucdtdY8jH2dqpU0E/IHKeAew
HiH5QNmOySDYI7gB3kV4jXxrV5KrMyL3Nq6S4cr9nqWE+IVca2HTPhj5LzgZ67J0HamDNclTCGgb
YXcwhiXeW2EgYVZzgb4QvfTGiN3IbR1ui+Z9JEIWbfnHjIP5eXA+DPacsqPsVtQUeYjqiXR6eHlI
GdsAFG40BBGuoLkgUAlvaIDdIeG/p3AVfEpmYpGJIctPp1kqz8Dbu9sx2kAZfOOkp+lr7zOVLlYX
NeuEjgjJdbWNWbOJD7Ung2qpVPeE9qFFBPBIJclMMsEkwjmA0MCtmdsWuq55KnZcUC7arrJNqAUo
U8/IJORpCGSfiwBXDfrKCh4w7riWXOHqkXQ6kl9JCtaRp9w+ntBmzuVyJDIKMaTZ5lebJPyCYUO5
oV8Ak3KvjDaZnLVJic/tAEPvOBs4SdMXabQ3eoGJs8pyjnbrtNKrTqw/LUzS/HCz0+F5dXCvsuAv
+Seej17YlTIYk/gdQ/+ph8ZZKCqHJhZM874jDykOkYoAfU95aXWjN7Okk3mWf2HXTC467R8pJimH
LU3GB7hkJgzYWStw/hNmH50d3c+a3pI8oz8aQ0pZ7VfROaanCtu21EKxMKxKEXb30wQFx84sumI5
7Rw5c8HsRvCBVSKkTLhbyqySELfwyNKbZkLqpaQxdQKZMJjmo8NduAUIShXlFADykJRZsH0IWoKX
W0TsodvtlLYguF9kQFMktOkT4JIN5CdN0VqWQbKnxyAaTs41zIBT9Uy05FphA6F454PC1bQgN1th
rAh1H2FtGoeST3IUgqh4tp4lPHx3itMquDdUlYG2zegKmaPMixYNOiGCOrkUdoGs0/U/YMdvPXqr
3Zxaju5f9xHnA4quXyYc4ajMMYNQHrN/xKjq5RmRcmR0pPCQFclZikbqV5xeFQH8DBWw2cTcVoEp
5W84JYq76Okk0mfaGZBqay5nyicrSt1MTbG4gcWXHush3CcYGyYuGsDKKoqXxSYDE6onBSSLvNVa
SToH6skmj6ogmxe0jISg0XyVcdQq3wr+7S2AxLRnaO1QkHGvUdC089aNIvVb9kJ550JWTdVF6pcV
T6/tmKEuazu7HMkfhXgNWC2Q40jCWmJp5SB1Ajn7Kxk3/SL7JKf5bPhmGom4JXjk2x5ay0FEiCbR
jPz1hK4X7fXXuPyfYQXjxmLAbm2EXuDWZ5QWjxbpKu16uKct4B2fK5ayOnuRab/1eyhiGqReXnYO
Qoeb9KuNVatxDJj1ypRkZk3DGlkGETDlT1M91+Ymd1DzQl0TZ6Ifqcw/GegdBzzqSwUAfNMq+TnS
rFHi413lSvh6CQHswuAyjMv5mMzsSCNrko74h5yhp0hxENiAyii7PIuiQK4XueCLT7Ix46kEyAYm
buggKcbQSqn88bO8IaA3dyarEFQszArIXdMIK+da3rvuO3eHNqTnKcr97rBDDplLKLpg1lrBjXUM
ZWTSOzVICh9BfaXcX/xGQ5tq0krZ1nTLyut7l8b2R+pgvD1eOmkXODXW3tk1ALxfnyHXambta5ga
GkusmIMWfHr1jbz8romaq93fEo9mr7ZN+3SQGNhFb0fP8CzHlp16gVsIt041MsyLl0qDWc+0Xoun
XQ9i1VAs7tN/9xJYl9CY8YS2tE/lscreE8Vowuvllg2eCkaKEi8P9sZFcd51WgmUb5/PPJK32KSK
QlsMzwU24OaWGRnfsWn6t6ib+Dtodt86wB3/YUKPcVcO7+C3zzIYGj/j+npKjfLCDB40+y02Vdfa
g8ghNtFe8NGC8M+vEjflnr7Qb+Jtb0uJ/ajBMa3u2hvCut+VPvx01qFfA85ea/JumUioHh5mJ6fP
Jm0d7GlAKpu8nje8YehUMvSaHepUskuFt61SbKU+rm/Zym9ZL31NUlyBnlTzU5ooOPakAX1mBp1F
FhehMMeLVxS8L9yZhaVPwonasKw2AIv1bgQ6/f82eAogLxFNXhbqLrMchbay/lfHP+yXJ+D9oKVo
u68fXDvfigV5+/dwXMUfERGqvs48PochWk+14M60VcAbPsuGik6cMnwBruVn63PKQ6cCn5KLPxap
84lPJvv9wxqUASNTifLaEKYpBpVToIz3h2d9T6ngBz0fIzvjqz3joUFTzZtivOaKEgRzb4qQ6+lK
NO2lUOI8leNgV4YyCmhp6OdmKquv/l83nOPDf4jmTqiYVBPi86Z7u7hQEB94NqEHP8mBD6TyvfQX
IgztnY292Iga6SAWWr4JE8MLu8ar/Ck6tki6fYMcCdhULLf2dMT24cXINO0qEnOBNbouRnPHJAe6
EM+SaQWH7oV7xGyn56MtH/8Lk56wdeoGIy+/Jszf2CE7/u5O0bzp+gcadqvcVcq/JZKlUpv9aNJ2
v9fGAmZp8zcic8qhCj/3iL1Ufw3Gym8eV+X7PmqDLdik+lU0tjs5tBBgGoWIUNNxeS/tKUTlZjmk
fsGlVP72iNaN0QSMuvL5/sv1QcIaOuIo+lGijUXOUl1J+wGj+jwzIAzDdijZHwcst+EHGMvhEnFB
sjPh82T91x9ekSAgxZIF2raiYsnUB92Pnmn4wZaH1ybIcrVhSHweURPkH5/HGmBgLxwLoJ/VylD+
+W58wkUgzBc6W4GBNWcJX92fSRpRm33ijBKxXW9OiSheP7vyPCa1KM2C87PHCcIG7AUJB9tIoc3l
aN0sJxspWG3T0CjRA3HjyKKPag2ceewIf5g7Dlz7aaOvb1wJCreCXa0KsziFtlGY6Mv6wGLlBsAm
tlCFbfQkJwmlSwTXq6Azcis+sfckzvoWm0vxK8Z4MP8Unh1m0I3P4e0b6trMcvMseIpnmvm4rNQk
u3S2fs60aoocIvxRwJYFqYUy4CZ5yZNSBoLI3S36EQMMWpcIgMDLtWMospoCieLSkox/GoCoiNkW
QyCiB1zvd+sf672pPXKn+eguIELHYPKA7AD0w1Bx6osWYbvzQeSMXjgZp3eJXH74w1+0tl3oKUh6
RVPE2VgDISoku0E1MGnp5auAYlwbUE/7x5grf78dMw8ximjggb5CHHjVGwUKhvyKXWTD4B/v4uom
hsVGqDhXQDCTXfs1T4GgLDQhWo55Nlo8ttX2wz5f7GZcIXoC9I6cymJ1+22tAMrlgyXUBJcVRvbN
/51M5m8mGSIngt+69bTiqZ17TQF2NvomOqPk+TIav5Mysrp9raGZbEoxzlCiIyV7FBNYTJvJpAkq
0VWKPYlWHFAR3Vi9B4exTMF7xq08Y4AI6KdFWXivimbE7JAWUrV5O2+UB2mUh6Vur8P1dl9Dda32
KdP/BF09ILq6cVWTVxYU1aRpRJA+PTnB/3gYi+R4OoHTrSHdwIlkZ4u0CJGdc3qZjDpqMO+OfzDI
oA29EANDur36FpcfZ+VAYxtVCrgpDX7rBRtipYnBZjbIQJBRcb6W70Dghdp8F3oI+reDMoavmBbb
oLX5Bm7eBAOWkvaYbHRx9Omf6T4ckzzoYCFTbcaqFUDCIAGG9djB+9AkAxVXgDfVCY8JYAwOi2yh
q7kPfzKOQT1mYsbfNJvd02mtvJPZJsahkHvbmX4uQ313jJM1FD6gDlyVMxHF+q/rZhwNqB+kksSk
VzgqUDvxgTlAtfrryo8NDwR/MCMw0CliYDHztdrnWYO9rrXk3RUsxkdaQbzKeOXZv4O2qaBOr9NU
/fGTuAlgHXOtuJR4d/3/E8NyCnY7Iqve2kBi2TBHbPYZKyjl/dpsYspGZnvYbiy0E4++r4KcfylE
8rcx9X6sqhlLeYPgkqIeEYnr6Jn3hZn6SL8bsNAcof0l+FI8j25CIzDXxjKNWvjsMnZ6XVTv3xIe
sYXpQFNc20eWZY+3p04nUnvAkIQFbVasVzdDA/mDr7C24yxE/x5UyNtTqgKJPu6ETQJWmst/iF6E
eWoR62HAUSOXPWRL7eKU/o1wezxNfX0UdauYtpzvOhih5h5o2qc84FAVvfEfNAylDbkLx6dxePTE
27bC3dWSoSqTSaPTX192zdK/GKiwopZxnA8NRGZoGv3u2lEmFl1+089h0Wt9AWG6zd+yhMmVwUJ2
+GT6/MRfAgKC2KNODXUAbuqWc7CfbaaHCGq/iN3EnNUGLWaAXFvZRgjZ0xadwc82szK+8vJ9ztmH
k4tRs7s3U5a9P/owWkoFXui7RiygUPeVQwPmBKma2BiKscKvAhee2n+AUNszERRxQKW5+wlZttto
RrxOl6rbkAJggbG2k31dpcvSBGQqCYxAcZjs2G1i9b89lK/jpPLbHiwX2kWCFMrjnj3tdxYEgQ5J
iOTJ8+4PBwVonXZFuZsfFuxeSRxIusC4no83vnTMRvDggX9jAL3Zs9jjNMf/qvELKyWYbPXCGyii
ffqSIMZr90dLicMqOhNf8pY2g2UCOIc29ibJXcCAvrAn5lwryALQAw5xQCcPbBLwSL0Pbpp24jcC
vcFYjfaMwkdZha1cp3D0CJmXKU0CmT+IW1Ey9dCf8aPJIfU9HOTRE7XS1OS0ml0tjLYvx8OStB+N
ixMe3kLtW1okZ5yGmdXoLcSL2vr/4sxFQ8NzjlzVgNenyMibeTDrqvaXoA/pZk607ImXdhEfqzt/
oTPe+RsO9Ij/FpR5WSkktCT6gfLLJvFkWsN2Dbtib7+IPqcxusGWGNmUFdkDLbZZZ5ML7RlZAljd
qp78XkdzB9zB22igx/woS2mvH3fGzZA8wvTlYDWMJT7NWkx87B3x1nU4o2gLWXnV6kXXW4/nVpuG
Lzy3jh2OFrldpSX0rjGMfjCFgtiNgseyYnTtL6Yio5do3+O0Akr8uxar+OzZ2whvCW4NBITEslbr
HnvFLwv/wSvXbN9wtxemIefR+TXBoqsmClLW+IGbOBr4xvxDbOlg53Z+ooXF1fFY/5QH0IInq1uS
T9fmQ7GVH3exWJWOItefGql8fP6g4KNHHK5YGb9rDAw5OD4NNjM28citklLIPCCAKnGMaLAGm1yM
FvE1+n4oW5Lj26MbsZ17sQ4UwyF2q/OoMqoXigY7iQ9hsghOmy+V+ecfarxh+wwL/ewqYS7xlX3J
ppTOzvCYO9CN1iv/yamGaYTQN4Y7NGRHgJ9OqChBgmQtPwDATc3py5hRbGzjKk52cFmmEovhHCbz
4D2DByzn5lN34vxZ1gEcPptwEYV6fGCajml1fIS31taVtQGY/tTP9FkfdoYQ2tEMO6ux5MGYUxzM
SeZFLVeYAzkON/tDosD4v0l6N3MxiQzX2TQ4f+eez2XR/LoVrjSKhkMXFVn8Ri4jAIZHDQWR4QJI
7ajOabF0y+Ru3CzW+GYh8FMGysJLOnjSNRRrj849ZE2+tH0bXcuNWkFSy6T9tljQLKr3PGQQtCnr
HZeooGh/CrbQFwZ1nCdf2fBfh7et682Zhh7I3Q5ivGMLjhyDxMAvA8rhOzT+qCd2RKD1VnoRmT8h
qrk1N0QK7I1MU8TZTIWwQIyrW4mqYoq51yXNuzXw9wPOxsBZzrey1MtEvx9yFoHQnzB0mDZJINkE
OHfn74odWeIMbDWd3YxgopCA8DnVU8GsWAU0YZ7/PKNHsAS/DkHZMR3jomiBcviHA6MLkbH/jYrn
hAtcyPo9soMiWnwdOP+b01O9ZexWYAx34ve97XRrp/15qtTxe8YzaNMj/nocqZuxQxGSeVM6wLsY
wvM9rg3exVjmONqqtFw5GWcWd7bhFQQ6A1hI0sVfeoQZfeMfFx6VTDNY1glBZWRH5LcKxRcIz4Yb
pNVyY8fhMCNQCDP2G3OJTfiUZ23+Rxe0lybiC5+f4GVLynYW6FD6gvcMCtrh43q/rMTIQ7nWkchb
ym5Wk8C0AWyhIesibw+WfDju3De0Yv1JrgGNQbKGyIBmgC3EUKpyi1AIKa/sakyZW7pHRsonJ3kL
nSL+PgdpFH2KLIzPbrjns1u2FJtd3m5qZcQnCeNUsJPWhb8C69ODZR4gaJWgQaJh/uJngrYcvkJ2
cTwtIRKtrd65wltTcwp5hEt+ztktIKcb6kv9aKbeAF1f6Zsu0UGR4cpgqnrynPDtfKn9sIErJsxE
w7qUyldnAMf6oKnKAedGx+2IiDoitlx4u8HESPdtGnfbu1KuNZH2SSQf2Sb32zaS1Lnz1PaB7JDM
ozIXq1UJiDyTtnF6tfA/wP3thI+e4MzYVmlAUJiV/qQs8k8rCIdP0rMVtqPX9C9sADLfY6B1ngTe
4NmAbSWfhPiZlvHFm4E5LUpHsOG8BlMlkejZcIrkYCaSZ6SOOIc7UoEx8Jy4mLL26pTuH1x83Ems
1lROzTZrvlU2UufLJBi0F5id5lSrVLXF9Cwyy9D7q3mH1uIaojPZ0/M/YqB1/9aUhOS09vnGztqC
epvmxytyuXX0EDi7x2Ojc10KjSW1CDiCBt+9pOC47vzlGmmoYv1XP689hVn5X60fyljLj0cRuqhp
qdMoEKi3j6ZBQHWwyqIoEhbUHz5AVmcYNDZPMFJHjWk+hrm0lkPh738z3841xZV2NLvkSRhkxkf7
n2reM8haswdFaOTDOodLAtMWyq9hC8/d2kdpFJ9r+fn0BgFvlIZDWSEf6rFAE39Cos05zHns3C8s
0zZ8OWxdJUOWU07pWNaEwmZO7l9IWhirTrpqD0yvx4TTU+TDHJo0YV+6L0RbkxxlCZ93Uxojf+Tk
tPZgInbshei4dpuBS2FC5UVWL3jeKsd7dB9pIeXZk+MuAomv4d5dPV81sEc3WJ66Qu83pmvAHJ2P
f04nZm5Xj3XsOL80RCEGO3iADA2c7f79WlgOrG+YRxF+HC8w9T6K0IbqzHA2UK5rc5p4Zw7O2JTL
ZpT6kml1s/uQHaIuBjeF/v6iCDh3APoA1T33fljLCzUclmADybTQu/QBsJtHKP4fNv68xOjhZvAN
fbS/vGoiTUpF5vcivGl7ZI2gn+mNisWf5CnhfS1zRszSJXvs2j/zN9MAPxv4OmQWoThbwSq+Ssap
uTvnzWdzJzjLJU4i4U+a5vIp/cuOkKuyBjgi7DSe0eWMa7wH00KBoyy8UjxPyVEimL9AKOZkM9LO
cR+dKoe6kkBpN1F1gImm5JZIOfQyPJ3nIjDL2agDUFbtIp6K9Bzcw1F/wi8pdX4JF9LS5ZuuWQ92
gbY4Tj+Ch1n8ymD8iRd/9rAjCEd6fT+rofsZoypYEp4Jv3V35mdy/WewkKz97ENeCViIMx91mMej
ESaT2+fo0sVjOAE2T6Is4x56GpvejG1KdYOYLDPpG8xUYAiUVuzdVWX3S9DjMDf8wT1UDXQWkxIi
OfHUwdGkOA6HlDQhjTUrEn8OkLqYDJJ2vNikaKsAcb/jddTxS7ZaI4CJssM05tEnnqXmxgDsFEvq
tS43rGM00bKlY3AoEKpD1+92ntfUBBTP7JVLOb7Ejufgc1la1qdkc04R3SVZcClhAp34foNfRxFr
cG877IybfJ6ioAQQUVd2hQMRy7zeNPJ0oSQ9CmCw5CKnXiJcxzrTg4WRlEE77PwLh9ZpnrJRUUOX
bO0BlNpj35t9OGktsG3SY87b7WBVBajn8PULUxOb+ziUNIqWP+zVHjsZ3OwlSe0QKszgll8KbeAR
hdIPLez8gyeVCApQpMgndRQcYiyhwNvtu4qWLKJgHOBjADAj51b1SqVVfLgZ4njDa3zna7xDLmIA
gu5Ro9f2Ik86lXvTJgTquozbbfa/OOj9sCAbvuCv1QrPy/CgcMy0RXdqtyX90uITUyNiY67skuZY
DSICToANULQWyXAp52pqd+7x3wka1LfrwgJ662Yq6UKnM4jb/9Bh77kiUYeEB41VjoHgSLw9xneD
yeaeyMX6+jDB3CZUyLxkkk9u38LGM3vdiffnc9Mqch3t0jHqYlH7ykG/IFWl9TepwlOcBo0QCqf5
Xjn7w5VfrRsFnSv+89wA9BCAjmRYyTYWus8jLUvCzEaQymj+KeQAw+kiwcnv4VEczlxrtJZ6zEyQ
3ctTcL3qHkZNftgx48Kf3Fv10N0vlaAuNME+GkaQP/25CJe6iC6jI6X6uV3OdDl6zohyAZ8n+AwG
8kprH+O61a5u6N6fo+CsuxJlK+tIf4OUEoCJMlo5S2WwT5/iG/I8ZpKxFwckafr8WjsbWfPe9c+h
5QATWvF7zZNqnzLgGMUATrgUdhgTu/P72KHD2NebMBBmK5vQ7smk41JXnraEdVGDXv5BqlzPRYTU
izbpyD8+xMw8X9TxGwAAGA9Bnh5klGRMZ/5qw4l/zTzf5iMPJfYderFBCx3JYA6wp1dKLyV5wb3J
UrnNogPNsBWbwzztVucpHEMkeoGTLBugPFNNftsh8Aim2ynanBn+tSRPHahEExqVONoXQ1GAndma
p6OEao09xs2fvwaGCIo84q4u//wz/Gx6lhkXR06V7ztbLNR9ziV/shQzLhqIS9ZJC+BNqF/tGrfy
SW5swEVqZJOGjDdaE+tNe432kgWnKl9YsQOMGcrcmboe1SEIkSnzIOHWI/FCLW7BD3pwlWMnMm9E
7qvJ9RDP1hJN+WXOsxg3c0onkeeY995sHgyAAROBA1W4UNgQnKE/BrlVDVfJlqkfAdTmGCMbVBMx
0rmQd/HOMtfK++acP0koKWMbAF8Ab2iftejJbFZfWHZ8iUye6sQ6jbSc7xrmlN1vihKIZYH4FqHC
un7fwt7mh/0O5AWea/o/F2w78ykoG+uSEKw2rqYPyLmk9Y8Yq5UCuyl61JVleBzltosphbfz1ANt
L3iXqtWTbTR00T9bRQdYO5dCM+XpO0gVUnGFrZMMsJyOKG5umm/koZ0fSxc1PadJVHSz7U2xFey1
yMMgMWAgeCKHjS9RPNVhEx1v+tIACUE+3C9qrixqAU71WlLQTHCEL4opTqSvE18B98o44pX6w9hI
iwnx8Y9DygY2vBIAPFiWrZXpSvSrIXG+NQV4gWRrD20ezTJL5pHBL/o5l1OgpdHMzr2xwyczebdL
B0wkZ1DfXJ6XMvJeookpklIGdpx3HBostv+0RiNN9v7S04J2dStUHO3vVmlI0nZbxaNW5Sdo31Aw
fo+pVDcw3Q/zEAkKRL9wPdisloxJz93r9QZOmmqVy0uPEqKj6ElRESevqYclFbQM/PUFAm5vpLjH
aP/2RJYfaY8Lkt2M04i5qTfTiiggBGpBesPamf/rKXC5T9jOShVUPP0ou1NXiA1KAo5leOEEsWjt
ovqbbZwzsOEY/ySpd2uRPG9lIMH0onxWhNTpOtl/D95aabkSq+E2SwoPKsxEMbLLlY3AMxVp2da/
DaVFn9RgcEH9qbVkYS2f6MT06Sjf3rZGIA7AQROfU1KL6PSm7mK3IZUUN+25Ja9h+1xyHSjFSHPb
l/PH7wsyjz0RBzwPCVH+EWO2SzLD9VDaB61YRtyg3ZHGi9sCvyPGlqw87whC55TAv/U3sNWkHs0e
hvCT8jUfXLQ2qvYSKYyuw+g80/5S0UP/0gkHZPT5Vq4tO0+DTQBETzCmmBXOOUQxLzMO4GkTYiJj
RcBJZ52Wrh4a4atls9i9mYdu7eqqg3M8ZBdyXntQBn802AncGt41iI25xQ35aihi3cZp9GxFva+n
6I+cbjyp+tlkY0AoCFJLrsc3MJLmAQT8amyZVtNjt9Y3Rhnta9CKeu0sheMrGqmmo3Zgt5BAVD+8
c6CIpzURAlfiMCk0SKkkOZHJh74nG0Fn4twHIIpT4GmqAYYN5bck5Z1nfI6vq1syO2yzLKK6XxzG
srRKaxAEfS0QCqtPMLBz5XKlYBowgUGdQ6DDTR0vJlhDBYcjlArU/+RsyafVBZAxglsHkm31bYCP
Gh0EYQaFZMquMAVivvo8/N8fqp+Z5zuRspm8rWlUoqyiN8QDH2vzTPbmwOj1MLEb/k92dsidI25x
d3hsUmienoxNLQf22iUdPFZEQ5DLjsEU1tpyU5jKT/fTWrRzE1yrLhc+0pwxkmrtiiRfvVVfc46W
05HxLPSY8h0X0qH4lOITo2JgJPJYMWNQ/tLJmSV0kwytbxHC2wqf6UOubrqhHEoi45K3jgQQ1b0+
9OVPDlrPXofqnvB1OjOYgflM6OLGStRPjTIjdB6G3vxvgrTrk5BPgmW1K8qktwnjMW9jXiXBOQNY
DTB+JnoSnrSc4/iuPtk/f0wTqZyKpaVJzPMiCQ0XSGAJ5r+bWFbRE/JH2Jwk+kNFJZ8zQAB3FUr5
PrgEKQ5Dp0JPkjlPxWEk7pXjN5SxhNPkwAVAw8BUmCPcfSzdUrphV8Vgh8Q0YdRbmLimmDDjLwrm
2pvDta7b6HSyAnEx+Mk+vMlT60+kwI3PUGCbirYLzMF0XlQJ86oCU5Lj0lT5v5YCFF6Ipqv3MdO9
K9KSVekg89kL4BkRb66CQ5FwphF52VtkFRNpdOuHWaMlzsnpaMOkJF18DffpVCY4UEeDGOV1EiVL
RxPrkDt7TmpTCFXQhJKUx5+XZcNqA0d8Q5Y2uXMTV2rFVrn5vERhJ2jlfFp8Etxj3Ly7X1RYfZI3
JU8VXVYv18aNz6w11Wf5oQ46wK4XHdTfRb9Q+V2yNjz/0VV8EBWDvNYDz7UYxknzA1/9wGMogyEd
wNFAY2nCQ7XE3cUqYg1Ir3dk1b6yPpKQbwjReuVoGclHGuGhwCbnYO5Pzn9A+s0vPYqPJuwRazYj
hpsB6XXmteFcjw9CsEx/oiavebOlnBadBBx53QbFYqJ92KxC9Kf2oenOsbiQnrMke89nTtRy+RxS
omLElM3iyv3I7ZWVkt8s/JMYUzhMIAbSROblDsHXMzEY6K2ROvhrmS48Oc6/vyBcasW6RK/g+Zce
VGutZ+gfvNkVkiZJgx/vaClv/o5LaMpyOhOCUbZH1Euikl0yw+3J6Voc8jDxRZN/vIvDIrOg10CB
3/XSksPDN9en3we42ilMELNKgU3bZnQ1w6bKBQ63/b7CIVja8gO85sUbZyocD2XCiINkIdA044+Q
rOdlWL9BpmW/4iO/4kvqXyYZsMovpH5hbFN+BdkSyUgOFJxOKCMV/9Z2voGLFZrP1sL2p8dukdqk
90JydYuOlmXfhxriWxa4G3Z58QXPLeHRN/OR9Ouv4yhS6aEdBl92Q2Chci8ihvEVH4LLRcip6rTA
ZCQSkzX7wtXwjvbR7eDhJsA8fziNo5ly43yGhR9YOHUf2JnH1C0u2hS2ygkC56hQ+aYHTskXLGR9
1neICmFF5a2Zmn7aAKViXTh2Gqz4+ls7T5+LjuzZfr1GLI0Y/AYJjvlViVZHMtsRYXpGOQmZihSd
9vDwKe/Rl+oNmYVBjeAQCVw4A8UwhZXFgD97utCQRkpA2G+ndKLj5UeN5gV/z17Tr/HCLctXCjwF
fAWbhTiNm9K/5uPNh6U7f9/efSYTFGvCxLSYvbXKxECydlVZWRGaNbkJW2hCs5qx9udXovWvAtFf
9JVERx2OYpqX0eEeE6D/gniOeM3wJWDtbiBxxqiKkaMNqtnn8L9jaLnYWblw2a9bdllepHBDYUHU
/0QwbRz4eP27bj3yPb547+gnmUfvWdwLtwpjLHWHb2An/2tY6PuNmcdYZ4Fiwzmsim4/hDriLMnZ
/IPD9IcZ6sdTTq9QWm0sEq1nsQPNPldjLjFMY8/g6psUIyqvX9qG1vPhtJn3wFzpJF2x97+3MAwZ
WhVV+c41eOzkVvzoa5/5xQmmvbmbqYXy49GC2GHVpWSpet5IztnIJvaJMBS3h4o6lW7aWiUHruE/
5v89Yhnnei3RsjCVltf1erZj/+s3U/928BZyN8bRBJ8gU9F8oZIEbdl4kG3WzzE6Yh6U80pJR8D7
WS7+GbWDyC/f4Jf0HnOmpoitGeR/DXzTIZq6u91BwPJ/MntFtisE+HrplsloyG1Z3bVUwJYqfxpp
QWyXFaJKOD7L6ZC2+pbU/97zDGrrf+zsfsY/CS7pUltOubjHFVY+UFVYPfnwkRSqP2TfKQ97VrIX
s7lYM5nUvn7Rl6RXDgOd5Gn8d+85ure2WZ2Gkz48lhHJGSekmdrztDyS4ISQ9IiClVug2DDhBSgH
pw3KTOkagdS81jkB7JjXHRBMNCh9U/qJnQH8rySIJaSuM6CkP5h994X7EXcaJ7qY1uUBZd2GKu39
o0qJz9sbuQSLBMe4zHxQmt2umTKjVC8yTrE6qqX7sqqIxdNTNgxdJOAq3SpD/z8RaAdjHrfYVZ+X
nsTVfXi5Pc3iBr64ug+IIh6sNt+1mcPenZHyBKPf4Wg7yA5n8A2+lxSNnObVA+axjDz2sZdC3odr
k7LW0ixs2Ecmu4byQYP7zqBFSTV3hTCLawmW7gkxVpu9QPRUAWMdjfD4JK60UnzJQjqfcRJLedaH
TBU+WcXwgs3+aCNowkO63hKyFuVVgCcIQaELnG4EmnYvu60mCfPMCVIrCPHkEHh925dBFScLejJk
p48NXy6oVcW++ysXGwMiS0jQVFFQGO++hYYIT3I3c4muPBIuy7p70gRAdL8FJZru01ZVIJxrgucg
e6Lelq+YGD5ZYN93LyBWgibgcJ7sJHWR30idbfRqftNyt4zjKE0RLH7QNULV+NYlWD6y3XqaAzcx
Uz8JV04LUbcl8ZWKt9bTvGXYDGbJt3i2J2Dc5Z9ZmvF72e1fXQg5G3bTsUTGO1pGqByMLH0fRKmD
JIhvBr8Tb2qOEOxIDVUH405gb7WKLB6n4uLgbsxFWKIZcAx4VBiVVo6oOUAwum/sun2Hy/qqVmBY
OL3cov7zQlpOOyUCGNY4WAcQxaHvNSMTUNxSvKcVfiRce8rqUn1Nnv2apb2hSW/0bhI0FCeWwJpm
TmRSY57ceXdGCwQgRp6tRvr5oPnuPztZpEGxgp6/3/A10C2aJDPHh68ioTAvzYIGK5Et6tyl8Rz8
kZcAidyQxX7myyJQuSS6s5uycgDotKLDZqSmHXuccPpzqiwxWb4aKhb2SeSk9AI/alfF5maKfqzw
q4SkCBhzXEXlmV2+Yd2pVntwX2iag5eoc6IAEyi4c6nD2X9s9DAG+JdvfY/Pk9UEU2Ti2+OrTjLv
ZRITdf9+4xmJOhQszi/gz02zUBLPW18LDQWQsNRiHHQkvae9rTPZMhwDByQeuIyf8swIr3/kBgRq
91ksrGEMUpNLOUD/lGq0/CYNaeLcuyTroPMYN+NmuHHSVdEDtxAfFjk80ew/gMphbFiZqvEY42fH
0XujzsjWH0KErWeriqhMUF+vcsbxIvi542TRxCC1AorQNLa1QJPSa+vZyOXragVxxKomZidxxqc4
unCpxwUnVR9cflQHFUO8dsUwDyAKEtHyES7rHRfg2Rt8HrcL2qFbRjiYPmz51PcLpUzJQxJZ952p
bvoucX++PenVCyFqYgzRx36S6qqiMEGDDLdD42CVBKleEDsE3iPeEcCcSE4knRQkuZKAPpHrqzWW
mRGOH/tWNdbAivPfi94RPWlhWfOCpHAJzqoPtyCzgtuxGuKsI5nAtlrBdCXMOSR73AKHvCMpHgH8
OezpZABPP3p+6XXZQ2MOJ8xW/YFYN2YFVreNqnj9lodcxX29NbcFjVsUWf8bkREjiF+cqLZh0yCe
Sz5VQJh0Fbxi+4iBG+aLk5n4z21IAPGYZo77fuJ6AiSjkOUBBKxI0HOxSxLKfQMrjOz+/t5RwMPg
12sk2hbX2n4zBEShfqdyiPW9R7WCRkdMSXkODilhz7JxN5VnEz40tM/VjRZkE95sZcgAWnaC+sQK
EtETdEdvXTknok8QtGvzXo2bLxbUC4UauIbr3nO3OU2Vc7Py2wmojg2UaYcXvgJ2nsaGfTiDkEge
n3Y+7FoYopx/DhoaeaE+hh5IV0AaerHg30TQZlE950QorTu5fQCWbJj+p94bO+4pXBaPXg6J+MH/
Bvqalpao/3QUKQxkpPhgNl7qFWvCaYOYfp+vCctFx8J9+2krm4nF/j4K3VTjw3mJc60JGLQ9jvIT
IGGH98oMjCMXSk9/wTUX1WgeCYkluNLiRXC2w9udJJpLYkJl7OEPKantqHACTJkt6vhMhKaf6Tis
6w/Q7A493YDY8FpNsCfqsAl/e/U0PSN4jC57fc5WvcND8IWpmDAry+iRdu4mwG/7hCLGDAyCq7R6
6ntapQXCz2PpzYNkeNs6IexbHB8KExDRrmzyvZNUXYQyYUid3j/1nTp3OX9Pxnw+r5E8o3ol7FYh
sgUUWey7EE5k+UtgLUQhmwDwZn9joZ4lAQ/WtDOg2f1Rv6xT2e3H5wGqCeOjfhhL3q7uCYSYtpRA
YcpzEOPSGHzC4igPaCfMmDfziItN9Ny8TNsOXFlABsYyKKL6zI9sDbTh4RIXPzWEwR7cfa9SDY73
YEzUHJ+bKjxjgu9XidcUKsdojpZxFR56KHdvREiNn/Jpq0k2Yv6WTLCtZuCsXqXXIT4sgqda0Wa7
8kwaQCbWeUVTpm6kaT0bCYoOipjAmrpJOxRPLLCasvJHMQH+HF+p4V+bU3PMEnRvJElsd/cz47CH
GI09EyDU5V8kAFUCFOo2gLb/ltyxvQg7pvI8XqStuJJYYQmBHFldR1sCzcickpsHHYFkII6jpWRp
eyUBRPEKxsHdQ/pSdSmNu/5IUBOjhd66Qf+VCoG0IaK/gZ36qpSKeCvh1EQgmWkTpgI6PsJvEhjJ
SlkRMCeQoGwHdt1dR3ICl675Evuhc9MIpbYfS6UEsB5tH78Nhf7SekLnvj+wJilIYszOUExjtIbW
R+v9MqsF+God2XPR6KMuQedWeBavphmAECmSCZ0g5Pg9IyTluJ3vBOMnOYHjEnRYuFTmmTNohqqV
O/w8tIJEYFRxYvOzN1dAdLasJPwKfW0G+FiOHKaq9TSvJz0swhSJ6efC1jm+QWavcPOYgfBXJUzr
XoTuYZtT+lSxr9DEIu3Av41wEcW72GRls2ANWfr3XuhL23o3E0A2y2f9oy3m4+UAH/Fx8f3nfO4x
ggBsGn7Fi3Sv+gDBi/WU0z5b2+ORHeD1V1frS5I32N6wsvpJ6BSYuU1PooWglNtFXZs83p7OlR4G
vjEcS1tZZT+jOH2zFtk1rlTWlGvRRA2XdlZeQcVINL9S0tZzIMW4eV8aOOsowCWc5gCVUCe2Ryt9
cyX8EvwrxHZCxOLllFzPmMbV3c8q/iHpQA6qASNoZoYU6v4+r91gFBgu01P3UxULE9YI6ZmMNPsm
6uIP3aPtiL27m7K9lOCHfpTc3ikXaRGLPaCoiSH37jtW2S+UrS6ul8rY4wAJEag1HzcHGMcHrh+x
RbNGzFkW1csPmgcc7CULUyDlyBQkSc93Epmk6BtNWr0kQ50yoFU9cFh12hX9Ct2alkD6AeutTl1Q
rG9bZC94oA0SaHj5LxHE4bXFwl1Lochl9cKjld/bLKlwqDG3umjs0mQAFZD5hnL0/cS0h1rYFJK+
02geQ7Afvre0cuSQu36v4dGTd4LP5pH4vR2ZrCAdvDglNAJ0nlDgzUkyyb/GtQUZsAbFqtzDDb0D
xK8lS5LxPMusXwOtetBp27vl/WOpYp8yKugyWMQ59+bxuEHe0vrCJPqGsQ/OzRkSDOpOHI2PcWVK
LtsHDVTlT8PhdDtnZclRqCg2g920Nm4xg2BXYVMc8kkQKt6VO78sdZylFj4/5XWZhJSWd6rwmsAF
0IuqU3uOXO1PT1wtZpB40/FAizXamrrUgN9jtuB8PX7fFLFVM7KqxltEW2B6cVr7pyWgM1JSAZoB
H9zpc20zLcFMgj/SsEozsjUGyAFpFVkUbQcQMvK+LigKobR93pwMZrpUz2f22kyP+gFm/LM+78Ig
SXSgHmzFpvdiFeHfXSwsJ2zmpZEoDUCSUH3e1Macio/nwxwDhqv48ahAZlXvCyKArc2nEOSr7g57
YqNv+XqFnR+pJ4Y1rDz11C5WKmsgUAnwFD71/3coSP4+3Dv6SXOfVVv39Ngihf+NJtFOFJMbYADv
UCDJXA9txR69V0V/l6c0dvC2BXE5iKfYz91jVsU5JEtPYRWHdjqpnlS+GGEfZ4CckhrV7Fnprbx7
yL1RRCO3Gf5wGMPj2TV+alDbsNzgE/JoAQpeUZfF9miTZ8V5Hut9iaI/UYl7jKhsSrWkxLHcb+o7
hnPuivCQtCsOiNFF+wlPdzQRA9ZzBnd8hKnBQ92IRPxYor9qEjJmndgTAcbvOBrxy19rOlTXyvMn
7Y2JFhgnwcqE7SkpHz/iHufpAIaofgjQFoGkF1HqNPHNgJF3cysRGO7AoRQ7rOVayVudlIKspkvU
gb1Ru6BlZK/u4HdwdGY/GvV/wSfMDD9SmL9+dCMyXEjK5ZgtgrADtTYYlU+yx+Ef5LcXwM+T5RRs
7txl4Ia/GHYas+3rzWzmqzJ4134ibKhC/ZMntgtpjqJuY2xPFKWHY1Fk+81X5bx+SN67Tn1U5j7g
zqPhE+8cdtSpwqk/9G/xV6v0nkfWdwdsTmqUkJuZYmC6n+KmOLPC5T+iKt+9jG+LcAF3CmGUwddV
upTTJ1Ske3df3jHOcQ2wsyNAUMcAAA+gAZ49aRCH97qHmpmpLo7Z+QTf4LKL4hPlREPur7/qLdhW
QfrbLiMyeOHUwAH2UwxNWlACQ93zvtp9/AXSZy2XLEP+Q5FjIgconpxXo8ExTeSBD+B8UeFEHpOm
kjvkyjp9tuTHnJ6WUgElyDsH9HqHOrHOLvQw73HgoGLE75AXIlaWZYhpQPqETGnURzJIBVV7U7RB
+DwOxnDANT8TzqD9cdnTER9RJb438cc/PYf6MGqP4PLVVKwbKF9uedtPzDKwX8A0KVRiaS0FJwCo
kZGryUtxFuKewdQfNC2cDHCP4VX2Y2i83bpPOAet0YiL9QlH+2UTnuVLkFWDWJc7ZTLFVwboXGRU
8fMD1xaKVB83tXy+tS+/0J7AoHgjj2iu8RZCF3cX0iqBz2hbeAfF1AFUzwRyPqnUkFjLpjykkoKQ
xqmw+1+dY1rz8IWzHtzY1lvl4e+CWjy0wrwSCdDICCyt1dQZTG0gPYt1efnFQIuJ4xLg3lXIvALA
BZbcLVe3U9hhhDF6ox/Le+7G9YA6ZqRjiPYgLRfiioivVwK7/HY6+17QECbiw4jUQCPnhndUqnFg
d/v+3Vfva/T0eU43wU2fSEm4S30pC5qvPBsejHMSwsxu4/6DEhNHIdXQ3o3hFkumr+UuHTDVfjNR
1A98SUH5cWPXuHnVb1jfG+mPteuJX2M5Apm/3X6Z+XMuVxRzz/KlX9R5m/0osA+zc8ehG+i/TjO4
v3S/LCzwad59QWuILUJBRzAp1azlXqwZRo6Rr1LkXA32+qQzJd8ch3YrtTOLqwM7B48IDMigeKMz
IicU2iopJ8LkFmxiGtyQ1VKMdTTXIXFaO+dkW3eiexnWgigWXo2Wdvgy8eEsMduNwon9x5ma9PEE
LvZjPtTXhjIzSwbLcyyvFEWr5iAdN0ekZj00IiPwIZIxTTmwiq6v5j7B1ApPPjI2q5GYsa0IQ8MF
UOmLgdB7db8xS7ExY60vf9+5iWbulqLnwUw89kln2R3GVTkQaRv4/8Rd+cU1wH4jq8+eG4FBTQS+
ViQE7kgGdzpgcqhBxkMMxLBb9c9qrrSACNd451HVcSg7m6GhSlGo2FrBwjsaYgxELXFTmAgP5fox
dir+2I7+FQix8DvwiU/R8VOEFvjvXrm71JMXwiZuWkQRUDa2cFwWOAZfRip9Co2vvqjf+HwXI414
vFiSCB686eZbOnLiobheAX/ECU2YWsC59gjAJfzSnIzV+kh3/AntsbygkCbIAigRtqXZGXNMiIsI
xUzkC8GXMTXA0UkVEjZbqWHWEDwe7v3z/7AvnEeSfWmOjnzKm5vxBVhh4qjRmYrOR/68i+iB9lwk
u6lEkXbcNp6+bpgMGr+WKVDqq5cTSwNFXuOKZ0njaC+xWdAuHTATWqGkVzG1az2oIzr3D89cK3RZ
FuzEY8Shicix2mLyGYdoDdo1iEhg9kjc6zPaZa7eJpRdoXfDIJ6JZI1rjcCNamxz/17Oik5uPsDS
rTAno2BSY5+0YGGTsEaT5P6DL6bVWXJzmETf0gTbw9toVRlabL9aIG6sgBRjDVi7H29Hb1flnreS
i9L50iYDmT+4WJ8CK3ufBky6/5DLTGN3VnFbGIa5y23DaqFlwZuNjBJ927onXRH7TVN7Eyw4CP7y
v6KC2T5DPVzAMx1gTUS29GsN5axDytC13r4JYSIvnln2SGpGqjkj8/v/cX5ikw7TQ8ZeZoXK+uON
Y2BoyBejccyFjRVx3wDAg2OuCO11dX+YWbLfI45mcKrANS39kL9fyqt2kcgnO8rnArJK4H/tXTvU
bLAe/gFUsYR3zUrd/5LucbqesntO/GqO09UwjszHJvCAas9tetNBk0yKzARO4oQ+Nba3aO78+yjo
yZ9c9dP7l8bZgm920JjtwQ49PTawwojIoIaY52qCUZUAw8OhLhYqIMXm4CHtP6jg5XgnFqDgO5o0
C7wriXsXKziiCwRiQhOVNmPd3W0XBCcwnX1k01j/D7sVAZpMBYyITZcK74aSF/CPMIqCg0mcrpCz
asW7wynV8BqHhiqCLLhuD2X1DQrJxwDpqiHfmbukOFoyQPR57mw0yKewybrex4pgPLFqNXeK2qCy
zg6U6ueH6T2bD97qDJ9l8ZBL2KZNF28Fa+u7iz+9qYN/SyssGEz97NkH2Qc6nw3n6lFt23N+EJQB
bytFtY4Mp+ht+Gyo9Uv7WjKRl/KTYGEXjMFDFlIJED+pl2G53bAwqnh6gvBS+FZ50KxJXoAFckVh
G0GVt4iMtP8yiuS1LVFsZW/2lSHsN1TXPRju4kls8h3TS1uueO4s7DVax5tXVFlLkP/oL3TeHwq0
/L7oyrXvLWSPodwMS8Le9Lk0jzqAVM1NaDb7yXdpplryQOwDyH7R7VQf846PI419paREC2gZY+q8
BtJRpfWGWWYm01xgC/cvwFEmcPjC5FxAUuRZV2SKuCmQDwRK6T19n+4mWwtscKGlNPWwWDh1LKHk
fbLzNNlEqzZ5BiU6/coebu0h2XQrQAcG7uBe3+jMPepoM3oW978EXocFQnqtyhT5z0sQFhVpGJLK
2vZjlh3ub38kWcRdAKprPKlZn2tn/1DzUxk4UMX+M6hMgoEc+6pMzU+6FFo2CU3SGDAPOYWOmlA8
N3rhrBdkW1PlOU06Vbrqu0Xu1GpLcLQbAPj7Y/gYUeUZphE09Ovik3t3+B2+Nn8MmMbuWSngWqGG
TjDqNAfMBZ4lQAAm1adY472B6NRxAdqcrkaqRDNvYA6uvK1Mny2GkZo9V4PKWwaz0i2r+seY1ffC
6FipdGsZYAPQt2POXohJ/lxOrxPCNjISwov6+dH0vO31r0MBdbOB5BbKqmHy0YzXNcnmtN2DhsOO
DN46ZB1FGPw13q+6f6FNW/FtfGxyGkDu1VYZKw7ujYTQYzZJ6ACRIeQP1pU2hoqHjcgA+HCv2wE6
02sme3mnvSW0bnAZalkQ1H/ZBYLKcGwRxUGwDyyhBooZTs5AvTUKXgGZURJEY6DFG9/7u/SGpwLz
Cy7zXY6h7IqQ/55tQ95v+S5PEJX6+FlqMHM5zkaQD4mSLik7vMEHMcqSobPlMoJU7gubdHk7NklO
UHyuedwUNXaKNxjtYruBOf3FNw1tqo2ba8MQWr+KyKTvYrG5LP7dqlRW0drpcNQyV6E1xveYxGmQ
Ezgm2Z0BxiurTI1K471pm9nh8E0xabsCAMNkzpY9DWsFaw6VTX0BObCoqw3PzI+ysZK91cUywp+7
nO2QAIyFVjoGz70XEWWlvSqBVGLZd2+dfsV8RwZDXE9JiTBgzslf6oOWyblq3PCkpCcHZ1Wqt/zI
XGTspzAtBHeH5eIeSDswVMsxFkGhEIgErwLA6w4Ixp8HLmDNYlcCKgqgO0+r1/J4Dm9f4MAQo4x/
7lPoL3PJaavcNYydQWt7T4debqM6ZMGp5tVhUbBp8u3VFs93cpwI6c2wHtQAtlq/RrTx/HZaRHKx
XMdJ/McRroOKYp2vG2uyU/3CTinWq2P4hK4VBLRDZcCfnsnJFrOpRx+fV9SUrXmxrCIuvcyfmSfL
WE01MiFO9M0vknwYW2AVZdSWm4enZ0yJeg2tvbbdk6Q4Qb4SZn/SxO6jCyPvkTfz7KBdjj77sc3M
q0vRYJlr4z+zJQu2DLccYafUUNuwCWJMhDm9F9OLBwReRpM8XFlcNZhCSMcehLKPpjknD6y+fqJD
d9oKuLCwayGXcJq+GxlpKygNVCeSItbXRMAGw2JWexkjLa7lwkBgtbq6V4dCYAYKv1IfAzFzPRvD
SXWd8yAcuNJxXf8gv+iVzNvSebXDTYHR8DOa7RNytNQqUbmveBQJheSNPjG5Pa1L3ycrZuX+bPtf
YBoNOySFZACGCxdKQ2MrKcYqFhH9XohXV/c4bSqHG+dHpOB/6vN35ZIndjPOdv/LoyAehLcbT0rJ
5ZesJrwZhdm7Fs87DgOgV6OQAGb8EghId3Xk+Mq+NwmqeDvOJYcLavj/Os8eruhPMLHNePpPF4xH
Ps4q+yNFhVVxRa+oHEJC81YS1+Uyom/2HwHebmb5n4VN0sZp/4Lid5/7cnYtkmhYUcRPzFnxgi3Y
Sc9q1Uq8vwCnbSqRikKDGJlUzLrtbZAskZjOCh2sYlrSQEGDYhJIcjHgndyGfotiTtTfe0o7tsVU
YL/3BM9fMY5KgDQVFwgTSKU63zsFDDzItvtWwk5pH4rnQk2KZFHt/Ny6JjlN7ByvK3Y0GFi2R3is
B8eWR522aB0Nfn1WHMcaxud8fwPPYGUgH9vaEwMwsFeOduOkiOgZ5f1YwuatfzPIQyKCIzvroDeK
4ptmTg1APC9WT/LvGYeB0NW/scn3AITQwFGptc09lrYOEKq0TxsCl71Bdk7XM+ciBHJR9w+pHLfy
esqUmvGTaH2/Jx6tqJpmXsJCNrIhaA1VqurdGBKhAPzwQo0xSMNn9jI18sTxxopEEfjmWRTlBJmf
YM1pGc08+JuNCZixL0Ll+S6PqMr9M/UBQ9mL1GBrrZIUw+c0k061Wew/BqPnqlBq7sRJXC3QBy7p
5/bupExQpghjJyuRypJ1JnT7L3QX99X3GYHDpm6PF27JFHnh8aY+Y92IzNE05nTqyjrb9FJdH5WB
3N34e4TXxZ3KSat3abWSu0woRw30NUyVLGw/yza4L3x3ANroL9e8VlhE2DkOA0KKD721oqvUsSEp
dTvi+pP3QPFuypnjGDosLbWjKNiy05wkP4mmd3vTQTQO/7SZYd+/X94liqSx13RV83UNJF+3BSr9
7KiKevM40lrotpI2ALhIAJTdhfMEB4P512vvXINZnBdlJqjDUnISkloRL6BglAgvA73GfsWy4Yvs
p7x9Sx8gImSKvVhtyVmwM9cGZyjZmmE/KIMyLMKE9VqnrkySsD8kFUwjqtegQip56mGU+eZoSFx3
1EfKx78rPz6WLLSzbCF5CmlfYcP+ektEBFqb4bD2ADPzIl4Cd3nJH9f+OfFVridEnwEACWUpchlw
KSFk4xbqNeu58Is3GVxNTtcIRDZxaIbuwUVPNZOHikF+S1ZLuNMKRQ3TcoAgyGxFJIl40SfMhzV7
swWKTrcN0vJwomm4An8f9/n6e2ZZJEnUjvrOgcu0ALvhjaP6JiXn1Ze27fmEvaKBnzWCNFumOs//
GHLsq5i0JToOGDIevRJzhSukdHd2n7O76rm2HLc0itPIWh5ZHl8LYFjgoqSsQCUbK8yMnmNkW6r2
xaIqu8dssL6TH9TmouGiv1UVhtgiE7+fXCkc/+hivWkv6IxNKKjtZ3iIJL5c2gDXvbbx2xCwDi32
3c3CT8nTJkiMWNWjabgS3RYaacD62tbptMWGmvinrwGevCEaj9/vyeCBK3cBWGhWGQgVQgZ30C69
tvbfhA9iEHoXoP82CGJS32cImjOE6/ucl2zthLVI23/PZz9O0Hrq27ZC0gVjN952XWYrbDQADQdO
Dre//7ByHbPxqexgcM46YiMfdvZ//QkAoY3BgYz6hwgCYAEQF+p/Up9Bw/if1KxAEll44DGBfwxg
BoABbNtWwFmhqV7TkNhOey73tAAAAHIQAOQ+hZi2sXWDfMTqarHyS3Gv7Z+NsakRPKXut1erFdf2
OHCgDwvXwAA8IAB80Pm39j+kDy8TwABKWqR2OiOGxAJw0IDuEDFEFOnWfLVHscLFs20FpAIgBsW0
0E0bDjkiigWgghAkcIDrwVuXkAByEO8+bd8EZfj+9DTtB95lcQLoPoL7bpyf+Vn4oru/nN/3+6u9
98Lft/+6v96Pv/OeF6/17r9pg68QQgCZJlAl/Xca1mgmUf68AHl8nk++86Z9G5hefqaTgc35PSXG
GaJDaeP07ePaq3tZHvBOcAHAIRqP33/b+AE7bJHaQDIbI4gU9x/oIvW1UM001EFspeMOP+ms4Yeh
r0XUiQpwKGKhJurEMbYx1bWT4f+Hoe21CDT7ZD/cNB0HTgfhnxD4gPyzQdPtuoBZNL7tmLbLatvT
7aD/t+c/72YLvzru2bb/30CZhcIK2JoEEAJpp9sW1p3/a2QtizBW313bPXP5zQNBx3qJbehl45ZY
AA+asHwbHH/zPkQi9lyGrniz468A/MmyAazivNbn4t93k8O//IeB7DoUFkLs8NEiQgRXXjGAAAAd
mUhGrdkdrR43dh1+nl1mlf4+9ociLABL2pzWcBOIHgaPId0CPPC2UvGHH/QcJz+fAMckZ04g0Npl
5OtB2wqQANA0//t/iH9r+0/v//z+3+8PtPtfa+0G2+heh7ZyAOQ7aHINsDbOQ8g23kOYuOs9C23M
eY+QbaG26cFs9dh+dtr85Mwv9raAADQAfa6j9zgf3+L8n8n5Pwfn9XvxxuzgIRqP/3/79AEra5Ja
JCAXDZAY5ej/CEKDtDXGV7CXi7GuieRqY0jNDUpic0BGtHPfc/vvUPCMJsLgBfdtjWiD3bkG28gz
FmD7k+bfNfSgD+7Zh5Dk0voGY61L6DyEMxAHIOQ2iDr1pAooAcdBNAg9oh9NxzxUE5CcwUJzOZxh
uO/+9EFg8FmuHYd/35+gvzff9+AecPL5Xl+8++9CoAvu3/UMx8hDkIAAAAAHD79fv0JVB9Sv1jGf
uREG7IDD4TbFkp3/TlLKFCiqrHguWs0uCYp7rcXdWwt+ZG3DP4snAoLY4rTIQC4QFYgYAf6FmwGN
X0BgMj15G1hqFm5ZtcIqEw7oFs6Bp+gafoOg+lB78H3R937SaTmazWaQaDQfbdt2zkHIdsDkPIA2
3bPdsxcg902MHXvCcIjwvIMwehgG2ByHMGYcnF23MPIOOmn8BMAMZYoP0eI359z9XAAA/93F1B3J
rrKfP3YeLWS/dJcX5jnnpT+o5/pu++nHR3X8TggO1O3OW6Qz7T/AIRqUxa3LQZDZZEAbI4QIIgEI
QEB0tIFZBRoPb6D6kEnYInXb9HWoicXKEDYUnjW4+FueWE2IALHBjAzFw36joGn2zpw//gP7f7z+
wf/3/7/rtW17UD6X/DbdtzAAAHXyQEEkA8LyDbcxBtu28hzEAcg912z3UkBAUWAkCAHHQUUDwn9i
/sAA70ADbMwhyDbQ5DyANtDkIByHkG2Zj2zMOYP83/X3XMHu2BF9D9A922z3f/HbAzByHkG27bmD
bQ5ByDkAch5AHIf+nIAD+0/vAAnQoCwqKQChANDElkclncIBcQIEIGAf9VIxTAHwBhHKHOu1FNNm
I/7e/rIXXw8L1/QNP0DTvuD7v3f/b7h9sFs21oOn20GnaCGgAGxfCgAeEtIHhLTRRIP8MxbYAZjD
kO2ZhzB/05BmDMHunHWZhrQu2+gZhf3f2gAD+4/u/t/tP7v7wFxE4CEalP2tyWJxWRx2ORANSCQD
/AQBjIeVD/LSjAWepvOxPJo82D493Ybl3CaBLmPAShmGgihp9t6Dp+gn939n9394/v/u/uP7f7ds
DkOYds5BmPMIf3/2f3P7//0AA9B9223ru2/+9t6BbEExwATnr85nPdvZnZnCjnn6XqqefW9b2h64
HmA/v/v/tP7QNt5DmDkGYQDkGY+Q7btmxwAA2MAbF2J16iQB17Y9oAC0AbE6+HCA68HhPCAD2fxD
8t9mPiHxH+z+WvZfEh8QAHnPh4eXg8fHxHhJ9vL0eX8fB6aEEEb5VfCgtgcgf483iVAQCsQAgBOy
i3uOwgdyCQA/yEDewvh/LrFAA9G/w/YiI1K92zB6F7sG2htoBmHMNshp1schDkIbaGYgzBmAP8Nt
zHmDkIZi23/rmENt90zD6FmL/G/Y2/TxjJ6062tP0ANAANOAAtr87oHfugd+aB+f0/QT7X3AHm+8
A8of3g/u//uQ7Z6CGYg20AANtCtiGgG7kuS3aHL5e03bAofeTYsJN3P0befogdAAAKbQpUAOIRqP
d6t/8f8lcXDZpHY3CA1KAwGiytblLCAdfeShPODmJgWRorJ4GAQBGn6QRgRyOGo4PGlcHCAn8BIA
JrtlEo4VAeEzGGYuQ7btv/TMf7P7OggGxA6/NfC9eDkO2Bti7MN67a/sDkOYvQgAOvfm801mDQ+r
g5DyH/LmHAS8h2z0LMQZhzDWpcw/5/Qv82Bl/6e6f45hDkGYg23kG25jAf2J839K+b+lf2MAHzX9
jfNB/YnzfXrTB18AAPC+F691/YnhOvdeokFEA2J4Tr+x9igAB18ADrwAHXg46DwgeE2MAAHmAAAk
BY8PDzeB5jzA8AAADweawsWGRHAO4gKgyOwgNwgNSAIRAaDJkru9LX19SWFvSCMUxICNj0UDhAbF
4UHCt6/7sHZfvwDkOYADYoafp/Xg2NsXYof76doIZj23kGYv0La6R0DbAzAHIQ0ANBDT9OeZy6O6
tazF67187v0/f38XxD/Y/LQB7MAH0wPkMx5j23bNszHtoAAcg+2fcAAgAAcefL4cOYcfnyWB9AAl
5vBPl7zwePl5WAiAcCEalRXBxWJw2WSgMyAIREdfgsQAh07Rft1twEP3X/MQCKVRkyH5f2tvfkJM
sP/L6HyDrnT7SB4XMPoeYw90/xANjeE2J4XrwZjzCAbaAcg5BmANs/tf2H97/8NszD7oAByHMf+H
oOYNtP7v7QA5DmHMPIOQ7ZtnIfdeQ+hbYAZizByDkIbYAbYGY1rDdD3zcyeYdXNeEav1R3RxedUI
5r/kienO/u4+mP7v9N/d/kHyH0wfI/3b6f5H+7/TfTf///y7/Z9n/ln5afEh7N+Xvyw+I+Ifl/xA
B8QH5eAVjeR/j7r8j3O8gI1ToARFwAn2Na3JZgOZAEImwf6NLByPKtTPPRoAy6pttQBc90Ah08NO
DMe2ByHkHIds2wADbMw7YHoeYOQZh5CHIQ5DtgZiDbNtPMPL5B5X3p5vKAABtobYH/QPQsw/9Nt/
68gzB1xp9thp2gBpwAmwmQRnNAHxFfeRxv7FsLw99c/91z1Ien3L1QQAAggHXtigGx9j9f8L4Tr1
ctIq3sO93HrH5Pd//13AO7/g74GMAHAhGpUdwcdhktlkIEMYEE/yELABEZxv24gsn/rlUELg9nAx
d4IwAWhAJIRaCPddtopHhOQ7bmHMP+P/Xbds20Nt2zMPIdsDMO2ByENsDbQD0PkH9j+w/uf/7+/+
x/Z/YchzBmPMQZiAB/Y/pX075H+6/TfIHyH0wH93D+7n075H5DkO2gG2htuY/+mYMx8g5DwjNt2z
kHun+Tbf+vu+Ysxqcl5I4d7rzPr/Zjq6p9gvS5HJobJTPWuSNoWCq1e2AhueZF1ZCoFAKVxzVrXA
MXzVxOLc2WB3W+b+lPmwAOBYGdGtXdHrO8o7PLHNZQMYgI/0AaFhQFpWvvgBnREi0wUSDhAAAbGz
FyDbeQH074kP7oD+6/InxHxHsvif897N/svyz2Xs/iQD6QfNP/7/8//39oA+6+4+5/GHrfxfw+v6
3tPW9p64fwPa9b+AY2/4z6n+h+j/NjJ5+p/UsHNUQshptq2KgF1z/3DQQ0ANY2F6NN9X1R1+KT1R
0Eh21vgKS79+4ZbxxwWL5S3RujLfFWcObH/mPW89xip5/2Nt7Gtx3NmwY4gI//x/IPy4GrMrwCEa
lQWpxWVxWFy2VwgQRgQP3QTQABeGfeA53TKhPi9d7Ae8OImB+jY4PqNt23/toAW14Xr/3PtH9ozB
mPbAANs23MABtmYttDbMw7btgP/0f3AByH3bbNtzAAP7X9of2f3/2f/v9r//P7AB/+f3f3/2n9uY
wANt5CHuvuu2f5sxcN8q39mjlXZnY1lakc3dnEN5+Hq/FP2HmOeOdX/374NqXW3SIUQC0AdeooBN
AKIB14NibGDwnXgnkA/n/m+pX+e+EAAYwMYD73yn3gAM25osG3NFckp9ROgK1uawyQA2MDiMCD9Z
BYA2VqvqAmdKgKKm+j4p2LBcc4bsWCwWaBB4LBdB0/QAti2bbAP/cPu/d/9A+0AH/7tnIfQ8wbbt
oB33f9733eererPVHfj5vvvVO/d53wsqahZVhcgDqrMHIekekNlU3Rt7rTiy7Iwcw5j4veIRPWSL
3yx9zhN83PIWpP59kTgb/AgUulhr9qwpUcAhGpTtrd1kcQEUQCEICH+gAAAEp8fFiOulaBJMhvGe
aCEhBHISCEgFpQLSgWmC0EWkDr3CA8JsXr1og/w2wOQA//w/s/t/sf2n/////2/3P7X9j+4/v/uf
3n9j+//9/uf/oH9h/b/f/YAf/5/a/tf3v/7+wP/3/9//h/bsXr4eF6914NjbF8KAde2P4TY2xev9
eDwnXwDY3HAbE8L4Twtoo46C0QBxwFFg44CigZizDmD0P/Dbcw8g2zMQZh2zkJ/+/2v7f73/6P73
9x/d/ef2gANGghbIP4eXmPDyACc0AaO5rC5LDJwQYwID8EWACh9dBjNyxRzZYxgIIP0af3mdP/Uf
af2P7P/1/+/3j+1tu2h/1H9h/e/vD+4H9geF4QHhPC9ffN/SfN/Nj5v6T5t/YX0o+kP7F9P9N9P8
g+Q+mf3YH0of2EH0p819J9J81/Y/mh9IAJRih3v/W7oDud4cIRqU3bQDcHCA3EAVCBAD/SAAAW/A
EP/edk/V2xhMMVubtvOxUPmFG5izDaQKJRtnugZg2zkO2B7vmDMQf9Q2zMPIfd/Qvd+QbbmHkHIQ
5AAbZtu2chDkG2ByHbPQQzCHIdtDkAbYHIdt5CGYeQZgzByCgi7byDbdt5DyDkO2Zj5DmHkHoQAG
27ZtgbYG2ZizCAch2zMHIcw5gDMO2ch5BtuYv+n/XMO2BmH/rmPvzru29Btrv+oUkRC67tnvz/e2
O/eQUGX0Ogi7b/09CzFyEOQZi/67Zsfr/XtjB4TYwbG69sYNjBaQAf//9n9oAFOnp53R4HNXHQdB
0fpOg6QdIA8gEzbnJZXFQZCB1EAXCAhEB/gAAch9eboDHqB3zNDGR1tO8A91902KAde2PwoOQchz
FtnhNjAAde2J4XMG2Btn/4P7f/z/9H9j/+P7P7WYA5AGY9s2zMWY9tANs5CHIcw5i5DmPMXIeQbY
ATQILOJpOZx4XzeR5Q8zz+fzeUHnv4r7w56+nr/w9+u4vVe99V9W+vd+AC7XoocnJycObiDlznT4
fPzunp6fD5+dallwAcAhGpTd+cICcoEAP9AWAQBfTigndNmi/XadVnXJlHdHMBxyLSJd/hmH0MkU
v522NO07v/TtPtgNB07T9s2zkAeFtAAdf2Lx0AbE6+HhdidfAOvbH44DrwdfDr+xQDkPu4Bp9tW2
FtaAGghbIaBoH/cOurb/367/3tjTsx7ZyHMOYdtANs5BtgZg2zbds5ByHbQzGAbZmL0DbNt23kHI
fQeQZi2zbMx8gANt/w23/r/kD/HbeQ8h/6+hbb6FmAPQfQbb66/30DT9B0ALYC2LZDQba0AADT9A
0+2AANA07Trafb+39t9r7oABQAs38rlhtb2zZvbRtbt4ABTp5weFzc3Pz9DwXQ5ufoJq1SKySZx2
GQgZygQH+gABgacdalBmNGi22Rl4oBRQNi0QCiAUSDwnXw8LaYPpD6X2YC2NB0/T7bti2ve9lh7z
TtAtsAH5f8R7P2XxHsvZPy/2Z7M9X737m73vPV/rgH37zebzed5Xnec8x5fOeYefztO0ELY0G2tO
C2ba07Qfm/pB9IAAUBbby3L37923kN4eGObnHO5zmPBEjw+c4Rz+EeD4XQ6ebp5nApwhGpR10o9i
cIDMgDEQAFgoNbOMdOnkO/qiSSixeueOPs+XUSSSREoovz/CC6667/27+DkG2bFIgBp+n6AFs2wG
n6DbYaAAaDp+g21bWg20GggABoGghp2n6dpwBNQguGziaTQJqE/dX11fxRRX19PTt9PRRXV/vU9d
znP7XyW0cltHJbTtO0z8UV3ORX89f393FfXV3P30/FFfzs7dRTl9fxX91fxRWwGnW3p1t2xp4BbQ
WzoE9aJCep6v9+xk8Bf56C/+2Hret7frAE9QnQ0qGp0mR3e8Hf/lv5H/G917kesrIHIBM06TUNw0
JwgYygIRFn3ABQEPJ1X1gPGgYRoI8A4TDfqOqbB/bP65P+vxf96736KK7nop27nbu+n7+dnu/O+f
Nd4d47wd4d+eqd/6sPVe/TkXr5+/iu7qKfnruKKcnIrqd3m+u/N5R5/KLu+u52ciinZ66uruK+nL
qcnbu7u5/7w8p5fP5XlAMscGnXaniQWAd93/W9fvDvgF9FUILhwhGpR9vk1jcVjAgpALLAAZF9Lo
+gZFIARacCiJBB9QlJfmInKZgLCNgpOK+ZxcKAPd+Q+6chDMW27Z7pyEOvh4XY2xOvbFDwgbF2Ps
frwfNv7CPpAH0g/sD5s/sL6Q+RP7rtgZi2zMAbZtnhQ8KGxOv+E8LbdsBp2gacGgaBoP2/uPtf+p
937r+B63tva9b1/bAB4ScTQAnE1gs0CaQeCzicBNYNjsJoHhOvTzPHEfqfEJ5Ceb+H82ND9EBlsv
lh6s267wCCtqYEVQTACNpJJznGJZFB4AmwJaXFZHDY3IBjS/0AAAHtwHAFUSiAbHD0LMOYcZfrY/
2zFtvIf+unafoFtBp+ggB/YDMXIOQBtm2ch2zMG2BtvINs5DmPMAAP7n9+gh/vp9t6foNthoGnBo
IWzbNsafoOn2zoP2/t/+4A+7937b7h937f2z/0+19v/2+0+79sfdP/d9p9oESXf7v/+//1vd9Z3e
53AHf/9/unugeu7oBOhVKXHADKjgDgAAEYkBnj9uRn/sG6quyD53klrl1kVawrd1QqeWqzaV9Frq
WAqjULC67slFyp6HRnE1PtkjvCN/i0beQNEM5rPIxZ1z5qikIj9WqM8dZAcJoa+opOP8ZZxrE0L7
NSKfulfOhwekOxwYvlaDH1y1gk/cuKSIDhXACvkCh5doaANxz+9mqrBO1wVCEpekjMcPo4yuuUrl
8HhohCMenYLW7fmZqRCdJp74UaojLXoIVEgtg695KUu62jttzNqEJCNf0u5XZXo5Ymup7StU73KV
EX7RuPY6mmvaHs66AwPSWw1F/eMy93gWg1lWh18qjzij8Yz7IhRKQqy8TmNunh2tj5LjeTsD1GWN
onGU4ddQuaUUWHGmwOQmWqzau3xxD4WgHED++OBW6ZkyNZASBTguW/bw5o1H8dJ0vm+XPm35uY4U
+CnYP0owDheSy7N2ceFsnSn2HcRUmE9O7sH78dPm12XfIT+MZp4bofshrjoR16UxByGtW6Br5mHU
YaigfyCJ+W4DwCoXibbwEewYhSpXnAINStdFsIP9a6vuFsl/tfA2u8pPeGVp+QMG1hOYywHdjgOg
sZM9+1QUtkliWXxfyFvvYYa9/OUz8SjeArRbck4dcDHknUm32hIoT2dAOOPGIfH2rP9gxs3C5TCP
JBUv383BDyA7WYC18Eo1mVnqFT7hjnnNL0FaBCNaQch2v2TrkxqJSHBDCOUmpGOR5ErAUVgZD1ge
Mn2tiurI2T429Q5UTW/1rSCVzGfPGCwoe4jkGM3+WkBkmnCd5dUxhm21nM27nYhTUXNpfDqODAvQ
bE5i+yje9Q1ArQVNG0bhctbXY2hUOq5+Yx1XuzD1k32wXkQlz1MBRKD+fvIlB1082QfF1zAx3exy
GFIpzROZL5iRelWHJxfHC1oGpAalsbtCgDrnlPCPa8cBYd0S7yYdy+rQaJMkJKGCsxiaEw6PBEY2
qNZW34nPFQKY6eIcKpHamBDqXCdiG3cMNAmryWBM8/q4By/Z/ti9sjeleHcshR3zzhzZeIuc1khh
f0X1D2J4X0VwjQauablx2lEkmrLd+rohKI8WHrOXbHibtv5+lxdaqdeYJnuSjozR7KemLUyTT2RU
Q0IcSRZYWcXvW8oVhV9Pox51zTRyAPW2sI1rPkFsy9i2kPIDqOt/ehRYKYKZLzuEUm+bDCzonEjA
SAJWadaUKn6nNoIozRm5WOHGLpMrlmOuGJZBRI+pOhLfAyo/pdvPccNkUe8xqoYqRFY07CfVlhCs
3sIZY+p7FYnaCmNLYUFXynIY6NX94iOM6HudS5ZiySnK2NjMhtJlQUnXaQyM1t4cpFUGhEfl9qgn
+fla09BBphnk0ueYXUi22v/kv9eIwkU9YV/d7w04SyiN7nPew/v8FuijgcoR5beoAJwKR7UNY4tv
3hlMP0jY0Bz0br1SfIQAnPk6pXQUMza8LxR6vKxpoiysl9w2IOAYFQPOjV6M9i0Ah+fbmIvuDkc/
u6rLUZLYdXxYFP2/8AdD1RAOP/F6MZaUKFxWs+b+vK6Bjb+BmxneYIRDPVgdU7Xq8cfYgxXv2ntI
zJUdD+lPtBrq6myclddAZaWm10DcUFSgd1SiLGIZec2rbSfApo80d3yQJWgrcyl6arx8IUWs9yBy
N37cO7CtzOAxXhmRgU4wAe6+e+Rfbq0PhUrguE5yROVm7jnTcGSpljlmiNu7YfQTPwTpLjQyKSpO
mT2C6h+h9Po2z8e/BYsOGVrGcv6Dj9g9yReLUQVUFcS60BmaKz9PKBvdWQaBkNCukn5hmeDAplhV
LNjskmggzSwsShFQ7GOlXnW9ToMtrR0NAVzKQt7xyKElSGhqXd03O4M9fr7jL/KNvHuXx2huj6/X
DlyUTBoOpSN7xUFqu+diXzof/kRKQ8mhrZ+0p9JObyIHIA+2wospxVDWEpn53vtm0Vl0sIKJSydv
LsrRPEyrAOdfE+8DQwEkK+g5s6L2mVxMccknS4ZpNXm6+rUT7clAz7Tkqlu5PQx3ary9KAlhTMgU
uTPpmerFtCeaXncMlcXIX5FIJWX+VTj0QT/DitEAmJ79Nu7ve0HL4WevvpquC2fFENp9yeXgDlYF
jjoAbS9Jy3xP8IgD5HGsLQd6/O1Y3ZF/Oz6O7BRkrIrLw0DnN7I6DUnyY9pkriK7GrZZ23GfqbBd
mcbq7YKwX42wR19NltZjJ+6iW98jfufCVnbEft6aXFrLvYWPETBj8MGL8Ka0aDXFUw1aQxHGwX+C
Eg/2Wl3l8WavYcQ/6jFcAsuTxwfX+lBYnzy/eEl8QvdtBXs6cUvnJWl3H/v9Y83fcwUUZpms4niD
uHCudiPm1p/VBJmntx9ghwW87XQJwXj/4CLCXD4xgADzloVT+fw94j4Bbu4EC4gznCrHlLjn88xk
2WXQntGrJ9g7LNevMsiKkNLWfuAMVxv+8JSj9MEL7JHYPYlLiXMpzUxgvYULDaJ2052o9QOq5gLp
GhywTDKO4jKB0U8E+5zaFpsGg15mrEz7djzTUbAzFvCs0wnQwMRj8UVYMjGGzSn/83pJPfrYKhEe
WWWYq5cMxpAoTkYFxO3YGMGpaiSb2qJogEOY9rLDli3QTE+hI3k6DzB0nb2gVyLVGjjpan4Kr3wB
uP+CQeC4Ep1sTUWxb1ZwUTZSv4OZ4py8vReDPSsItAgIShAeBXGho2IHXuJYuByz1GwUueZlmyyF
fNp/Mxki3DtcLpUrLSnnu99lPL+EMJ/Nr1hvSIhB+rxdZFvbWwDJon92r/96mAoQsFcrErjnhkm1
27zs7bu4TFeUDZx2IFlxFxoDRG5OAjpY9FVYo0OYudlmyxkn5YG9ai4P3L93Fdv9iLDHn4f23a0N
FaV21milU3QK2d+SY967OCBz3Zzo9TqRL0rrmNlVlNWL0mNbKO8cPG0bS9g5TVJ0k9YM7PrzJ4/q
+MtZhsiuNqjYp5ONzhv09jGGhnQJltohvOVEXS1HJ/GAZ9K9ON13Vc+S5C/hH9U1fUnsbjaPS/tQ
L1e7svs0f9VOrkLpPR6O/2nbVTy/b0D+59f3nRrBUsbK6nMdXRY+fkKYUxLMIxzEOU7LP01GYYxW
zuSPdv+7Ozj9g5i4wTK059zYMH9N+Mud72mm5SYsdytAGh2Dxe1fl9V3eRCeNlEKdwbl2fbrrlUk
XgmhWS9+ZsWkEwW8e883MdvAE5C13fndWB1g6MsdyU10A6AUQx42KOW0bbKt0shEyzaX5ouMoO//
fJGnvOTyfTSX1c/BSaVE2wOT88rJHoDx93jMe/VWjnEkfFZKx6EietUNxjxkPnUkh4lIyi8zRqlY
C36O1ahJJld1hSq/nchLcqzE3EHav7gVERR8Jol3Thtr79HUkgqd/OpUcfWskO9bRw49ZFAj41dV
+EK3dBJkgwg2HL5YpcTD36WM8IQO2AmgmsNFAVECNHHxTd9X6tv+q8zubkJoWi3KC5lz1CQacNiI
85ZZ8UWwBv3LlLE3OsjH3LmiXdJKxCQ1OrDfv+QEfEJHc35+LicqNSjR6UYWa9P7B9m3Q5FnuaQa
l9mTcKp4sO3TEvjYcHq+NDPCqLzp/OCtb8ULueW2JwCjVQLAqS6ueKkB6J1YGnUz7BmF7a1EGHRu
0ZnRcdZBfyJA3odQGK2cluYCFQ9dfzNMZhqkxFIURX98j/XD9b6IQjjoKSNCeCY8JibY+/RIO1C5
rar0s5/lVFLWlyDbrVc4YUa+2vKmwf5ZIokWVDOUadaLdXLYKCgR8ZdAm9IgHyHs0tvI36G7VxoF
VSz9tb9d1OiM0uBiSf8iFqXxlF7hjnvdeGCgLGYc6JWEaXKnWsOGZDaFVs9Y+GGQ0gOy+kMrsm0g
OQKabbjBzOaYf/bdjmKz4PuefbL6VF8LZYQtrtbPGuap5eerQaiFI4FNvLy85By/bioZ8LKKh8hB
YLQWtCwVWv73g5RSNIigUCJJo2rMGXTkKZtG1CjD5U+gM3eQ9XokHsIiFGoISyDQz+jF5wm4cZxG
vYbJFA0pGp948/FpNhMRzVya1jzrx/2eFpl4Lh/e2BYj9U/9vhD+RVoj5pRkvr44FkURXQ0J12X3
aJ1pAwWnME7DNEOYrB2XSO+Lhrw3CZwQOoByJ21Nz4kCvtG1RPob+6eKlWcyWLk37HOOMFNbh8+b
vo5GFCeStPcvar3OLcf9XJHVylT0RXpj2mOqbyIiT0TCu3T6YSbO+C8GthD66393N0Pd4eXLan27
9x+DvuuZ/M82kBExM0G9QjWD5I6rPPJcigsvDGihGRRom/YBW5PKh6P1MctvljsUI9oWQNlbpGzU
+RteJ45bvWoKF+jqGAcUorLYgWn50H4NxzW3ylDIzw+MRP0zR5VEhJKGdDh57sDrJ+mVvADpZ7tU
IUOqbb+w5FY/NeINeXadowxQJ86xODwD3AQVhOGbzl09g5RbQD80Nxn9+Vnv+XUurY0C4PYkYhVp
9ylps/ZLQ4wTOIjuwiFA6SqO2N8iFnGllxrKSrHbfTr7dn0qVI1lrGxZgAZX3KjvXs3eYt67bR5H
TUyp/6lvQXaDXeYHaLI00iWbVTt1pvJLP20Q9dwZQSUeVV6QRh7TF8UCQubif9FvOt1nL16thgwj
YMxCrna3ZrMVtVpSbtnJgvtSl3Zc10MmDkZ7V5ynIeUO2+eBVT+M1YS5S/j5oQ/vl8YTqAA5Aj/C
UOJ8tn8gQ4/U1CPb9WldPrqhF5WCW9kkvISBgowtdLVA9tx1wmDtA9IHniiz36btLWauUOpEhNc7
cDV/ZgBvhlQM5Po4W5kloJ+tyBCMj18XI5scF/ptWfzA+27eXQFx+/WLBQ7GsYYFCjGjUOMNjAjZ
4giFnBFeMNeBgn+GMISCBCmFomSGfB3Nj+rwKoOoOXnJlmOqeicccfSNKwJdWmP8PqwUj25EU9O7
AS6t79hijyczEg/YbpOt54m1vuC9Hdmkku4/fhhuAOHYFkZ0MJtlwG0Al/BHp+V4ULKriv8pzEAC
oj6+3PB4puquI0x7KYppaz7TwwtP8fswAhvZY2vEF/ha0PDGqGDrr0pSMNrk+mBvfckJTxW6zI+4
K4IbJ7gfnToGWsMfJKqYwM0+DUwoH0BrS6VLo7yDOji99AyqiXer+2SX+43PXFojs26TzglQB1I6
KC/JjVWe+/IFOopfY2kOzTXewD+w+R5sAKgDj1OGMr5YDG1qYSDW44MyOxDJUXn9wiWoH4/aTkRS
DiQxbwwMKdg5bU8QGLYriQZav9+OdsjcigHm19Nv7oHRZ2RlvTt0q6GuCatpqJuiXkdDpmIZu3AC
lAXVkdLy9EwYcWhGN8/T7gdcaH5cALH64nnIxsJsTRuN2wY91jJmYl09FsWi+MLDUulgxuNo5pwi
620+x5kxBnki4dgofxhfBlAhk6zE7IEjnBMfjsd8n92wzh5dz2+pPOZL6V7ZW4ewlN722YMO5G2/
uSNh7Qz9CyylhjQpGQSyr7kHc+AIgtZGfRKQ2vTnF73A0UP/ta6S7ZHRdyz777VjEbfkLDbA70rV
rOOC1Ysp3G2kr7RYIcHe+5kZpq1KJdZ8KLocZlubgX7uUA9Y9jLrfMMhImxny8QO18zXjb5oLe1u
5CBLuDlBjSz6kPn7gAmnuwCzxZ0C3rH3JQqDNSV1VX8wiQKkNl0zptNSDqjTXygoaSx8KOfnmGOU
ebGlAdGzGnnZ3viluZbRgLYbmeduBwuoxANsu0gEt4++2+aG37XLJH9nClFi16lZ7p3QdGmhByoK
bDfVNBmZQccKLDm7XJya2LsqDz45xXDyVC24TcW8YolpjmXN/k+jgije2EhylT4ougJUkuh4tN9J
7EZeRhMKB3UoFb8GPZtestc4+Fdet74pboX8idkv1ikhTwGnNzbl64HUftwxfLkdicTCrlYzi0FY
IlupwwD65aEWi9YrI5ijYBcoa3d+N/Usjx+sbcbvUtzZFRXI1QwImCdMlSxJooFWI9i90lunPRNp
m82IAy8O87CQzWIZAAAG1EGaITUILakymARXORzEqO0gBeNjuhnRH/rIVJHLhAIki0+PGMaIoBpO
o2tCJhd1LJgXmyNy1AK89k3FFpMNnyexsdNB1DjPkWx+nJL8FUWSHe+BzjoyQbt4tCTrQMr0f+xC
BnjsYuFNjnypFhjRomXWDqtuCxEpMloR1R31wJVLai1ka9TTCxL/x/hoeIekkZqNkW0gi51+lrZM
amaZ/3YxphoF816u4VNXcWi+4mKDnYYpW184ozd2y9o3a5Db/nuNEqaHJ3uYK/+BX0KX8lJ/2XyI
1tWRlaKUyZsJPkmHCxPqKZ9B/otByV7oIq81Yp1B18y4pAl69enYuak3kwleX7o5azYtWzhpYDcZ
Ol2RDcUSdwSoWVH9I865yZ2kjKBCpPsF/Qf3O+++dk9NBgJFgRjGZcG/WbLfvA9vuvNCL8IJj7MN
mIirYWvhyKDiKxRGYM1h4pUoU+KCttoPMwee9OApSZuBEJ3MLQoBKgG9kq2G37f4fbiWUBeVMgd9
Teeok+zvMQ6tnk4iCwtr32K/2+hbdZjf0cJjYiglP3WYHjGVz8WDk66tlsNCqap82CZxXMwhHwkY
De/yRGAXTasgK+G+1n3Y601GZ8Qw1dljtLi4cQvhzmdVKjuY7bZx63y2nZWOsXD9xBOxybRBzJJ1
59jljWGS/FUlN2y1XNaGSTUh/jkVa8/Veuwtfl34+vl/yzFbcFdXABzENVf+/W2lRo+YAcuJvmvS
ySYQO9j3xZgkazIHMd08F9SKERs/QyZ5zirn1Xd4VbDCuwsHuiBBPHesJNAsRmMu6fRPDqI+7+EL
4S880V5M8tIi8X2T7rmRyuh04u//SH96S9VLDapQ0/zeXsYJZmKTM5InTc8SQQq/TSho16Wek+0s
fVVGBzTNymkkome7ehA9gKkTZfyoEsBljmz5vv2oMgNcyJ/BRlD6w/h0n6/jXFIygy8u3wCC0RFF
odcsAW+FoXDcn/i0naGsKI4IgS5pRPVwQ8M7w/0lfpmDdAFASuWyjNEpvQIfwEhtwHDSfR0cpC6K
9DruqFZe0JSs0MX/wM08rMLmEOeaHLZniq8LVWPW+QjG5wdiMSL2jBiS69FNtGkZx8bgOeF/Ie7m
spdkaJMY+BaMOvkDcMxCFk3BdC90rXkaeLOKYST689cyEsOiUWq1ihPLx8YhOQ5Lutr8+mJGGQv4
UbY1qZ3pblp0VnDAtSh8yYpiilMXyFoiYfFzt3Nbta0s+P2kYGHLlLRgljcHrEfe+rnsE2S1UJn0
/48dAOyL/LVh1gxW7AkGxFMzps+8/TIvvdWFiHj2gOcKoSwr/yMGbCDae0U5HqRrOwFkCPelUoFK
QDDJoiF7Nu3wLdpJFokGyFrtOAA2AJAQ87rJgfouz1h4kFxoM0MEW8L1SCMdTnQnKNwJps9pL1sB
hIfGwrSBuQvhHDcF+GaKqRyrVWqMJ2tGwyRZpKxG7qxQr8xSSr3B0JX+DXE/gcX4yOD6JAdULE6Z
yfl2F+CpIxlLQoezYRiKLoTa0h5A/eoxifOh/NQG0rYLXfiLIV/I0RKhmFPYzkuIIGogBjG61QDa
CN4SWZwvCC5W2IyFJj9GGZEsQvh20jiyoXVF+iy8+3bIAs/YFh+fUmUIgiMBQRJYQ8JciIP/ecEc
G9dsvJgINzp40YYZEfMxs8sz91eWxXzM2DFTRFn9/baGteLHpTe7wCnlKcZnI64PJ+zTc/Q1eZzU
he+2sXK2ZRh6c+KrxY2fkQEW5r6GSXo8LPW4U8FJ8jFdKAwtMSPddMop6eqliUIzoSf/WyM4mKSc
jvgjoZrTnz2lPttFtZ8hM7qcg5Sqn5JK07MQJmpMqNUW88pZ/Dh1hoVTGb/NbDL/NMCITGYHrtn0
4kNT670LiyB07SLl7kg5ZeB3Y+DUQkYQtWpjpoRSPVEh1WH+hLAxtGZa33LgnwQqte/FGXzRDmK1
RAaePTw/pjunWPL3xSooBCe32ilzlqloSZbe47ythuQZo4MQCCdkmz9FqdzLzWz8Nyw63+FYB2z6
G4hR3lOYtYW3VXFBAtM8vC2IAOfRLJepr3NcsESozvUvuCeGMqEvs0dUtwd3/M7sKKkQEKesg2j+
yoyjJBMNEhnm6p+hXwkA2hbS2RL04/yDLoSfBxHpth2/TkuUyzTe2X6werHua2ldphQVHYBI0UIP
uVmVlSHh3UeCaXL3guXTuMYA45dKouNzcEzXBVLCuvwGMs5BnhnSiG4IRrL/vYzb0FO46OsZwSSn
UlRwekFVrxjQrLwGCfx4Ye+2OC7CFkAdhJ2ASmf+lQQJXsysUNQ9rv4xrDeu9hYWwIEpWzgzAAAs
h0GaQ03hCltSZTAFERd/2G6JRBnx3L02I+4oxhVVeBrQeECZFWjDZ9iIYlPk7Vc4b2BuBUbNptLg
W6iHoCP1aAQFyoa6ScyoYv+SR7LUEyivtir2lJ+w5liO7W5vRuuPAl7HvG0ySa8TT5wfXKKKKGqu
I+Wqtk0nj9hSSE1B08r3MbOYXo3+eWEYeJ+tIynw/CMu3F/zkg7WyglW1GbYT8GSQ2GiU3akdPaZ
otU0kJoDgbn9/I7clb7JX7NkhC8ieuu0riHPt/mC+FPFE4MZSWHPDKdAtOlixbQbDpmmuNbMbaWZ
LW6goLHG0LYHO87T2uBzOT/eet3UlF3I+PI2aA4wDmEs8cY5V7Mdye91QbsbjIg6hIFo9+B1ikxT
xcPq1npBoFHsXP7g0j5R//Lw3pvLf2ljNF/TsatOMf8HdKM/epW7FHulMG7gQLi8vcQPRcEUBZdg
56Do+37A/WcWOsNVIo22H10ytm2/q+A8h9MTNNJl0h3GkKe8/sqNV8W0P78XAyHxGzQ6J35JuPML
2UXpY9vtO4ESVeJs/ILVtelWvIPB1smcpU0cOnd7ZYjcj54fNrtL53AELMF+R6K+2Qf2/B/8d6jj
OHvU7qVeZ5yFltvjYG/AlCPMwCJbKan/hcxE3t5o5Tkmb8kGJif9ScxAidbTp1GYHDyyfODAQ2GM
/qA9/mTcEIq3QSe8jvBd3pKWGp59o8WzbF+8O5rUb+oP+buHzs3Qrw2NzbPYp0PVNc+i9f2rbn68
5BHrXOw9ABFIWko8aykm+M5iPi2rx/bZluL3Y0s5SOZ7fYw8mtrU2lLwY8JSZz7QRptLrwfBVKAc
l64d+ROG775Z7tTjT3NUydyUxshqPuvBh2IRQ3YMKSjWqowzCu5WRmiYKi6VfDu0c6jBMuLe3Bb5
+WWXzgC4H6BapsDIPdfcrdjt99ggywasO+6GSlFX4MlhEHoUOcpFfr+gQBMzrp2lpPVA0h3wM0YU
2klDB4hWeZoHAgOwblxOXsYQO/rxr3NYvj1aqQuJD+mrA3GxuyAW/g/+nAQHRfUEs4i2W3r1T1AP
oJRt2BPSEy+KfANB0mQ+MNciacQySi3DFhqe1cx+IOzDvBxnqCuwq6dwI/vCVRJ/UCIjuuqqZOgH
daZo18uAfIqkIfcZLVl5XTtsFf5LJLlSL5HUL/Lrfa6rWyuPKFsh+Ko8HhN+oBAIM5mShlqC7cgI
vVxcwWd7uJcnVjSFQxbpoVDF7ZMq4e6jx7R1xsxbyUIYhcZReI5qLBgpS5B6lcrkzZxDwf+OXhs2
YMkN/b4lH4xCHOXb0Eh9UNFZs7Cg11mY5GShBtCHm2wCi+AOZ04VtxQyDHCrKam51mh0WinWY0GB
dWIAGkRvTeaU15gld48CkGoQdAv6oD53n4jZ/mvi1RBdxDnDdrQkxgRTOpHV1TbW4U4S6OszS1LH
/fq5SbpuC75rZP3VTmyJTWLE1IeMmD9wIdNJil8Ltvb9rUB2+5oBcAFr5lralCjtvn4rjX+x/UW7
5dZy7nV5f3a0IcHGf5sLb74AXNKtV8jSrKBpGzR0paIQ3T9L95WigHAq9TS/vChG8rb7oganwhQu
ESOZqZzSxMVJp2q0mh40plJ1/mFyiKiaMBTvDO6EnRT5X/o+yzWbXBeTsYiUKGu/g/WlcdWnlOsl
4/VT6JmJnbhj6pcxd+lu5G8Ohlq9whFbu0UDkqKE/QaH4D0AIqlEFcYExNIpJZ0Xn05AIy5wx1Kz
bOxZzQt4pIaYray8YEpf0OlPLBP65C9/TXkuBmrnRZH77b+Np4PToqczMyodYZpoUVfHT/J/8aJT
GA8+O1BK9Nt1NGh9N16A/KGEEDuhSuW+7mH6vJ/K5y350A5vUJsCygYC06RjIFMfej/j35Mdogj7
QfVZfNIr1/DEDex6nIut3Cw0sZUYJreLq1MrUXf5RrcDFyWAL3s2SQwWNuCJvK4v/KnwycBQApEz
rpHHeEGLeT45xDd9FlwZdSpcw3h80wwTJA4b6AKQ8N45Jml9mDA1AEmSiKH6GzzqIuPb4KVvnkvV
eAnMFE2vsca01YzFKHgkakxv8eLQDyCVzVgfTTT0v82Omx09Xv7din3cX8BErJ0Spxvuw4GUTQdL
ooZPI/yudC9bgmkVCsmrLsokSypRmOmegBj3BV6xUYtkaKk7FpUsNDNlYRDp/+/XPeHPs8HCSzK0
a7OWqERgLFwZ2pqMEVvzdIBAYcBBtZ8RKC3XCHlpjh8MZfm9jQej02+r+5H7iGpZqyytIUKbEyL8
sAXynycttAxQdMwS9dq8kadYi6F07zPBmi7HRYNeGr9J5DK1ilKoO9GZwKWY2UYLTBYBqArtlujv
c0v9A91TARqPwL5x9o+KnpDEEsc1CTFB73u24S4dY9SuAWX/MhVwIvebB03u/Kmev6+3KFnfe4rd
IrayiCzqw2kAEXFjDC5EghPimsdZUghU8nLRmCjVKMMfBblDTJuBn/88yjtDmyYtdF6LWuXT5HHJ
c3YVTBKZmtHMdx/naR8RMfD8Bab4P3G2rxMoHDoHi2Wl2hcwuox/e+QxQSLGitZoFsR5Ckom0fMP
I1CoEP1wGczFv2vnR1Ao35GqbsuFF8tin/XaeWkc8W8Y3L5HJ+x6zWh8UOZSVdngktghatRaFrcg
F24au4yOijhpa3rlpRiUO5S1Yb6KkUhx1Js+mUKqh5NJkyYXSvYWqDqG1B23bCsiJMTSmMZRafki
XgonddQ494duc9Y0qVM+sqH3kO16u1Jk03bDcMjegvlM3yHuzFJ/E6ChxfD7HfSvbXe3c+Zmhj0I
/2DhqYuT/n98cvDNUw6t1FpdvJoyoC9Gh8o7bQAeMvCqnH4mEHbv8rivROE7Ad6cwn3+42v+jlYG
dZ1f4GeOiHY1d1MyQftk0kJ0MDB9soLDjMuZb2cX6vOG5JM9DCVZVJnnfGVkR/1HajhoRUFu7erl
iBJEZjRVqymj0X8ym9U86rOtvEIgYRSMsUVZSkbBmiQrbtfAoycEkLed2pG3DLfj2Z42TEthiuNd
DFhVjKR6DtoCh9L7OHHVg2Ar/YqBARyOEPtwF7eNTmOn3+wLx3UAPrAu92pv2pkc/HInYd74pUjd
dnIrwycs32IHTTy3Vt7tzOPcMT/FvWbQMn72UXv+7Vz80Q1+NjqTUjDiSAj7JiLS44IJMYj9oc6o
SrkYByUgZGetbeUI+c1hj5PoRJn+nY3qAm30NhtcssisbvfEkTfjQfNAGWhhmh0h54WdVEssQQRs
kg5lRctMsMEpiFwXcXcJ/0ibEDTKRCApF1g7ygGsyeRFit/LcJ8XO7NRMnEB1D5j86QSKI9J/bm8
uAAlrqbpH4dPuffc4qUZuux6Q8JbQCqj8dhBkUwNt0WOouMiiMr/odc9uXzkzUUKXvXzxPOwtUNV
daKs048gEUkL5j/XfEaK9GRc4yCos0bfqZI73IbsKqa6koSxCFFJkkp9S+2RsJJx+yyp5cnUvvz3
MRcChDMXdST2ozWHE9XG2fNgLWQnCNBGiAB/76lBLcC8giicWfyp6Cb1HTqRIZznWExb0GRMm5yJ
srQzgr1VTQunnrUEGjh9+2cmT2l+TL0iu4H1Pw6DapYs3eyPIUHt0xZO49tSCxGpbfp5+aSFWwNR
VFSwVbjHFI0KcnVmhSm+pBhQTJdCPcv+D+Z26A3HTuNFN8hIdx4V9NUugdZBbL++S20+/zU7YN1H
tDuIpGIRqj/P7/J0xDeuF4osGrHnyOrjdo7eDEWzRt45fx+gRnq7j+D1T5WRYuqrBazJRVGRxsx/
KrdOLPDbKxWytS9xlm0FS3QOowqHSBRfP8DQL9tHImqza2wFwi1xbU6vA/LHVeOchP860eivNVU+
L5vjYVc/KggMKVpX6dbIB+lg0WI1gZvwZLDrU7qAP+hwHYGTts4Su+IcOjBI9k57CktQfs808T6N
NUGiffJSOh/9T4uhwtkXIjgwZbxX7xxs6ed979uQ5u9c6fTraW95kg4XZGZbQERzSiJrivHEHjWe
UZPmx8Exy3uhVyxnC3+Lnp6WQA7i+XbRQ7eztjfbeeDDdl8W33vNkClBmVRmgk2+AiIob2O0VgR3
WKgAmMdmTUDPbMItEbSe2DHHUZb22cktGqdoyfxPphWeXVfMgO5hPG/RlzRsLr7cXO84FiVkil30
1+BVu7JTKOB6cgxAyIaG353R3f4fgmR4udnZtHSeQscKcrnXiSXeTPmRbndtoNwrKsO5+uM9WAbX
zhwhkCgCE2x/V0wx9a1/21nn4QLoMMy/v3hiMgXROA2QsDidenhIqxzA1sNagcNm06I9vnfptdMA
0vT62p0tJWfXtkcfjG26FnFLNHoIHg/HNZQGzHbFXsYyN5Cx0T96b8f45zieQSjR2N7kevqvOYE5
HU5cpue//uJp5m4kOm9bXD9hnda8PVvjQQ7HTEc8esjxd9vzyIdHRxQgP2TtYU5QXlUCJgc7vwgI
g1iEU7sftKZ1rjMxa8TWGoVc2+GX8PJ7Jm6xPmUQnCAq3WNSRt1tSuz8iwfoMsN82grp6LkYYzmQ
nfYYSGhBaQcdajyA7LJQGik/aA785bY6DIK51+YuS68N01MEgmI8X8zkKt8cIpLn8yhYpOnI6uIx
wHLmByBN3X/rnRQTnQaC+nyYa53QjNxZOREqXKihtEwESZHpX/vFp8NDQU7U/1D4sq8fSpRmIHdk
+m9NrF6ksSesVsMpO1wZ8Av56jaLFY9QdI1UeFJ5m2HMLaPI6QHTf6LgMXAqhMcUdNPfJ8KIlTH0
IS0iDiYCSqTRor6tRBUGjE7D2b9aWrPMUhGfHcVqbpFs1vZBb5nQTATKCaHuUwnLAHkc/m1FrlUr
+6dz/vKeOjALRnJuiKMXq2kbd6f+CaX5YV5ySrPvjhvvzw+3nOE+KNlnnZPnLRaTJPBXWelrdm4q
SLEFxBfCQOch9mE5X8RNljOclTXnnb/nBGy0YXI0Q2z+hgGLza5YLSUWj4xC33A5V6V6UjrvTm9J
EFWXwBvUMjzTZv/dP5zup4j7ywGQf+sBFIWQyG87nofhedZJU8xP/u+2XXEk6VxY9MCYhf0t/Sf2
34MT7BJf8quFxXagOEAk14oOQicPuDKiVhcYuso4abUtqmBtluCrWz+68zsHk3/d60zZho8lQFw9
0swhdt5vR+V63UTkRE+s7u0P+FbN5Mk0FXYbz5IaABUuEyxMRCqpvAug11Uc8c+/Udr5jLtUWu2B
MF2UDCUiroGUP1CV7iccOWSALrSKbnnBo8f+BVIufS8ynkjjRHpxZJbk0rol1ExeydRVDcqGUjLR
XRDtyWTnxHhXabrEZgFECium20JJQu603mrinDkXkaLgu7LWYkJguYSYyOpJQxqwGL381dpY4TK0
YqUB+j3btM8mJX7YOZPozH5Va98qYWf2qZsaoDVIdoL7IE5zV+sdejUehsZQLAARWRQeoIxSSDrI
P5VpKkmotn6r+hPiwsJbYW3ooPjabqo+SEHfb5WJ/WJdRQXLaGeP3ZFKs4IHnfANTG3q/gJbY2pk
TcyEJLArHWN/EVN9eXMu4e5bgLSJr3olXH4J4hRpHBWVngZHbvwLlrB7Vb34T7RccXrEKT4irTTn
aGGFGBy9FtNr25nkJNdaXnkX5Ue73VISQ/gwjFVdPYiRc0De+bgjWO0swV1FlMwp4eI81qrOUgYz
5fHELTCMWMezRj19VomUFIpDFknYnrL+PgCCkB65IHc/fhvWsNJuGuZ/2EBPKJXqDWsJSGQX24nd
PCPgWlv41yWFNB9zza007v0vuU9LcAYV+u/Clhqs+C0n2NqsoQYQ92xT+kD3+30+Kqft0itIBWL7
fuzmQl9n1ibeMhJNuEZSsnrJAbfa1Tg4dR0/AbLNaNueD22HaLpzRMNHYVFqom3cMTIv0WHuuAIK
NxOBB0m7no1EUpjoUkxRE7UHiau4REBh+imlf2TgTfbHdW65AWDJOI4mSxvXwiRaXH36fplq6Z+p
5IrBYSI5YeH5oVWlUnLJ/Pq/jrxTcgl0hf9KYTwUK1ktmy0/d5VayBXUa4a5VDcR3BIvlrXyh9XZ
XsKCwzRyAznQNNG2vo57ErNJ2ADbT+48H2KNsPDVPJD/mb2RldPTIs459e/27O3GUvFrZnkg2s